![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 14, 8268-8277, April 3, 1998
andFrom the Center for Oral Biology, School of Medicine and Dentistry, University of Rochester, Rochester, New York 14642
| |
ABSTRACT |
|---|
|
|
|---|
The initiation of mucin-type O-glycosylation is catalyzed by a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (ppGaNTase) (EC 2.4.1.41). By screening two mixed-stage Caenorhabditis elegans cDNA libraries, a total of 11 distinct sequence homologs of the ppGaNTase gene family were cloned, sequenced, and expressed as truncated recombinant proteins (gly-3, gly-4, gly-5a, gly-5b, gly-5c, gly-6a, gly-6b, gly-6c, gly-7, gly-8, and gly-9). All clones encoded type II membrane proteins that shared 60-80% amino acid sequence similarity with the catalytic domain of mammalian ppGaNTase enzymes. Two sets of cDNA clones (gly-5 and gly-6) contained variants that appeared to be produced by alternative message processing. gly-6c contained a reading frameshift and premature termination codon in the C-terminal lectin-like domain found in most other ppGaNTase proteins, and a second clone (gly-8) lacked the typical C-terminal region completely. Homogenates of nematodes and immunopurified preparations of the recombinant GLY proteins demonstrated that worms express functional ppGaNTase enzymes (GLY-3, GLY-4, GLY-5A, GLY-5B, and GLY-5C), which can O-glycosylate mammalian apomucin peptide sequences in vitro. In addition to demonstrating the existence of ppGaNTase enzymes in a nematode organism, the substantial diversity of these isoforms in C. elegans suggests that mucin O-glycosylation is catalyzed by a complex gene family, which is conserved among evolutionary-distinct organisms.
| |
INTRODUCTION |
|---|
|
|
|---|
The diversity of O-linked oligosaccharides displayed on secreted and cell surface glycoproteins is determined by the repertoire of glycosyltransferases present in the Golgi apparatus. The biosynthesis of mucin-type oligosaccharides at specific O-glycosylation sites begins with the transfer of the monosaccharide N-acetylgalactosamine (GalNAc)1 to specific threonines and serines of an apo-protein. This initiation event is regulated in mammals by a family of at least seven enzymes, known as UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (ppGaNTases) (EC 2.4.1.41). Four ppGaNTase isozymes have been cloned and functionally expressed from rodent and human cDNAs: ppGaNTase-T1 (1, 2), ppGaNTase-T2 (3), ppGaNTase-T3 (4, 5), and ppGaNTase-T4 (6). Evidence for three additional members of this gene family has been obtained, using a polymerase chain reaction approach.2 An eighth murine isoform having high amino acid sequence homology to ppGaNTase-T1 has also been suggested by nucleic acid cross-hybridization to a genomic library (7). Transcripts encoding specific ppGaNTase enzymes have distinct tissue patterns of expression, indicating that the acquisition of O-glycans can be regulated by differential expression of the ppGaNTase gene family. The substrate reactivity of the mammalian isozymes varies from those that are broad (ppGaNTase-T1) to those that recognize a narrow range of specific peptide sequences (ppGaNTase-T4); therefore, O-glycosylation of specific proteins in vivo requires the coordinate expression of polypeptide substrates and their cognate ppGaNTase enzymes. An analysis of the human and murine expressed sequence tag (EST) data base revealed numerous new sequence homologs, suggesting that an even larger and more complex family may exist in mammals (8).
The complexity and potential redundancy of the ppGaNTase gene family in mammalian systems is underscored by a ppGaNTase gene ablation study in mice, in which the deletion of an exon from a putative ppGaNTase gene produced mice that appeared normal and unaffected in their ability to O-glycosylate proteins (7, 9). The growing number of ppGaNTase isoforms isolated in mammals indicates that a genetic approach to ablating ppGaNTase activity in a murine model will be a lengthy undertaking.
