![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 14, 8137-8144, April 3, 1998
§¶,
,
,
,
¶
From the Departments of
Immunology and
§ Cell Biology, The Scripps Research Institute,
La Jolla, California 92037 and the ** Department of
Biochemistry and Molecular Biology, Georgetown University Medical
Center, Washington, D. C. 20007
| |
ABSTRACT |
|---|
|
|
|---|
p21-activated kinases (PAKs) are serine/threonine kinases that have been identified as targets for the small GTPases Rac and Cdc42. PAKs have been implicated in cytoskeletal regulation, stimulation of mitogen-activated protein kinase cascades, and in control of the phagocyte NADPH oxidase. Membrane targeting of PAK1 induced increased kinase activity in a GTPase-independent manner, suggesting that other mechanisms for PAK regulation exist. We observed concentration- and time-dependent activation of PAK1 by sphingosine and several related long chain sphingoid bases but not by ceramides or a variety of other lipids. Although phospholipids were generally ineffective, phosphatidic acid and phosphatidylinositol also had stimulatory effects on PAK1. Lipid stimulation induced a similar level of PAK1 activity as did stimulation by GTPases, and the patterns of PAK1 autophosphorylation determined after partial tryptic digestion and two-dimensional peptide analysis were similar with each class of activator. Lipid stimulation of PAK1 activity was dependent upon intact PAK kinase activity, as indicated by studies with a kinase-dead PAK1 mutant. Treatment of COS-7 cells expressing wild type PAK1 with sphingosine, fumonisin B, or sphingomyelinase, all of which are able to elevate the levels of free sphingosine, induced increased activity of PAK1 as determined using a p47phox peptide substrate. Studies using PAK1 mutants suggest that lipids act at a site overlapping or identical to the GTPase-binding domain on PAK. The inactive sphingosine derivative N,N-dimethylsphingosine was an effective inhibitor of PAK1 activation in response to either sphingosine or Cdc42. Our results demonstrate a novel GTPase-independent mechanism of PAK activation and, additionally, suggest that PAK(s) may be important mediators of the biological effects of sphingolipids.
| |
INTRODUCTION |
|---|
|
|
|---|
The p21-activated kinases (PAKs)1 are members of a growing family of Ser/Thr kinases whose catalytic domains contain significant homology to the STE20 kinase of Saccharomyces cerevisiae (1). PAKs have been implicated as regulators of MAP kinase cascades (2-6) and the phagocyte NADPH oxidase (7) through their ability to phosphorylate regulatory substrates in these systems. PAKs have also been shown to modulate the activity of the actinomyosin system in lower organisms and in mammalian cells. ATPase activity of the heavy chain of Acanthamoeba myosin is enhanced when phosphorylated by PAK (8), and PAKs have been reported to phosphorylate the light chain of mammalian myosin (9, 10). PAKs localize to cortical actin structures in growth factor-stimulated cells (11), and introduction of active PAK1 mutants into mammalian fibroblasts induces cytoskeletal reorganization, including a polarized phenotype characterized by membrane ruffling, extension of filopodia, formation of focal complexes, and loss of actin stress fibers (12, 13).
PAK activity can be stimulated by a variety of external stimuli that act via cell-surface receptors. These include chemoattractants acting on G protein-coupled receptors (7), growth factors interacting with receptor tyrosine kinases (11), cytokines (2), Fc receptor stimuli,2 and extracellular matrix molecules binding to integrins.3 In response to some of these stimuli, PAK translocates into a membrane fraction where it can interact with membrane-bound receptors and activators (11, 14). Whereas interactions of PAK with adapter proteins such as Nck have been implicated in translocation and stimulation of PAK activity by growth factors (14-16), the molecular mechanisms involved in PAK regulation by these and other receptors has not yet been determined.
Activity of PAK is dramatically stimulated in vivo and in vitro by the binding of GTP-Rac or GTP-Cdc42 (7, 17). These GTPases interact with a region at the PAK N terminus which contains the highly conserved CRIB motif described in a number of Cdc42/Rac-interacting proteins (17, 18). Binding of the active GTPase stimulates PAK autophosphorylation at several sites, presumably changing the protein's conformation and activity toward exogenous substrates (13, 19). An additional consequence of activation is increased binding of SH3-containing proteins to the PAK N terminus (12, 14, 15). The potential for other mechanisms of PAK activation in cells was established by the demonstration of PAK2 activation resulting from proteolytic removal of the regulatory N terminus by caspases during apoptosis (20). A recent study has also described enhanced activity of intact PAK as a result of membrane association initiated by introduction of a membrane-targeting sequence, although the mechanism through which membrane targeting causes activation has not been investigated (16).
