|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J Biol Chem, Vol. 273, Issue 14, 8009-8016, April 3, 1998
From the Targeting protein or RNA moieties to specific
cellular compartments may enhance their desired functions and
specificities. Human immunodeficiency virus type I (HIV-1) encodes
proteins in addition to Gag, Pol, and Env that are packaged into virus
particles. One such retroviral-incorporated protein is Vpr, which is
present in all primate lentiviruses. Vpr has been implicated in
different roles within the HIV-1 life cycle. In testing a new
hypothesis in which viral proteins are utilized as docking sites to
incorporate protein moieties into virions, we used the peptide phage
display approach to search for Vpr-specific binding peptides. In the
present studies, we demonstrate that most of the peptides that bind to Vpr have a common motif, WXXF. More importantly, we
demonstrate that the WXXF motif of uracil DNA glycosylase
is implicated in the interaction of uracil DNA glycosylase with Vpr
intracellularly. Finally, a dimer of the WXXF motif was
fused to the chloramphenicol acetyl transferase (CAT) gene, and it was
demonstrated that the WXXF dimer-CAT fusion protein
construct produces CAT activity within virions in the presence of Vpr
as a docking protein. This study provides a novel potential strategy in
the targeting of anti-viral agents to interfere with HIV-1
replication.
Human immunodeficiency virus type 1 (HIV-1)1 is a member of the
lentivirus family. HIV-1 has a complex viral life cycle and utilizes
multiple cellular and virally encoded regulatory proteins to tightly
control its replication (1). The essential retroviral enzymes, reverse
transcriptase, ribonuclease H, protease (PR), and integrase, lack
cellular counterparts and have been used as targets for developing
agents that inhibit virus replication (2-4). Despite considerable
advances in anti-reverse transcriptase and PR therapy, it is obvious
that ongoing genetic changes of the virus can confer drug resistance
(5). This problem has led to proposals for alternative therapeutic
strategies.
Specific cellular compartment localization of therapeutic moieties
influences their desired functions. Cytoplasmically localized anti-HIV-1 integrase single chain variable fragments inhibit HIV-1 infection of T-lymphocytes more potently than anti-integrase single chain variable fragments that are concentrated in nuclei (6). As well,
functional ribozymes have also been tested by targeting these moieties
into murine leukemia virus virions in comparison with cytoplasmically
localized ribozymes (7). The concept of incorporation of foreign
proteins into retrovirus particles has previously been reported,
utilizing fusion with HIV-1 Gag and Vpr (8-12). Sorting of most
cellular proteins into specific cellular compartments is determined by
protein-protein interactions through specific domains (7). Membrane
protein docking with target protein signal domains can incorporate
target proteins into either the Golgi apparatus or mitochondria (7).
Applying this target protein docking model for further molecular
analyses is now possible due to the development of the phage display
system.2 Short peptide
libraries can be generated, and panning against any target protein for
searching specific binding peptides can be accomplished. By engineering
the target protein binding peptide into specific protein moieties, it
should be possible to deliver the binding peptide protein fusion
moieties into specific cellular or viral compartments.
HIV-1 encodes proteins in addition to Gag, Pol, and Env that are
packaged into virus particles. These include Vpr, which is present in
all primate lentiviruses (14). The virion-associated protein, Vpr, has
been studied extensively with respect to understanding its role in
lentivirus infection. Vpr is expressed relatively late in the viral
life cycle and encodes a 14-kDa protein (15) that is predominantly
localized in the nucleus of infected cells (16). Vpr has been reported
to be incorporated into viral particles at molar quantities (16, 17).