In this present study, we have searched for a simple model organism that is suitable for using a genetic approach to study the roles of mucin-type O-glycosylation during development and differentiation. We selected Caenorhabditis elegans because nematodes express hyperabundant mucin-like glycoproteins and because C. elegans is amenable to classical and reverse genetic studies. In addition, the EST data base revealed numerous C. elegans clones, which encoded putative sequence homologs of the mammalian ppGaNTases, providing us with a system for identifying the size and properties of the complete ppGaNTase family in a whole organism. Biochemical studies performed here revealed that worms express ppGaNTase enzyme activity and that this activity is encoded by a family of enzymes. A total of 11 distinct C. elegans cDNAs (encoded by gly genes),3 containing complete open reading frames with sequence homology to mammalian ppGaNTase, were isolated, sequenced, and expressed. Two sets of these cDNAs appear to be splice variants. Functional analysis of recombinant worm enzymes demonstrated that five of the members of this family catalyzed the ppGaNTase reaction in vitro using mammalian peptides as acceptor substrates.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
C. elegans Homogenate and Extract--
C. elegans N2
worms were grown on 15-cm egg plates for 2-3 weeks, washed with M9
medium (22 mM KH2PO4, 22 mM Na2HPO4, 86 mM NaCl,
1 mM MgSO4), and harvested. Worms were purified
from debris by sedimentation overnight at 4 °C in M9 medium in a
graduated cylinder. The concentrated nematodes were diluted with two
volumes of 100 mM NaCl. Resuspended worms were mixed with
an equal volume of 60% sucrose and centrifuged at 2000 rpm in a SH3000
rotor (Sorvall) for 5 min at 4 °C. Floating worms were removed and
resuspended in a large volume of 50 mM NaCl and centrifuged
as above but only for 2 min. This final worm pellet was resuspended in
100 mM NaCl, incubated at 20 °C for 30 min, and then
frozen at
70 °C.
-mercaptoethanol). Worms
were disrupted three times with 1-min pulses, using a Mini-Beadbeater-8 cell disrupter (Biospec Products). One volume of this homogenate was
diluted with 10 volumes of H2O and centrifuged at
250,000 × g for 60 min. The pellet was resuspended in
230 µl of extraction solution (50 mM sodium cacodylate,
50 mM
-mercaptoethanol, and 2.5% Triton X-100) and
homogenized with a 1.5-ml tube plunger. After 30 min of rocking, the
tube was centrifuged for 10 min and the supernatant was removed and
saved. The pellet fraction was re-extracted as above, and the
supernatants were combined, mixed, and stored at
70 °C.
ppGaNTase Enzyme Assays--
Enzyme activity was measured
in vitro using the following assay conditions: a final
volume of 25 µl containing a final concentration of 500 µM EA2 peptide, 50 µM
UDP-[14C]GalNAc (25,000 cpm), 10 mM
MnCl2, 40 mM cacodylate pH 6.5, 40 mM
-mercaptoethanol, and 0.1% Triton X-100. Peptide
substrates (amino acid sequences in parentheses) used in these assays
are: EPO-T (PPDAATAAPLR), EPO-S (PPDAASAAPLR),
and EA2 (PTTDSTTPAPTTK) at a
concentration of 500 µM and TPPP at 1 mM.
Three µl of worm extract, purified bovine colostrum ppGaNTase (2), or
immunopurified recombinant enzymes were used in this standard enzyme
assay (Fig. 1). All enzyme assay points were performed in duplicate,
and these were repeated with duplicate enzyme preparations from worm
extracts or COS7 cell supernatants. Glycosylated
14C-labeled peptides were separated from unincorporated
UDP-[14C]GalNAc by anion exchange chromatography on
formate form AG 1x8 resin spin columns (Bio-Rad).
Data Base Analysis-- The amino acid sequence of the mouse ppGaNTase-T1 was used as a query to perform a TBLASTN analysis of the data base of expressed sequence tags (dBEST) (10). All EST sequences derived from the C. elegans data base were conceptually translated and aligned to the four known mammalian ppGaNTase isoforms, ppGaNTase-T1, -T2, -T3, and -T4. Any clone that contained at least three homologous segments (eight amino acids in length) with conserved spacing between each segment was treated as a putative homolog of the ppGaNTase family and used to generate a cDNA hybridization probe. Seven different expressed sequence tag (EST) clones (yk2f11, yk3 g10, yk15e11, cm13e2, yk151a8, yk72f6, and cm16e9) were selected for probe design (probes B for gly-4, C for gly-7, D for gly-6, E for gly-5b and -5c, F for gly-8, G for gly-5a, and H for gly-9). EST clones yk2f11, yk3 g10, and yk15e11 were obtained from Dr. Y. Kohara. EST clones cm13e2 and cm16e9 were obtained from Dr. L. Fulton and Dr. Robert Waterston.