In this paper, we describe the ability of specific lipids, particularly sphingolipids, to stimulate PAK activity both in vitro and in vivo. Lipids regulate PAK by a direct interaction that is independent of the action of Rac or Cdc42. Both PAK autophosphorylation and activity toward exogenous substrates are enhanced by active lipids. These results suggest that PAKs may be cellular targets of sphingolipids and may account for some of their biological activities.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials-- The lipids utilized in these studies and their sources are listed in Table I. Lipids were routinely prepared as CHCl3, ethanol, or Me2SO stocks, as appropriate for each type of lipid. Prior to use the lipids were dried under N2 and resuspended by sonication in a bath sonicator in 50 mM Hepes, pH 8.0, plus 1 mM EDTA or in Tris-HCl, pH 7.5, until a translucent suspension was obtained. In some instances (e.g. with Me2SO stocks), the lipids were diluted into the same buffer or added as a complex with 4 mg/ml bovine serum albumin. Mixed lipid vesicles were generated by mixing the lipid stocks in molar ratios varying from 1:10 to 1:3 prior to sonication in buffer. Fumonisin B was obtained from Sigma (F-1147).
Plasmids and Protein Expression-- PAK1 wild type and the indicated mutants were prepared essentially as described (12, 15) in the pCMV6M vector, which adds a 9E10 Myc epitope tag to the N terminus. The wild type PAK1 tagged with the C-terminal 17 amino acid farnesylation sequence of K-Ras 4B (KDGKKKKKKSKTKCVIM) in the pCMV6M vector was a gift of Jon Chernoff (Fox Chase Cancer Center). All other CAAX-tagged PAK1 constructs were generated by subcloning into the BamHI and NheI sites of this vector. Mutation of the terminal cysteine in the CAAX motif to alanine was by polymerase chain reaction amplification using a 3' oligonucleotide containing the mutated base pairs (5' CCGGAATTCTCACATAATTACAGCCTTTGTCTT 3'). The PAK1 ED mutant was generated by mutating all aspartic acid residues to asparagine and all glutamic acid residues to glutamine between amino acids 175 and 183 of PAK1 wild type. This was achieved by using internally derived oligonucleotides containing the mutated sequence in both the 5'-3' (5' CAAAATCAGAATAACAATAACAACAATGCTACCCCACCACCAGTGATT 3')and 3'-5' (5' ATTGTTGTTATTGTTATTCTGATTTTGTGAAACTGGTGGCACTGCA 3') direction. Polymerase chain reaction was carried out with vector-derived oligonucleotides to generate two overlapping strands containing the mutated sequences. These were then used as polymerase chain reaction templates to allow synthesis of full-length PAK1 containing the ED domain mutation.
Expression in COS-7 cells was performed by seeding the cells at 1 × 106 per 100-mm dish and then transfecting with 5 µg of the plasmid using LipofectAMINE (Life Technologies, Inc.). After 30 h, the cells were either utilized for in vivo experiments, or lysates were prepared for use in in vitro solid phase kinase assays (7, 15). Transfected cells were serum-starved overnight in Dulbecco's modified Eagle's medium containing 10 mM Hepes, 2 mM glutamine, 100 units/ml penicillin G, and 100 µg/ml streptomycin and then incubated with various stimuli for the indicated times. Cells (100-mm dish/stimulus) were then lysed in 250 µl of Laemmli sample buffer and used for in-gel analysis or were lysed in cell lysis buffer for immunoprecipitation, as described below.PAK Kinase Assays-- Solid phase PAK1 kinase assays and in-gel kinase assays were performed essentially as described previously (7, 15, 21).
Analysis of Membrane-targeted PAK1-- COS-7 cells (1 × 106 cells/10-cm dish) were transiently transfected with pCMV6 plasmids containing various N-terminally Myc-tagged PAK1 constructs, including WT-CAAX and HL-CAAX PAK1. As an added control, constructs were used in which the terminal cysteine residue in the CAAX sequence was replaced with an alanine to ensure that there was no effect of adding the additional C-terminal residues in the absence of membrane targeting. We verified the predominant membrane localization of the CAAX-tagged constructs by homogenizing the transfected cells in lysis buffer without detergent (see below) and, following a low speed spin to remove the unbroken cells, the homogenate was fractionated into a high speed (100,000 × g) membrane pellet and the cytosol-enriched supernatant. The relative localization of each construct was then determined by SDS-polyacrylamide gel electrophoresis and Western blotting for Myc-tagged protein in each fraction.