The carboxyl-terminal domain (p6 region) of the Gag polyprotein
precursor, p55, plays a role in the packaging of Vpr into virions
(18-21). None of these publications have shown evidence for a direct
interaction between Vpr and p6 proteins. Recently, several groups have
shown a direct interaction between Vpr and the nucleocapsid protein, p7
(22, 23). Roques and co-workers (23) show that the interaction between
Ncp7 and Vpr occurs in vitro by a recognition mechanism
requiring the zinc fingers of Ncp7 and the last 16 amino acids of Vpr
(23). The authors suggest that Ncp7 cooperates, possibly with p6, to
induce Vpr encapsidation in mature HIV-1 particles (23). Several
biological functions of Vpr have been defined. It has been shown that
Vpr is essential for optimal infection of macrophages (24-26). Vpr has
been reported to influence the nuclear transport of the viral preintegration complex (27). Vpr activates transcription from the HIV-1
long terminal repeat (28-30), influences terminal differentiation of
some cell types (31), plays a role in the reactivation of viral gene
expression, as demonstrated by addition of exogenous Vpr to cultures of
latently infected T cell lines (32, 33), and causes blockage of cells
in the G2 stage of the cell cycle (34-37). Recently, Chen
and co-workers (38) showed that Vpr is capable of inducing apoptosis
after cell cycle arrest. Other recent studies indicate that the Vpr
protein can also associate with cellular proteins, such as
glucocorticoid receptors (39), the transcription factors Sp1 and TFIIB
(28, 30), or the uracil DNA glycosylase (UDG) enzyme involved in
cellular DNA repair (40).
Since the highly conserved HIV-1 Vpr protein can be packaged in
quantities within virions similar to those of the major structural proteins, this accessory protein may be used as a docking target to
deliver anti-viral agents or other foreign proteins to progeny virus.
In an attempt to understand how Vpr can interact with different viral
and cellular proteins that are implicated in diverse virological and
cell biological pathways, we used the "peptide phage-display" methodology to determine whether any common binding motif is shared among those proteins. We demonstrate that most of the peptides that
bind to Vpr contain a common motif, WXXF. In this report, the domain-specific intracellular interactions of the WXXF
with Vpr were further confirmed by utilizing a variety of complementary systems. Finally, to evaluate the feasibility of this peptide-based docking strategy, we have constructed a WXXF-CAT fusion
protein and analyzed the ability of this fusion construct to be
packaged into HIV-1 particles through interaction with Vpr. Our results show that the WXXF-CAT fusion protein is incorporated into
HIV-1 particles through a Vpr-dependent docking mechanism.
This study represents a new approach in the targeting of anti-viral
agents with the ability to potentially interfere with HIV-1
replication.
Plasmids--
The HIV-1 molecular clones used in this study
included pNL4-3 (41) and pNL4-3 His-tag Vpr Purification--
Baculovirus expression vector,
pACHis-SV-A-Vpr, was used to generate the recombinant
Vpr-baculovirus.2 SF9 cells were infected with Vpr
baculoviruses (1 × 108 colony-forming units/ml). SF9
cells expressing His-tag Vpr were harvested by centrifugation. The
cells were suspended in binding buffer (20 mM Tris-HCl, pH
7.9, 0.5 M NaCl, 5 mM imidazole). After sonication, the cellular debris, which contains most of the expressed Vpr, was collected by centrifugation at 20,000 × g for
15 min and washed with binding buffer. The pellet was then dissolved in
binding buffer containing 6 M guanidine and incubated at
room temperature for 1 h. Insoluble material was removed by
centrifugation (20,000 × g, 20 min), and the
supernatant was mixed with 1 ml of pre-equilibrated His-Bind resin
(Novagen) and incubated at 4 °C for 1 h with gentle rotation.
Nonbound substances were washed from the resin with binding buffer
containing 6 M guanidine, and the binding protein was
eluted with binding buffer containing 6 M guanidine and 0.5 M imidazole. After dialysis against water, the eluted
purified His-tag Vpr was precipitated and resuspended in
phosphate-buffered saline.
GST Fusion Protein Expression and Purification--
The
pGEX-GST-VPR was constructed by inserting a 304-bp
BamHI-HindIII fragment containing the
vpr gene via BamHI-HindIII sites of
pGEX-KG (44). The expression of the GST-Vpr fusion protein was
performed as described previously (45). Protein expression was induced
with 0.1 mM
isopropyl-1-thio- Phage-display Peptide Screening--
A phage-display peptide
library kit (New England Biolabs, Beverly, MA) was used to screen
binding peptides. The kit contained a heptapeptide phage-display
library. For phage panning, 50 mg of purified GST or GST-Vpr fusion
protein was directly applied to 50 ml of glutathione-agarose gel. After
a 30-min incubation at 4 °C, the gel was washed with TBST. The phage
library (2 × 1011 plaque-forming units in 250 ml of
TBST) was added to the GST-containing gel, mixed, and incubated at room
temperature for 1 h, then centrifuged at low speed for 2 min.