PCR Amplification of Sequence Tags and Preparation of cDNA
Hybridization Probes--
Nucleic acid hybridization probes, specific
for each EST, were prepared by isolating polymerase chain reaction
(PCR) products of a 190-330-nt region in each cDNA from the data
base. EST clones described above were used as templates for amplifying
probes for gly-4, gly-6, and gly-7,
while first strand cDNA from mixed stage nematode total RNA was
used as a template for amplifying fragments of the remaining
gly clones. First strand cDNA was synthesized using a
First Strand cDNA synthesis kit (CLONTECH),
oligo(dT)18, and total RNA from mixed stage C. elegans N2 nematodes. The oligonucleotides used for the
amplification of each isoform is described in Table I.
32P-Labeled probes were generated using purified PCR
products, antisense oligonucleotides for cDNAs gly-4
through gly-9, and a PCR labeling protocol. Briefly, 30 ng
of PCR product was added to a 12.5 reaction mixture containing 1 µM primer, 1× PCR buffer, 1.5 mM
MgCl2, 50 µM dATP, dGTP, dTTP (each), 0.75 units of Taq DNA polymerase (Perkin-Elmer), and 5 µl of
[
-32P]dCTP (3000 Ci/mmol, NEN Life Science Products).
Reactions were amplified for 30 cycles at 94 °C for 40 s,
49 °C for 40 s, and 72 °C for 40 s.
cDNA Library Screening and Clone
Characterization--
Full-length coding regions for 10 of the
sequence homologs were obtained by screening two C. elegans
cDNA libraries: an oligo(dT)-primed cDNA library and a
random-primed cDNA library,
-ACT-RB1 and
-ACT-RB2, respectively (kindly provided by Dr. R. Barstead; Ref. 11). Seven
hundred thousand phage of each library RB1 and RB2 were plated onto
24 × 24-cm Nunc plates and a lawn of LE392 Escherichia coli cells. The plates were plaque-lifted using Hybond-N membranes (Amersham Pharmacia Biotech), and the membranes were hybridized overnight at 68 °C in 5× SSPE, 50% formamide, 5× Denhardt's,
0.1% SDS, and 100 µg/ml salmon sperm DNA, containing 3 × 105 cpm/ml of each 32P-labeled denatured probe.
Filters were washed three times for 20 min each in 2× SSC and 0.1%
SDS at the following three temperatures: 42, 64, and 42 °C. Initial
screening was performed with a mixture of seven probes for isoforms
gly-4, gly-5a, gly-5b,
gly-6, gly-7, gly-8, and gly-9.
Ninety-six positive plaques were cored, dot-blotted on multiple
Hybond-N membranes, and probed with individual isoform-specific probes,
using the conditions above. Twenty-one clones, corresponding to 10 different cDNAs, were isolated to homogeneity. Cre-lox excision of
the pACT plasmid from each
clone was accomplished by transduction into the E. coli strain RB4, which expresses the Cre
recombinase. CsCl2 quality plasmid DNA was prepared in the
RB4 host and used directly for infrared fluorescence DNA sequencing,
using Bca DNA polymerase in a Ladderman Core sequencing
protocol (PanVera) and a LICOR model 4000L DNA sequencer. IRD41
dye-labeled primers were designed for the pACT plasmid, using the
following sequences: PACT-F primer d(CTATCTATTCGATGATGAAG) and PACT-R
primer d(ACAGTTGAAGTGAACTTGCG). Both strands of clones
gly-4 through gly-9 were completely sequenced by
creating deletion from both the 5' and 3' ends of the cDNA inserts.
Radioactive DNA sequencing was used to fill small gaps in sequence
reads. Splice variants were completely sequenced on one strand, and the
alternative spliced region was sequenced on both strands. One splice
variant, gly-6b, was present on a partial cDNA, lacking
the first 151 amino acid codons. The full-length sequence of
gly-6b was obtained by using overlapping gly-6
cDNA clones. Similarly, the 5' end of the gly-5a isoform
was obtained by using overlapping gly-5 clones. The sequence
of the 11th cDNA, gly-3, cDNA was determined by
sequencing a gly-3 PCR product (using the primers in Table
I) and the sequence data in the GenBank data base from clones CE17E3
(EST) and ZK688.8 (genomic clone).