To evaluate kinase activity, cells were allowed to express protein for 48 h post-transfection and were then lysed into 500 µl/dish lysis buffer with 1% Nonidet P-40. Portions of each lysate were run on SDS-polyacrylamide electrophoresis gels and transferred to nitrocellulose prior to blotting for the expression of myc-tagged protein. The lysates (normalized for expression levels) were then immunoprecipitated with the anti-Myc antibody. In vitro kinase assays using 1 µg of MBP/assay as a substrate were carried out in 50 mM Hepes, pH 7.5, 10 mM MgCl2, 2 mM MnCl2, 0.2 mM dithiothreitol with 5 µCi of [
-32P]ATP and 20 µM ATP in each 100-µl
reaction (7).
Immunoprecipitations-- To immunoprecipitate PAK1 from COS-7 cell lysates, 9E10 Myc antibody was prebound to protein G-Sepharose beads (Amersham Pharmacia Biotech) by incubation overnight and then washed extensively in lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 5 mM MgCl2, 1 mM dithiothreitol, 1% Nonidet P-40, 10% glycerol). In activation experiments, 250 µl of lysate from cells (100-mm dish) activated with the indicated stimulus was incubated with 30 µl of a 1:1 slurry of Myc antibody-coated beads for 1 h at 4 °C, and then the beads were pelleted by centrifugation. The bead pellets were washed twice in lysis buffer containing 1% Nonidet P-40 and twice without Nonidet P-40, suspended in 100 µl of Laemmli sample buffer, and then analyzed by in-gel kinase assay.
Measurement of Sphingosine-- Sphingosine levels were determined by an enzymatic method as described previously (22) or by HPLC analysis (23) with slight modifications. Lipids were extracted with chloroform/methanol/concentrated HCl (100:200:1 v/v), and the phases were separated as described (22). For HPLC analysis, aliquots of the organic layer (approximately 50-100 nmol of total cellular phospholipid) were saponified by addition of 0.5 ml of 0.1 N KOH/methanol and incubation at 37 °C for 60 min. The reactions were terminated by addition of 10 µl of concentrated HCl, and samples were extracted with 1 ml of chloroform, 1 M KCl (1:1, v/v). The organic phases were dried under N2, resuspended in 50 µl of methanol, and derivatized with o-phthalaldehyde for subsequent HPLC analysis (23). Sphingosine was separated isocratically on a Cosmosil 5C18-AR column (4.6 × 250 mm, Nacalai Tesque, Kyoto, Japan) using a model 600E pump (Waters) with methanol, 5 mM Na2HPO4, pH 7.0 (60:40, v/v), at a flow rate of 1 ml/min. A model 420-AC fluorescence detector (Waters) was used to detect fluorescent derivatives with an excitation filter transmitting at a maximum of 340 nm and a cut-off emission filter at 400 nm. Sphingosine levels were quantified using the Rainin Dynamax HPLC software package (Woburn, MA).
Measurement of Cellular Phospholipids-- Total phospholipids present in cellular lipid extracts used for sphingolipid analysis were quantified as described previously (24) with minor modifications. Briefly, to dried aliquots of cellular lipid extracts, 40 µl of a mixture of 10 N H2SO4/70% perchloric acid (3:1, v/v) was added, and samples were incubated for 30 min at 210 °C. After cooling, 75 µl of water and 400 µl of 4.2% ammonium molybdate in 4 N HCl, 0.045% (w/v) malachite green (1:3 v/v) was added. Samples were incubated at 37 °C for 15 min, and absorbance was measured at 660 nm.
Two-dimensional Peptide Mapping--
Immunoprecipitated PAK1 was
incubated with 1 µg of GTP
S-Cdc42 or 200 µM
sphingosine and labeled with [
-32P]ATP, as described
above. Autophosphorylated PAK1 bands were separated on 6.5%
polyacrylamide gels, dried on HiDry hydrophobic drying sheets
(Diversified Biotech, Newton Center, MA), and detected by
autoradiography. Each band was separately excised from the gel and
resuspended in ammonium bicarbonate, pH 8.3 (50 mM),
containing trypsin (1.0 µg) for 14 h at 37 °C. The resulting
tryptic peptides were extracted from the gel pieces with Kontes
disposable pestles (Fisher) and centrifuged at 14,000 rpm in a table
top microcentrifuge, and the supernatant was lyophilized.