Supernatant was washed with 250 ml of TBST. The nonbound phage was
added to GST or GST-Vpr fusion protein at equal amounts. The mixtures
were incubated at room temperature for 1 h then centrifuged and
washed extensively with TBST to remove the nonbinding phage. The
binding phage was eluted with 100 ml of 5 mM reduced
glutathione in TBS (50 mM Tris-HCl, pH 7.5, 150 mM NaCl). The binding specificity between GST and GST-Vpr
was titered, as suggested by the protocol from this kit.
Yeast Two-hybrid System--
The yeast reporter strain, HF7c
(40) containing two GAL4-inducible reporter genes, HIS3 and
LacZ, was co-transformed with plasmids, pGBUDG and pGA-Vpr.
Double transformants were plated on tryptophan-, leucine-, and
histidine-deficient synthetic medium, and growth was continued for 3 days. A liquid culture assay for Transfections--
293T cells were cultured in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum at
37 °C. Transfections were performed by a standard calcium phosphate
transfection method (Promega, Inc.). 1 × 106 293T
cells were plated in 10-cm dishes, co-transfected with 10 µg of
pNL4-3 or pNL4-3 CAT Assays-- CAT assays were performed as described previously (39). Briefly, 1 × 106 transfected cells were harvested by centrifugation. The pelleted cells were lysed in 0.9 ml of CAT lysis buffer (Promega, Inc.) and 50 µl of supernatants normalized for protein content and used for standard CAT assays. Virions obtained from transfected 293T supernatants were concentrated by ultracentrifugation (20,000 × g for 3 h in a A-621 Sorval rotor) and purified on 20%, 65% sucrose gradients (40,000 × g for 16 h in a TH-641 Sorval rotor). Each fraction was quantified by measuring HIV-1 p24 antigen levels. Virions from the peak were normalized for HIV-1 p24 antigen and finally lysed with 0.3 ml of Promega CAT lysis buffer at room temperature for 15 min then at 65 °C for 15 min. Lysed virions were assayed for CAT activity. CAT activity was detected by thin-layer chromatographic separation of [14C]chloramphenicol from its acetylated derivatives and was quantitated by radioactivity counting in liquid scintillation. One hundred microliters of the lysed virions (p24 in ng/ml) was used in each CAT assay, with a fixed time of 3 h. Western Blot Analysis-- Yeast cells growing with similar density were lysed in radioimmunoprecipitation assay buffer, and immunoprecipitation of lysates was performed with a mouse anti-GAL4-DNA binding domain antibody (Tebu) and protein A-Sepharose beads. After washes in radioimmunoprecipitation assay buffer, bound proteins were subjected to 12% SDS-polyacrylamide gel electrophoresis, electrotransferred to a polyvinylidene difluoride membrane (Amersham Pharmacia Biotech), and immunodetected with a rabbit anti-GAL4 binding domain antibody (Tebu) followed by horseradish peroxidase-linked swine anti-rabbit immunoglobulin (Dako). Antibody binding was demonstrated with ECL Western blotting detection reagents (Amersham). Oligonucleotides-- Sequences of oligonucleotides used in this study are presented. Regions in boldface indicate restriction sites for each construct. Underlined regions indicate base changes from point mutations. 5' primer UDG1: 5'-AAAGAATTCCCCTCCTCGCCGCTGAGTGCC-3'. 3' primer UDG2: 5'-CCCATTGACTGGAAGGAGCTGTGAGTCGACTAAATC-3'. Mutated complementary primers UDG225: 5'-GGCTGGGAGCAGGGCACTGTGCAGTT-3' and 3'-CCGACCCTCGTCCC- GTGACTACGTCAA-5'. Mutated complementary primers UDG222: 5'-GAGCGAGGCGGGGAGCAGTTC-3' and 3'-CTGGCTCCGCCCCTCGTCAAG-5'. Mutated complementary primers UDG152: 5'-CATGGACCTAATCTAGCTCACGGGCTC-3' and 3'-GTACCTGGATTAGATCGAGT- GCCCGAG-5'. WF-dimer 1: 5'-CGGATCCATGCAGCCTTGGTGGGCTTTTTTTGGCGGCGGGAGCAGTTGGTGGTCTTTTTCGATGGGGCCCACGCGT3'. WF-dimer 2: 5'-ACGCGTGGGCCCCATCGAAAAAGACCACCAA- CTGCTCCCGCCGC-3'. CC-3' .96gIII sequencing primer: 5'-CCCTCATAGTTAGCGTA- ACG-3'.