Design of Expression Constructs-- Expression constructs were designed such that the cDNAs were expressed as secreted recombinant proteins, lacking their natural N-terminal membrane anchors (for amino acid sequence, see Fig. 2). To clone all of the isoforms, a new expression vector construct, pIMKF3, was created. The SV40 promoter-driven expression plasmid pIMKF3 is virtually identical to pIMKF1 (6), except that the multiple cloning site was expanded to include four new unique restriction sites: ApaI, BglII, NotI, and SacII (Fig. 5). Seven cDNA clones (gly-3, gly-4, gly-5a, gly-6a, gly-7, gly-8, and gly-9) were introduced into the 5' MluI and 3' multiple cloning site of pIMKF3, creating the constructs pF3-GLY3, pF3-GLY4, pF3-GLY5a, pF3-GLY6a, pF3-GLY7, pF3-GLY8, and pF3-GLY9, respectively. The MluI restriction site was introduced into all constructs by PCR amplification of the stem region with a PCR primer (Table I, column two) and a downstream antisense strand primer in the 3'-untranslated region (UTR) or vector sequences (Table I, column four). Only the cDNA sequences encoding the full-stem, catalytic region, C-terminal coding region, and part of the 3'-UTR was present in each expression construct (the first amino acids used in the secretion construct are indicated in Fig. 2). With the exception of pF3-GLY3, the majority of the coding region was replaced by a restriction fragment of the cDNA clone obtained from the original library screen, such that the PCR-derived fragment was minimal in size. All PCR-derived sequences and cloning sites were completely re-sequenced to verify that no random PCR-induced mutations or frameshift artifacts existed in the expression constructs. Expression constructs of the "b" and "c" splice variants of gly-5 and gly-6 were constructed by replacing the 3' end of the cDNA in the pF3-GLY5a and pF3-GLY6a clones with the original cDNAs that contain the variant regions. These splice variant constructs were sequenced to verify that the sequence and reading frames matched the original cDNAs. The pF3-GLY6b construct was unstable in E. coli.
|
Transient Expression of Recombinant Proteins-- Recombinant enzymes were expressed by transient transfection of COS7 cells, using these pF3-GLY3 through pF3-GLY9 constructs and LipofectAMINE (Life Technologies, Inc.) as described previously (6). Briefly, 1 µg of supercoiled DNA and 8 µl of LipofectAMINE was used to transfect a 35-mm dish of COS7 cells at 90-100% confluence. After 5 h, 1 ml of Dulbecco's modified Eagle's medium containing 20% fetal bovine serum was gently added to the cells. Eighteen hours after the start of transfection, the transfection medium was removed and replaced with fresh Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and cells were grown at 30 °C for 2-3 days. Medium was harvested from these cultures and clarified by a centrifugation at 100 × g for 10 min. The transfected cells were washed with phosphate-buffered saline and then extracted by adding 500 µl Cell Extraction Buffer (20 mM MES, pH 6.5, 50 mM NaCl, 1% Triton X-100, 5% glycerol). The extract was clarified by centrifugation at 12,000 × g for 5 min.
Immunopurification of Recombinant Proteins and Analysis of
Expression Levels--
The recombinant proteins were partially
purified by incubating the culture medium (1.5 ml) or the cell extract
(375 µl) with 150 µl of anti-FLAG M2 antibody-agarose (Eastman
Kodak Co.) for 3 h to overnight at 4 °C with rocking. After a
5-s centrifugation step at 2000 × g, the supernatant
was removed using a 30-gauge needle and syringe. The antibody-agarose
pellet was resuspended in 75 µl of Storage Buffer (50 mM
sodium cacodylate, 50% glycerol, 100 mM NaCl, and FLAG
peptide at a concentration of 0.4 mg/ml). After 30 min at 4 °C with
gentle rocking, the antibody-agarose was centrifuged as above, and the
eluted recombinant enzyme was removed with a 30 gauge needle and
syringe. To determine the yield of recombinant proteins, immunopurified
enzymes were 32P-labeled and analyzed by Tricine-sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS-PAGE)
(21). 32P Labeling of proteins was accomplished by first
incubating 1 µl of the FLAG-purified recombinant proteins in 10 µl
of heart muscle kinase (HMK) buffer (20 mM HEPES, pH 7.0, 75 mM NaCl, 15 mM MgCl2) with 5 units of heart muscle kinase (Sigma) and 5 µCi of
[
-32P]rATP (6000 Ci/mmol) (NEN Life Science Products)
at 37 °C for 60 min. Next, 6 µl of 5× Tricine Gel Loading Buffer
(20% SDS, 60% glycerol, 250 mM Tris, pH 7, 0.05%
Coomassie G-250, and 10%
-mercaptoethanol) was added to the labeled
protein and heated at 65 °C for 20 min; 2 µl were analyzed by
Tricine-SDS-PAGE. Enzyme assays were performed with 3 µl of the
FLAG-purified recombinant GLY proteins.