Two-dimensional phosphopeptide mapping of the tryptic peptides was
performed according to the procedure of Boyle et al. (25).
The lyophilized samples were resuspended in 2 µl of pH 1.9 electrophoresis buffer (2.2% formic acid, 8% acetic acid), spotted
onto 100-µm coated cellulose plates (EM Science, Gibbstown, NJ) in
0.5-µl aliquots, and electrophoresed for 40 min at 1300 V in a
Multiphor II horizontal electrophoresis unit (Pharmacia Biotech,
Uppsala, Sweden) in pH 1.9 electrophoresis buffer. Plates were
air-dried and chromatographed in buffer containing 62.5% isobutyric
acid, 1.9% n-butanol, 4.8% pyridine, and 2.9% glacial
acetic acid. 32P-Labeled tryptic peptides were detected by
autoradiography on Kodak X-AR film for up to 12 h.
| |
RESULTS |
|---|
|
|
|---|
Activation of PAK1 by Membrane Targeting Is Independent of GTPases-- The association of wild type PAK1 with the plasma membrane induced by the addition of a membrane targeting sequence caused increased activity of PAK1 toward an exogenous substrate (Fig. 1), as also reported (16). Activation did not occur in the absence of membrane association, as determined with a PAK1 construct in which the cysteine residue in the CAAX motif was mutated to alanine. Of particular interest, we observed that membrane association also stimulated the activity of PAK1(H83L, H86L), a form of PAK1 which is unable to bind Rac or Cdc42 (12). In contrast, a fully active PAK1 (T423E) construct was not further activated significantly by membrane targeting (Fig. 1). These data strongly indicate that PAK activation resulting from membrane association is at least partially GTPase-independent and may occur through a distinct mechanism. We therefore investigated the possibility that certain membrane lipids may have the ability to directly stimulate PAK.
|
Stimulation of PAK Activity by Sphingolipids--
We observed that
sphingolipids were able to dramatically stimulate the Ser/Thr kinase
activity of PAK1. As shown in Fig. 2, sphingosine and several related long chain sphingoid bases were able to
increase autophosphorylation of PAK1 in an in vitro kinase assay to levels similar to that achieved in the presence of
GTP
S-loaded Cdc42 or Rac1. A concentration-response curve for PAK1
activation by sphingosine is shown in Fig.
3A. Stimulation of PAK1 was
observed at sphingosine concentrations as low as 10 µM
and peaked at ~200 µM lipid. PAK activation was
observed with sphingosine obtained from several commercial sources and
with the lipid prepared in several different buffers, in Me2SO,
or when suspended with bovine serum albumin. Sphingosine was also
effective in stimulating PAK1 when presented in the form of a mixed
phospholipid micelle, either with phosphatidylcholine or
phosphatidylethanolamine (Fig. 2C). Stimulation by
sphingosine was not stereospecific, as each of the
DL-erythro or
DL-threo forms produced similar
levels of activation. Even dihydrosphingosine, which lacks the
4,5-trans double bond, or phytosphingosine, which contains
an additional hydroxyl group, stimulates PAK1 in vitro. In
contrast to sphingosine, the sphingosine precursor
N-acetylsphingosine or ceramide was inactive, as were a
variety of other structurally related and unrelated lipids (Fig. 2 and
Table I). In particular, the inability of
sphingosylphosphorylcholine and octylamine (not shown) to activate PAK1
suggests this was not a general effect resulting from the presence of a
highly positively charged group associated with the lipid backbone.
|
|
|
S resulted in the
formation of three distinct species of PAK1 with slightly varying
migration on the SDS-polyacrylamide gels. These represent variably
phosphorylated forms of PAK14
whose formation correlates with increased activity of PAK toward exogenous substrates. Interestingly, activation of PAK1 with
sphingosine only resulted in the formation of the two faster migrating
phosphorylated PAK species (Fig. 2A). This modification is
sufficient for sphingosine to effectively stimulate phosphorylation of
a p47phox-derived peptide substrate by PAK (Fig.
2B), as well as intact p47phox protein and Nck (15).