Mapping of Vpr-specific Binding Peptides-- Phage display was used to identify peptides that bind to the HIV-1 Vpr protein. Purified and denatured His-tag Vpr produced from baculovirus was used by coating plates as the target protein to screen the binding phage for Vpr interactions. The His-tag Vpr showed a high titer of bound phage compared with bovine serum albumin alone after second round panning (data not shown). To increase the binding specificity of phage to Vpr, a third round of panning was performed and showed a high titer binding phage (P/n = 24.5). The positive clones (for binding with Vpr) were amplified. Phage DNA was purified according to the manufacturer's protocol and was then sequenced using the 96gIII sequencing primer. Fig. 1A illustrates the sequencing results. Analysis of these sequences demonstrated that 90% of these peptides contained a consensus motif, WXXF.
Binding of Vpr and UDG Mutants-- We recently reported that Vpr was able to bind tightly to and be coimmunoprecipitated with UDG (40), the major uracil DNA glycosylase in human cells (47). Examination of the human UDG amino acid sequence indicates that this protein contains a WXXF motif (amino acids 222-225). The region of UDG protein containing the WXXF motif is conserved between different species, as shown in Table I by alignment of protein sequences of uracil DNA glycosylases.
-galactosidase assays.
Detection of CAT Activity in HIV-1 Virions Based on Binding of WXXF-CAT Chimeras to Vpr-- We next tested the hypothesis that WXXF might interact with Vpr and dock fusion proteins containing this motif into HIV-1 virions. This was first tested by fusion of WXXF to the CAT gene. Of note, retroviral vectors are powerful tools for the transfer of new genetic information into target cells due to their high transduction efficiency (49-51). The plasmids used in this experiment are represented in Fig. 4. The pSLXCMV-VPR-CAT plasmid was used as a positive control. Incorporation of foreign proteins into HIV-1 particles has previously been reported by direct fusion with Vpr (8, 9). These authors demonstrated the capability of HIV-1 Vpr to direct the packaging of foreign proteins such as CAT into HIV-1 virions when expressed as heterologous fusion molecules. Virion-associated CAT fusion proteins remained enzymatically active. Based on our results in the yeast two-hybrid system and the studies of WXXF motif in the interactions of UDG and Vpr, we constructed a dimer of WXXF and dWF fused to the CAT gene. The amino acid sequence of dWF was based on the amino acid sequence of the peptides that bind to Vpr, located by peptide phage display (Fig. 1B). These two WXXF domains were joined by a linker (GGGS) to allow flexibility and proper folding of these domains. The dWF was amplified by PCR using WF-dimer-1 and -2 as primers and then fused in-frame with CAT. The final constructs were named pSLXCMV-dWF-CAT (Fig. 4).
VPR DNA and pSLXCMV-CAT, pSLXCMV-VPR-CAT, or
pSLXCMV-dWF-CAT. The ability of Vpr to deliver functionally active
proteins to the virus particles was confirmed by sucrose gradient
analysis. Virions obtained from 293T cell supernatants were purified on 20-65% sucrose gradients. Each fraction was quantified by measuring HIV-1 p24 antigen levels (Fig.
5A). Equal amounts of p24
antigen from purified virions, fraction 9 (density of 1.16 g/ml), were then tested for CAT activity. As shown in Fig. 5B, virions
from 293T cells co-transfected with HIV-1WT/dWF
demonstrated significantly higher CAT activity compared with the
virions from 293T cells co-transfected with HIV-1 VPR/dWF
(28% compared with 8%, respectively, lanes 7 and
8 of Fig. 5B). This CAT activity can also be
compared with CAT activity detected in virions from 293T cells
co-transfected with HIV-1WT/Vpr-CAT and to the virions from
293T cells co-transfected with HIV-1WT/CAT (37% compared
with 8%, respectively, lanes 5 and 6 of Fig.
5B) as positive controls. No difference was found in the CAT
activity for fraction 11 (density of 1.19 g/ml), which was comparable
to the background activity (data not shown). These results indicate
that CAT activity was primarily associated specifically to the HIV-1
virions. The cell extracts from 293T cells co-transfected with these
different plasmids demonstrated very similar CAT activity (Fig.