| |
RESULTS |
|---|
|
|
|---|
Functional ppGaNTase Activity in Nematode Homogenates-- Detergent extracts of homogenates from mixed stage worms were assayed for ppGaNTase activity using a mammalian multisite peptide substrate EA2 (PTTDSTTPAPTTK), which was derived from the tandem repeat motif in the rat submandibular gland (RSMG) mucin (12). Minimal ppGaNTase activity was detected at 37 °C. Because C. elegans is a soil organism that thrives at a temperature of 16 to 25 °C, the temperature optimum of the native nematode enzyme activity was determined. In vitro ppGaNTase enzyme assays were performed at incubation temperatures varying from 4 °C to 60 °C in a 2-h transferase reaction. The native enzymes from C. elegans reached a maximal enzyme activity between 20 and 25 °C (Fig. 1A). In contrast, the native mammalian enzyme isolated from bovine colostrum was maximally active at 40 °C. Temperatures above 30 °C resulted in a sharp drop in worm enzyme activity, and at 50 °C both the worm and mammalian ppGaNTase enzyme activities were undetectable.
|
Cloning, Expression, and Temperature Dependence of GLY-3 Protein-- At present, only one cosmid (ZK688) in the completed portion of the C. elegans genome sequence data base encodes a putative homolog for a ppGaNTase. The ZK688.8 gene, designated gly-3, contains six exons that encode a 612-amino acid protein with a type II membrane structure. The total 612-aa size is similar to that of mammalian ppGaNTase enzymes. The sequence of the central 330 amino acids of ZK688.8 is 80% similar to the catalytic domain of the mammalian ppGaNTase-T1 enzyme. The gly-3 cDNA was isolated by reverse transcription-polymerase chain reaction, using total RNA from wild type C. elegans N2 and sequence information from C. elegans genome sequencing project (13). The sequence of the PCR-amplified gly-3 cDNA was identical to that predicted by the genomic sequence and the GeneFinder DNA analysis computer program, except for an asparagine to serine codon change at position 560 in the protein. The coding region following the N-terminal transmembrane domain was cloned downstream from an insulin secretion signal into the mammalian expression vector pIMKF3, such that the recombinant protein is produced as a secreted soluble protein. The pIMKF3 expression construct containing this truncated GLY-3/ZK688.8 protein is labeled pF3-GLY3. Protein expression was obtained by transient transfection of COS7 cells, which secreted the recombinant GLY-3 protein into the culture medium. To assay the functional activity of GLY-3, the recombinant GLY-3 protein was immunopurified using an anti-FLAG M2 antibody to remove any potential COS7 cell endogenous enzyme contamination. In parallel, pF3-mT1, encoding the secreted form of the mouse ppGaNTase-T1 isozyme, was transfected into COS7 cells. The pF3-GLY3 clone expressed sufficient ZK688.8 protein to demonstrated ppGaNTase activity (Fig. 1B). Enzyme assays performed at a range of incubation temperatures revealed that the temperature optimum for the recombinant worm GLY-3 protein was approximately 23 °C, while the recombinant mouse ppGaNTase-T1 had a temperature optimum of 45 °C.
cDNA Cloning of 10 Additional ppGaNTase-like
Clones--
Putative sequence homologs of the ppGaNTase family were
detected in a C. elegans expressed sequence tag (EST) data
base using the mouse ppGaNTase-T1 amino acid sequence (6) as a query
and the program TBLASTN (10). A total of 20 EST cDNA clones
contained at least three blocks of sequences conserved with mouse
ppGaNTase-T1; however, many of these were overlapping clones. Nucleic
acid hybridization probes were designed from seven non-overlapping
C. elegans EST clones: probes B, C, D, E, F, G, and H in
Table II. Two C. elegans
ACT cDNA libraries, RB1 and RB2, containing oligo(dT) and
random-primed cDNA clones, respectively, were hybridized with a
mixture of the seven 32P-labeled EST probes. A total of 1.4 million phage were screened, resulting in 584 clones with a moderate to
strong hybridization signal. Therefore, on average, one positive clone
was detected for every 2400 clones plated. Dot-blot analysis of 96 clones (48 from each library) revealed the frequency of each EST in the
cDNA library (Table II). Hybridization with individual probes
revealed that some cDNA clones hybridized to two probes, E and G. The abundance of these RNA messages in the cDNA library suggested
the following relative frequency of each clone: most abundant = gly-7 > gly-5 > gly-8 > gly-6 > gly-4 > gly-9 > least abundant. The frequency of these
cDNAs in the RB1 cDNA library was not an accurate
representation of the frequency of the message in the RNA population
because the 3'-UTR of some of the cDNAs (gly-6 and
gly-9) were unstable in high copy DNA vehicles.