However, when PAK1 was activated by sphingosine we were unable to
detect effective phosphorylation of myelin basic protein, which serves
as an excellent substrate for PAK1 when it is activated by Cdc42 or Rac
(7, 17). We are uncertain at this time whether this represents a real
difference in the ability of lipid-activated PAK1 to utilize certain
specific substrates or whether this is a competitive effect of the
lipid with the MBP substrate. This could also be due to differences in
substrate utilization by the differentially phosphorylated PAK1 species since, in contrast to sphingosine and related compounds, stimulation of
PAK1 by phosphatidic acid, phosphatidylinositol, and/or
monosialoganglioside GM3 induced the formation of all three
autophosphorylated PAK1 species, and these lipids also stimulated the
phosphorylation of both p47phox peptide and MBP by PAK1. For
reasons which are not clear, the action of phosphatidic acid and
phosphatidylinositol upon PAK1, while highly reproducible, was only
observed with very fresh lipid preparations, and their ability to
activate PAK1 was lost upon storage even under N2 at
20 °C.
The use of immunoprecipitated PAK precludes us from conclusively
stating that activation of PAK by lipids is due to a direct effect on
PAK1 itself. However, to address the possibility of a contaminating
lipid-regulated kinase that could phosphorylate PAK1 directly
co-precipitating with Myc-tagged PAK1 from COS-7 cells, we performed
similar experiments using several distinct PAK antibodies and using
different sources of PAK1. We used PAK1 antibody R626 (7), two other
PAK1 antibodies directed against distinct portions of
PAK1,5 or 9E10 Myc antibody
to immunoprecipitate PAK from bovine brain cytosol, human neutrophil
cytosol, or PAK1-transfected COS-7 cells. No sphingosine or
Cdc42-sensitive kinase activity was immunoprecipitated by the 9E10 Myc
antibody from brain or neutrophil cytosol, indicating that this
antibody did not nonspecifically precipitate such a kinase. The R626
PAK1 antibody and the other PAK antibodies, however, precipitated
sphingosine-activated PAK from all three sources, strongly supporting
the likelihood that sphingosine was acting directly on PAK itself. We
have also observed stimulation by sphingosine of PAK2 expressed in
COS-7 cells and immunoprecipitated via a distinct antibody directed
against its N-terminal hemagglutinin epitope tag. Finally, sphingosine
increases activity of a pure recombinant PAK1 (~99% homogeneous by
silver staining) that is already partially active in the absence of
activating agents (we have been unable to purify a completely inactive
recombinant PAK1) to an extent (2-3-fold) similar to that attained by
addition of Cdc42-GTP
S, again suggesting a direct effect of the
lipid on PAK itself.
Sphingosine-activated PAK1 Is Phosphorylated at Sites Similar to
Those Resulting from Activation by GTPase--
Fig. 3B
shows the time course for PAK1 activation in vitro by
sphingosine versus Cdc42-GTP
S. There was essentially no
difference in the time course for autophosphorylation with either
activator. Both sphingosine and Cdc42-GTP
S stimulated PAK1 to a
similar extent at optimal concentrations of each. In addition,
stimulation of PAK1 with sphingosine in the presence of Cdc42-GTP
S
did not induce additive PAK1 autophosphorylation nor additive activity toward exogenous p47phox peptide substrate, indicating each
stimulus alone was able to fully activate PAK1. When we
prephosphorylated PAK1 in the presence of sphingosine and unlabeled
ATP, then rephosphorylated in the presence of Cdc42-GTP
S plus
[
-32P]ATP, there was no incorporation of radiolabel
into PAK, suggesting that sphingosine had caused all the available
autophosphorylation sites on PAK1 to be occupied. We examined the
pattern of PAK1 phosphorylation when activated by GTPase or lipid by
two-dimensional mapping of tryptic peptides. As shown in Fig.
4, the phosphorylation patterns were
qualitatively quite similar. There was a single minor phosphopeptide
spot evident with Cdc42-GTP
S that was not detected with sphingosine
activation, and two additional spots seen with sphingosine activation
were not evident with Cdc42-GTP
S, but the pattern of the major
phosphorylated peptide species was identical. Differences in relative
spot intensity seen between PAK activated by Cdc42-GTP
S
versus sphingosine in Fig. 4 were not consistently observed
from experiment to experiment. These data suggest that the mechanism of
PAK activation induced by the sphingolipid is similar to that induced
by the binding of the GTPase.