5B, lanes 1-4).
The highly conserved HIV-1 Vpr protein expressed in the late stage of viral production (15) and incorporated into virions (16) was an ideal target for testing the docking protein model for intravirion protein delivery. HIV-1 Vpr functional studies also show that this protein has a diverse phenotype via interactions with multiple cellular or viral structural proteins (22-28, 30, 31, 34-37, 39, 40). These multiple interactions indicate the possibility of Vpr-protein binding through specific domains, which may be carried in the different target proteins. To identify such potential Vpr-specific binding domains, random peptide libraries constructed in a phage-display system were used for initial screening. Subsequently, each of the identified Vpr-binding peptides were further confirmed by using the yeast two-hybrid system for intracellular interactions of Vpr and peptides. More than 32 different Vpr binding phages were identified after a third round of panning using both denatured His-Vpr or native GST-Vpr fusion proteins in different panning systems.2 Interestingly, the great majority of the peptides binding to Vpr revealed by these assays contained a consensus motif, WXXF. Intracellular binding of Vpr and peptides was subsequently confirmed from 10 selected Vpr-binding phage-displayed peptides by using the yeast two-hybrid system. Computer searching with the WXXF motif against protein data bases revealed several cellular proteins containing the WXXF motif. One of these, UDG, the major uracil DNA glycosylase in human cells (47), has been reported in our recent work and has demonstrated that UDG specifically binds to Vpr (40). More importantly, we now demonstrate that the WXXF motif of UDG is implicated in the interaction of UDG with the Vpr protein, as mutants of the UDG motif bind differentially to Vpr. The mutant F225G lost its ability to interact with Vpr, and the mutant W222G lost more than 60% of the binding with Vpr. However, we could not exclude the participation of the first or second X of the WXXF motif in the interaction, since an appropriate conformation of the WXXF motif may be important. It is unclear at present why Vpr interacts with UDG, a DNA repair enzyme. A recent report excludes the involvement of UDG in contributing to G2 arrest of cells. Mutational analysis of Vpr showed that binding to UDG is neither necessary nor sufficient for its effect on the cell cycle (52). UDGs and deoxyuraciltriphosphate pyrophosphatases (dUTPases) are thought to prevent the misincorporation of deoxyuracil into DNA during DNA synthesis. Since UDG is not involved in the G2 checkpoint, the hypothesis that association of Vpr and UDG may perform a role similar to that played by the dUTPases of non-primate lentiviruses is quite possible, i.e. the reduction of uracil misincorporation into proviral DNA. Recently, Turelli et al. (53) reported that dUTPase minus caprine arthritis encephalitis virus accumulates G-to-A substitutions in vivo (53). Mansky (54) reported that the vpr gene partially accounts for the lower than predicted in vivo mutation rate of HIV-1. A vpr-negative shuttle vector had an overall mutation rate as much as 4-fold higher than that of the parental vector (54). We recently reported that TFIIB, a basal transcription factor, binds to Vpr (28). The portion of Vpr that interacts specifically with TFIIB ranges from amino acids 15 to 77. Also, it was indicated that the NH2-terminal domain of TFIIB is required for this interaction. Interestingly, we located the WXXF motif in the NH2-terminal domain of TFIIB. Preliminary data indicate that mutants of TFIIB, which have a point mutation in the WXXF motif, lose their ability to interact with Vpr (data not illustrated). Vpr has many different potential roles in HIV-1 expression. Vpr is able to transactivate several heterologous viral promoters lacking a common DNA sequence element (29). It has been shown that the addition of exogenous Vpr can reactivate HIV-1 replication in latently infected cell lines, indicating that Vpr could play a role in increasing HIV-1 expression through transcriptional or translational events (32, 33). Also, Vpr has been reported to influence the regulation of some cellular functions. Vpr induces terminal differentiation of rhabdomyosarcoma cells (31) and causes arrest in the G2/M phase of the cell cycle (34-37), and recently this viral protein has been shown to be capable of inducing apoptosis after cell cycle arrest (38). All of these effects by Vpr are probably mediated by interactions with cellular proteins. Our findings could assist in the screening of proteins that are implicated in these functions and have the motif WXXF. We have already demonstrated the potential implications of this motif (WXXF) for UDG and