Surprisingly, gly-8 was not detected in the random-primed
RB1 cDNA library, although 19 clones out of 48 encoded
gly-8 in the RB2 library. DNA sequence analysis of the
available 5'-UTR did not reveal any evidence of SL1 or SL2 splice
leaders; however, not all clones recovered significant lengths of
5'-UTR sequences.
|
|
|
|
Functional Expression--
Soluble recombinant protein expression
was achieved by cloning the lumenal domain of each coding region into
the mammalian expression vector, pIMKF3. cDNA sequences were
introduced downstream of an insulin secretion signal and a series of
epitope tags (Fig. 5). The length of the
3'-UTR sequence incorporated into the expression vehicle varied with
each clone. For construction of expression constructs using
gly-6a, gly-6c, and gly-9 isoform
cDNAs, the complete 3'-UTR was deleted to attempt to increase
stability of the plasmid construct and the yield of the recombinant
proteins. Transient transfection of COS7 cells with nine of the GLY
protein expression constructs resulted in the production of secreted
recombinant proteins, which were then purified from either the cell
culture medium or a detergent cell extract, using anti-FLAG M2
antibody-agarose. Detection of recombinant proteins was achieved using
32P labeling with heart muscle kinase enzyme and
[
-32P]rATP. The relative electrophoretic mobility of
each protein, as determined by SDS-PAGE, agreed with the sizes expected
from conceptually translated sequences (Fig.
6). All GLY proteins from C. elegans were expressed and readily detectable, except for the GLY-6 series of isoforms. GLY-4 migrated as a doublet in SDS-PAGE, while all other recombinant proteins appeared as single species. GLY-9
and GLY-6A were detected at low levels, and GLY-6C appeared to be too
rapidly degraded for detection. Metabolic labeling of cells transfected
with pF3-GLY6c indicated that no recombinant protein accumulated either
in the secreted or cellular fractions (data not shown). Removal of most
of the 3'-UTR of pF3-GLY6c did not increase recombinant protein
yields.
|
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
To determine if C. elegans could be used as a model system for studying the role of glycosylation in development, we have defined the family of enzymes that initiate, and thereby regulate, the acquisition of sugar chains on mucin-type glycoproteins. Genome sequence data suggest that nematodes express an abundance of mucin-type glycoproteins. Some surface-associated glycoproteins are modified with mammalian mucin-like O-linked glycans (17). The expression of specific cell surface-associated O-linked glycoproteins or O-glycan epitopes is also developmentally regulated at specific larval stages in C. elegans. Surprisingly, only one ppGaNTase gene (gly-3/ZK688.8) has been reported by the finished sequences of the C. elegans genome project, despite the fact that the genome sequence is about 70% complete. Therefore, in this present study, we focused on identifying the size and members of the ppGaNTase family through analysis of the EST project. To increase the probability of cloning cDNAs encoding this complete gene family, we screened two cDNA libraries generated from the whole organism at different developmental stages. By this method, we isolated 11 distinct ppGaNTase cDNAs and full-length coding regions in a single effort and accounted for all EST clones with homology to mammalian ppGaNTase enzymes in the C. elegans data base, placing the putative size of the ppGaNTase family of proteins at 11 members in this organism. Ultimately, we expect that with the expansion of the EST data base and the completion of the C. elegans genome sequence (predicted completion date in 1999), the absolute size of this family of sequence homologs will be unambiguously determined.