|
Regulation of PAK by Stimuli That Increase Cellular Sphingosine Metabolism-- To determine if PAK1 activity could be stimulated by endogenous production of sphingosine, we treated COS-7 cells that had been transiently transfected to express PAK1 with either sphingosine itself or agents that would be expected to elevate intracellular sphingosine levels. As shown in Table II, treatment of the cells with sphingosine, fumonisin B, or bacterial sphingomyelinase all increased intracellular sphingosine content. Addition of 15 µM sphingosine to the cells stimulated the activity of several kinases when lysate was directly assayed using the p47phox peptide as substrate in an in-gel kinase assay (Fig. 5A). A prominent activity that comigrated with a constitutively active PAK1(T423E) standard was observed. Stimulation of this activity was rapid, occurring within 5 min of sphingosine addition. This kinase was not stimulated by the addition of 15 µM C2- or C8-ceramides nor by the addition of N,N-dimethylsphingosine to the cells. Similarly, treatment of the COS-7 cells with 5-10 µM fumonisin B, a mycotoxin that inhibits ceramide synthase and thereby blocks the acylation of sphingosine and sphinganine to form ceramide, for 10 min or with 1 unit/ml sphingomyelinase from Bacillus cereus for 30 min also caused a stimulation of this ~68-kDa kinase which was of even greater magnitude than was observed with exogenously added sphingosine. Cell viability was maintained at greater than 90% for all treatments.
|
|
The Site of Sphingolipid Action on PAK1-- To gain insight into the requirements for PAK1 activation by sphingosine, we evaluated the effect of this lipid on a number of PAK1 structural mutants we had generated (Fig. 6). Introduction of a K299R mutation into the PAK1 catalytic domain results in loss of PAK1 Ser/Thr kinase activity. Sphingosine had no stimulatory effect on the catalytically inactivate PAK, again consistent with a direct stimulatory effect of the lipid on PAK itself rather than via a co-precipitating kinase. When PAK1 was constitutively activated by introduction of the T423E mutation, there was no further stimulation of autophosphorylation by sphingosine, nor by GTPase. This supports the hypothesis that both stimuli induce activation by a similar mechanism.
|
S was dramatically reduced in the presence of as little as
10 µM N,N-dimethylsphingosine (DMS). This
inhibitory effect extended to both autophosphorylation and
phosphorylation of exogenous substrates (including p47 peptide). DMS
also antagonized PAK1 activation by sphingosine itself (not shown). A
number of other lipids, including C2- or
C8-ceramide, DL-dihydrosphingosine,
phosphatidylserine, and dimyristoyl-phosphatidylcholine, had little or
no inhibitory effect at concentrations up to 400 µM (Fig.
7). DMS thus appears to be a specific lipid inhibitor of PAK1
activation.
|
| |
DISCUSSION |
|---|
|
|
|---|
PAKs Are Lipid-regulated Kinases-- The data presented here describe a third physiological mechanism through which mammalian PAKs can be regulated, i.e. through the stimulatory action of long chain sphingoid bases and several other biologically active lipids. It has previously been established that PAKs are also regulated by two other mechanisms as follows: the binding of GTP-bound Rac or Cdc42 to an N-terminal p21 interaction domain (7, 17) and, in the case of PAK2, by the caspase-mediated proteolytic removal of the regulatory N terminus (20). Only three classes of lipid out of a large variety of lipids tested were capable of effectively stimulating PAK activity, indicating this is a specific process that is not due solely to cationic/anionic groups associated with the lipid moiety nor to nonspecific hydrophobic- or detergent-like properties of lipids in general. In fact, we find that PAK activity tends to be inhibited in the presence of most ionic detergents.
We have utilized immunoprecipitates of PAK1 for most of the studies described here. We cannot definitively rule out that there is not a second kinase which tightly associates with and co-precipitates cellular PAK1 that is in fact the target for sphingosine and the other active lipids, a finding which would certainly be important in itself if true. However, the following several lines of evidence suggest this is unlikely: 1) PAKs isolated from at least three different cellular sources with five distinct antibodies are all responsive to sphingosine; 2) autophosphorylation and activation of PAK1 by sphingosine is dependent on the ability of PAK1 itself to bind ATP and exhibit catalytic activity; and 3) a recombinant, but partially activated, PAK1 of 99% purity is stimulatable by sphingosine to an extent similar to that induced by addition of Cdc42-GTP
S.