TFIIB in their interactions with Vpr. Because of the strict conformation of UDG, it is formally possible that other regions are important for the interaction with Vpr. UDG is an enzyme that is extraordinarily specific in its function and so must have a very strict and defined three-dimensional conformation (48). Recently, Chen and co-workers (55) demonstrated a weak interaction between Vpr and the cellular DNA repair protein, HH23A. The authors show that the carboxyl-terminal 45-amino acid region of HH23A interacts with Vpr. Interestingly, this carboxyl-terminal region has 2 Phe residues that are conserved between different species. This may explain the weak interaction of this protein with Vpr (55). Of interest, we show in Fig. 3 that the UDG mutant, W222G, lost 60% of its interaction with Vpr. Since the Vpr protein can be packaged into virions in quantities similar to those of the major structural proteins (16, 17), this protein has be used to target fusion proteins to progeny virus. Serio et al. (56) have generated a chimeric protein based on Vpr utilizing the conserved protease cleavage site sequences from Gag and Gag-Pol precursor polyproteins as fusion partners. Kappes and co-workers (8, 9, 13, 57) have generated chimeric proteins based on HIV-1 Vpr and HIV-2 Vpx, utilizing CAT, staphylococcal nuclease, wild-type and mutated HIV-1 protease, integrase, and reverse transcriptase. All of these reports use Vpr or Vpx as partners for chimeric proteins. As HIV-1 Vpr may functionally block the cell cycle, possibly involving the cellular apoptosis pathways, fusion proteins with Vpr for therapeutic purposes will be difficult to utilize, as this retroviral protein may (i) perturb viral replication, (ii) lead to difficulties in delivering a fusion protein in vivo because of competition with wild-type Vpr (or natural Vpr) and thus lead to viral escape, and (iii) interfere in cellular functions. In this study, a new strategy is proposed. HIV-1 Vpr was targeted as a docking protein, by which one could target anti-viral agents or any foreign proteins fused to the WXXF motif into HIV-1 virions. This is based on our demonstration that the WXXF motif in fusion with CAT is (i) capable of delivering the CAT protein into the HIV-1 virion by interaction with Vpr, and (ii) the CAT protein retains its enzymatic activity upon fusion with WXXF. Our choice in utilizing two copies instead of one of the
WXXF domain was based on our CAT assay comparison between
the dWF and WF motif of UDG. Virions from 293T cells co-transfected
with HIV-1WT/WFUDG demonstrated differences in
CAT activity compared with the virions from 293T cells co-transfected
with HIV-1 Development of target protein-specific docking delivery systems have broad potential applications for viral or cellular functional studies. Rapid generation of target protein-specific-binding peptide motifs using the phage-display system will provide critical peptides in different proteins. In this report, HIV-1 intravirion delivery was used as an example, but the same principle can be used for a variety of viral diseases. Utilizing combination protein-based intracellular immunization strategies, intracellular docking, and intravirion docking systems may dramatically enhance efficiency and specificity of these approaches. These data indicate that Vpr binds to the WXXF motif, and by interaction with this motif, one can deliver a fusion protein into the HIV-1 virion through a new docking strategy. The interesting features of the chimeric proteins generated here are the minimal addition of residues (22 amino acids) and the use of Vpr not as a partner for the fusion protein but as a receptor for docking to deliver this fusion protein into virions. This study illustrates a potential new strategy in the targeting of anti-viral agents into virions that may permit a feasible avenue to interfere with HIV-1 replication in vivo.
We thank Drs. Joseph Kulkosky and Hui Zhang for helpful discussions and Dr. Inder Verma for kindly providing the 293T cells. We also thank Rita M. Victor and Brenda O. Gordon for excellent secretarial assistance.
* This work was supported in part by United States Public Health Service Grants AI38666 and AI36557 (to R. J. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ The first two authors contributed equally to this article.
1 The abbreviations used are: HIV-1, human immunodeficiency virus type I; PR, protease; UDG, uracil DNA glycosylase; bp, base pair; CAT, chloramphenicol acetyltransferase; dWF, WXXF dimer; PCR, polymerase chain reaction; GST, glutathione S-transferase; WT, wild type; CMV, cytomegalovirus.
2 Y. Xue, B. Hu, Z. Yu, W. Li, R. J. Pomerantz, and L-X. Duan, manuscript in preparation.
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||