ppGaNTase activity in both mammals and nematodes is catalyzed by a family of proteins having a highly conserved primary structure. The predicted structural domains are summarized in Fig. 3. In mammals, two processed forms are naturally produced by each gene: a membrane-bound Golgi resident enzyme and a catalytically active soluble form, which is secreted into most body fluids upon protease cleavage of its N-terminal membrane anchor. At least one putative N-glycosylation site is present in all GLY proteins; this is consistent with the bovine ppGaNTase-mT1 isozyme, which is efficiently produced if one of the N-glycosylation sites is occupied (18). Based on previous studies with four mammalian ppGaNTase isoforms, we identified a 420-amino acid region of the enzyme that appears to be highly conserved (6). However, sequence comparisons between homologous mammalian and worm enzymes identified in this current study caused us to re-evaluate the size of the central catalytic domain and to suggest that the evolutionarily conserved region actually spans approximately 333 amino acids, not 420 aa. The intraspecies amino acid sequence conservation (percent similarity) in this catalytic region of either mammalian or nematode transferases is about 60-80%. The size of the catalytic domain was supported by N-terminal deletion analysis of the murine ppGaNTase-mT1, which revealed that the N terminus and part of the stem region (between the transmembrane anchor and the beginning of the conserved sequence in the catalytic domain) are not required for catalysis (18). The amino acid alignments of the 11 C. elegans sequence homologs indicated that the greatest source of sequence diversity of this gene family is in the N- and C-terminal sequences flanking the central catalytic domain. C-terminal to the catalytic region, most ppGaNTase enzymes share structural homology to a putative ricin-like lectin domain, first reported by Hazes (15); however, the GLY-8, GLY-6A, GLY-6B, and GLY-6C proteins either lack the lectin-like segment or have an extremely divergent sequence. The functional importance of this lectin-like motif is presently not understood, but appears to be important for production, secretion, or stability, because GLY-6C protein lacks part of this motif and is not expressed at a detectable level. Surprisingly, GLY-8 lacks this C-terminal lectin-like domain completely, and instead ends with a HDEL motif, which has been previously shown to act as a retrieval signal for lumenal endoplasmic reticulum proteins in S. cerevisiae (16). The C-terminal primary sequence has an additional source of sequence variation in two pairs of cDNAs, gly-5 and gly-6, which both contain three variant segments.
Preliminary analysis of shotgun genome sequence data indicates that at least the GLY-5B and GLY-5C proteins are encoded by a single gene that is alternatively spliced. If the variants of GLY-6 are similarly derived by alternative splicing, then the 11 homologous cDNAs will be encoded by seven different genetic loci in worms. The number of functionally active ppGaNTase isozymes detected in C. elegans (five isozymes catalyze in vitro ppGaNTase activity) is similar to the number that has been reported in mammals. However, the actual number of ppGaNTase sequence homologs in mammals is expected to be larger, because mammals have a more complex genome and because the human EST data base contains additional novel ppGaNTase-like cDNAs (8), which have not been functionally expressed at this time. The combined sequence data of the mammalian and worm ppGaNTase homologs is useful for identifying candidate amino acid residues in the active site. The amino acid sequence alignment of the ppGaNTases in mammals and C. elegans indicates numerous residues and positions that are invariant among evolutionarily diverse organisms. Site-directed mutagenesis of the invariant positions is currently being performed to identify those residues that are essential for enzyme function.
In this study, we observed that not all the recombinant GLY proteins were functionally active on the set of four mammalian peptide substrates tested. O-Glycosylation of a serine-containing human erythropoietin peptide and its threonine homolog were used to test if any of the ppGaNTases had a preference for serine. All worm transferases (as well as mammalian ppGaNTase-T1, -T3, and -T4) appeared to catalyze GalNAc transfer to threonine at a much higher rate than to serine in the erythropoietin-derived peptides, under in vitro conditions. Four members of this gene product family (GLY-6A, -7, -8, and -9) did not transfer GalNAc to the mammalian peptide substrates tested in this study, using an in vitro assay. This observation suggests that either the in vitro conditions do not reproduce the in vivo intracellular environment or that the correct substrates (peptide or nucleotide-sugar) of these enzymes have not been identified. The inability to simulate an appropriate Golgi environment in vitro may interfere with the O-glycosylation assay, as has been observed with a polypeptide mannosyltransferase. Polypeptide mannosyltransferase 4 is functionally responsible for glycosylating the O-mannosyl protein Ggp1p in vivo in yeast, but would not glycosylate its cognate substrate in vitro, using a protocol that had functioned for other members of the polypeptide mannosyltransferase family (19). Therefore, the functional identity of the GLY-6A, -6B, -6C, -7, -8, and -9 proteins is not clear, despite their remarkable similarity to bona fide ppGaNTase enzymes. In the case of the C. elegans GLY-6A and GLY-7 recombinant proteins, we observed UDP-GalNAc hydrolytic activity in the absence of peptide substrates. This low rate of hydrolysis is a trait shared with many ppGaNTases from both worms and mammals identified to date. This suggests that the GLY-6A and GLY-7 enzymes are capable of recognizing UDP-GalNAc as a potential sugar donor. Future in vivo studies will be directed at identifying the substrates and reaction requirements of GLY-6A, -6B, -7, -8, and -9 isozymes.