There were similarities and differences in PAK activation by lipids
versus GTPases. Stimulation of PAK by lipid was not additive with activation by Cdc42 or Rac1, and the level of activity attained was similar with each class of activating agent. Tryptic mapping of PAK
phosphorylated by either type of stimulus indicated that the major
sites that became autophosphorylated on PAK1 were similar. However,
there was an obvious difference between the number of phosphorylated
species formed after stimulation by sphingosine (two) versus
Cdc42 (three). Interestingly, phosphatidic acid, phosphatidylinositol,
and monosialoganglioside (GM3) all induced formation of three
phosphorylated species that appeared to comigrate with the three forms
produced after activation by Rac1 or Cdc42, suggesting these lipids may
act somewhat differently than do the sphingoid bases. The ability to
induce formation of three autophosphorylated PAK species also
correlated with the ability of each stimulus to enhance phosphorylation
of myelin basic protein substrate by PAK1. Sphingosine did not
stimulate PAK1 activity toward MBP but did enhance the phosphorylation
of a p47phox peptide substrate, as well as of p47phox
protein and Nck. Whether this indicates differential substrate specificity for the different phosphorylated PAK species remains to be
determined.
Although we cannot determine the exact site(s) on PAK1 that activating
lipids interact with, several pieces of evidence suggest this may be
within or overlapping the p21-binding domain of the N terminus. We
observed that mutations in the p21-binding domain either enhanced
(H83L/H86L) or inhibited (Y107F, not shown) stimulation by sphingosine.
Additionally, the inactive derivative DMS effectively blocked the
ability of both sphingosine and Cdc42-GTP
S to activate PAK1. This
inhibitory effect was specific for DMS versus several structurally related or distinct lipids (Fig. 7). DMS represents the
first small molecular weight inhibitor of GTPase-mediated PAK activity
that has been identified. Previous studies have reported potent
inhibition of sphingosine kinase and protein kinase C by DMS.
Inhibition of these three kinases by DMS suggests that they might
possess similar sphingolipid binding domains. However, other data
indicate differences in the lipid interaction sites of these enzymes as
follows: D-erythro-sphingosine is a
stereospecific substrate for sphingosine kinase (26), whereas all
other stereoisomers of sphingosine, as well as sphinganine which
lacks the 4,5-trans double bond, stimulate PAK kinase
activity. Similarly, all stereoisomers of sphingosine, as well as
sphinganine, are equipotent inhibitors of protein kinase C (27). It is
also interesting to note that both PAK1 and sphingosine kinase,
although the former is a protein kinase and the latter is a lipid
kinase, are stimulated by acidic phospholipids such as phosphatidic
acid and phosphoinositols (28). Moreover, in diverse cell types,
sphingosine has been shown to uniformly increase the level of
phosphatidic acid either by activation of phospholipase D and
diacylglycerol kinase or by inhibition of phosphatidic acid
phosphohydrolase (29). Thus, sphingosine can also potentially act as a
positive feedback regulator of PAK activity due to its effect on
phosphatidic acid levels.
Regulation of PAK by Lipids: a Mechanism for Activation by Membrane Association?-- It is interesting to note that the Acanthamoeba myosin heavy chain kinase, which shares significant sequence homology with PAKs, has been reported to bind to and be activated by membranes and acidic phospholipids, particularly phosphatidylserine (30, 31). The activation of mammalian PAK1 by membrane association induced by the addition of membrane targeting sequences directly to PAK1 or to the PAK-interacting adapter protein Nck has been described (Ref. 16 and the current study). We show here that this stimulation of PAK induced by membrane association is not dependent upon the ability of PAK to interact with an activated GTPase, since stimulation of PAK activity also took place when mutation of the p21-binding domain of PAK prevented binding of Rac or Cdc42 (Fig. 1). Based upon our current findings, we propose that it is the direct association of PAK with lipids in the plasma membrane that stimulates its activity. This effect would potentially be regulated by agonist binding to receptors that stimulate the formation or metabolism of the stimulatory lipid species we have described here, most of which are believed to be largely present within the membrane rather than being cytosolic. We have shown in a previous study that stimulation of Swiss 3T3 cells with platelet-derived growth factor induces the association of PAK1 with a plasma membrane-enriched fraction, and this is associated with PAK1 activation and effects on the actin cytoskeleton (11). Platelet-derived growth factor is known to be an effective stimulus for the formation of sphingosine (28). It will be important to examine the role of sphingosine in growth factor-induced PAK regulation in future studies.
A Role for PAKs in Sphingolipid Signaling?-- Sphingosine and related long chain sphingoid bases have been implicated in intracellular signaling pathways regulating a variety of cell functions. Among these are regulation of cell proliferation and cell death (27, 32), modulation of phagocyte oxidant production (33), and effects on cell morphology, adhesion, and the cytoskeleton (34, 35). The latter is perhaps most interesting in terms of the possible involvement of PAK in sphingolipid signaling, since PAK is known to have regulatory effects on cell morphology and the cytoskeleton. Indeed, treatment of cells with sphingosine has been shown to stimulate the activity of several unidentified Ser/Thr kinases, including one with a molecular weight similar to that of PAK (36). Our data establish PAK(s) as potential downstream mediators of sphingolipid signaling and indicate that further investigation into the role of PAKs in sphingolipid signaling, as well as into the role of sphingolipids in PAK activation by physiological stimuli should be of substantial interest.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge the technical support of Pamela Hall, Yan Wang, and Wesley D. Scott and the editorial assistance of Antonette Lestelle.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grants GM39434 and GM44428 (to G. M. B.), GM43880 (to S. S.), AI35947 (to U. G. K.), and University of California Breast Cancer Research Program Grant 2RB-0229 (to U. G. K.). This is publication number 11092-IMM of The Scripps Research Institute.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Dept. of Immunology-IMM14, The Scripps Research Institute, 10550 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-784-8217 (G M. B.); and 619-784-9281 (U G. K.).
Supported by a fellowship from the Arthritis Foundation.
1
The abbreviations used are: PAK,
p21-activated kinase; GTP
S, guanosine
5'-3-O-(thio)triphosphate; DMS,
N,N-dimethylsphingosine; MBP, myelin basic protein;
HPLC, high pressure liquid chromatography.
2 Jones, S. L., Knaus, U. G., Bokoch, G. M., Springer, T. A., and Brown, E. J. (1998) J. Biol. Chem. 273, in press.
3 L. S. Price, J. Leng, M. A. Schwartz, and G. M. Bokoch, submitted for publication.
4 C. C. King and G. M. Bokoch, unpublished observations.
5 U. G. Knaus and G. M. Bokoch, unpublished observations.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Song, W. Wen, S. K. Rayala, M. Chen, J. Ma, M. Zhang, and R. Kumar Serine 88 Phosphorylation of the 8-kDa Dynein Light Chain 1 Is a Molecular Switch for Its Dimerization Status and Functions J. Biol. Chem., February 15, 2008; 283(7): 4004 - 4013. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Totaro, S. Paris, C. Asperti, and I. de Curtis Identification of an Intramolecular Interaction Important for the Regulation of GIT1 Functions Mol. Biol. Cell, December 1, 2007; 18(12): 5124 - 5138. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rider, A. Shatrova, E. P. Feener, L. Webb, and M. Diakonova JAK2 Tyrosine Kinase Phosphorylates PAK1 and Regulates PAK1 Activity and Functions J. Biol. Chem., October 19, 2007; 282(42): 30985 - 30996. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Sheehan, Y. Ke, and R. J. Solaro p21-Activated kinase-1 and its role in integrated regulation of cardiac contractility Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R963 - R973. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-P. Ching, V. Y.L. Leong, M.-F. Lee, H.-T. Xu, D.-Y. Jin, and I. O.-L. Ng P21-Activated Protein Kinase Is Overexpressed in Hepatocellular Carcinoma and Enhances Cancer Metastasis Involving c-Jun NH2-Terminal Kinase Activation and Paxillin Phosphorylation Cancer Res., April 15, 2007; 67(8): 3601 - 3608. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Schubert and C. G. Dotti Transmitting on actin: synaptic control of dendritic architecture J. Cell Sci., January 15, 2007; 120(2): 205 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Za, C. Albertinazzi, S. Paris, M. Gagliani, C. Tacchetti, and I. de Curtis {beta}PIX controls cell motility and neurite extension by regulating the distribution of GIT1 J. Cell Sci., July 1, 2006; 119(13): 2654 - 2666. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Grosshans, H. Grotsch, D. Mukhopadhyay, I. M. Fernandez, J. Pfannstiel, F.-Z. Idrissi, J. Lechner, H. Riezman, and M. I. Geli TEDS Site Phosphorylation of the Yeast Myosins I Is Required for Ligand-induced but Not for Constitutive Endocytosis of the G Protein-coupled Receptor Ste2p J. Biol. Chem., April 21, 2006; 281(16): 11104 - 11114. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Leisner, M. Liu, Z. M. Jaffer, J. Chernoff, and L. V. Parise Essential role of CIB1 in regulating PAK1 activation and cell migration J. Cell Biol., August 1, 2005; 170(3): 465 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. K. Misra, R. Deedwania, and S. V. Pizzo Binding of Activated {alpha}2-Macroglobulin to Its Cell S |