Given the diversity of sequences that are O-glycosylated and the large number of ppGaNTase substrates expressed by a given cell or organism, the existence of a complex gene family of ppGaNTase isozymes is not surprising. However, it is not clear why both mammals and nematode ppGaNTases display such a large overlap in their peptide substrate reactivity. Five members of the gene family from nematodes identified in this study (GLY-3, GLY-4, GLY-5A, GLY-5B, and GLY-5C) are each capable of glycosylating most of the peptide substrates tested, though the rates of transfer for each isoform differed. The other isoforms identified here lack observable ppGaNTase activity with those same peptide substrates. These may then represent members of the gene family with a more rigid or restricted specificity. Gene ablation studies of polypeptide mannosyl transferases in S. cerevisiae and Drosophila melanogaster have indicated that protein mannosylation is essential for viability in yeast and for the symmetry and alignment of the adult body plan and musculature in the fly (19, 20). More significantly, multiple mannosyltransferases from the yeast need to be ablated before phenotypic variance can be detected. This could prove to hold true for ppGaNTases in nematodes, as well, and may help to determine if ppGaNTase isoforms are functionally redundant in a biological model.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Robert Barstead for the cDNA library; Dr. Yuji Kohara, Dr. Robert Waterston, and Dr. Lucinda Fulton for some of the EST clones; and Marlene Balys for technical assistance. We also gratefully thank Dr. Lawrence Tabak for supporting this effort and reviewing this work.
| |
Note Added in Proof |
|---|
Recent submissions to the C. elegans EST database revealed two additional ppGaNTase sequence homologs, placing the size of the family to a total of 13 isoforms, encoded by 9 genes.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grant DE-08108.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF031833 (gly-3), AF031834 (gly-4), AF031835 (gly-5a), AF031836 (gly-5b), AF031837 (gly-5c) AF031838 (gly-6a), AF031839 (gly-6b), AF031840 (gly-6c), AF031841 (gly-7), AF031842 (gly-8), and AF031843 (gly-9).
To whom correspondence should be addressed: Center for Oral
Biology, School of Medicine and Dentistry, University of Rochester, 601 Elmwood Ave., Box 611, Rochester, NY 14642. Tel.: 716-275-0380; Fax:
716-473-2679; E-mail: fred_hagen{at}urmc.rochester.edu.
1 The abbreviations used are: GalNAc, N-acetylgalactosamine; ppGaNTase, UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase; EST, expressed sequence tag; PCR, polymerase chain reaction; UTR, untranslated region; nt, nucleotide(s); aa, amino acid(s); PAGE, polyacrylamide gel electrophoresis; Tricine, N-tris(hydroxymethyl)methylglycine; MES, 2-(N-morpholino)ethanesulfonic acid.
2 K. G. Ten Hagen, F. K. Hagen, and L. A. Tabak, manuscript in preparation.
3 The gly gene name designation is used by the C. elegans community to refer to glycosylation-related gene products; therefore, "gly" genes include the ppGaNTase homologs identified in this study, as well as other glycosyl transferases, glycosidases, and components related to the N- and O-linked glycosylation pathway.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Nehrke, J. Denton, and W. Mowrey Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program Am J Physiol Cell Physiol, January 1, 2008; 294(1): C333 - C344. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nguyen, I. van Die, K. M Grundahl, Z. S Kawar, and R. D Cummings Molecular cloning and characterization of the Caenorhabditis elegans {alpha}1,3-fucosyltransferase family Glycobiology, June 1, 2007; 17(6): 586 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, K. Julenius, J. Hryhorenko, and F. K. Hagen Systematic Analysis of Proteoglycan Modification Sites in Caenorhabditis elegans by Scanning Mutagenesis J. Biol. Chem., May 11, 2007; 282(19): 14586 - 14597. [Abstract] [Full Text] [PDF] |
||||