JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagen, F. K.
Right arrow Articles by Nehrke, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagen, F. K.
Right arrow Articles by Nehrke, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 14, 8268-8277, April 3, 1998

cDNA Cloning and Expression of a Family of UDP-N-acetyl-Dgalactosamine:Polypeptide N-Acetylgalactosaminyltransferase Sequence Homologs from Caenorhabditis elegans*

Fred K. HagenDagger and Keith Nehrke

From the Center for Oral Biology, School of Medicine and Dentistry, University of Rochester, Rochester, New York 14642

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The initiation of mucin-type O-glycosylation is catalyzed by a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (ppGaNTase) (EC 2.4.1.41). By screening two mixed-stage Caenorhabditis elegans cDNA libraries, a total of 11 distinct sequence homologs of the ppGaNTase gene family were cloned, sequenced, and expressed as truncated recombinant proteins (gly-3, gly-4, gly-5a, gly-5b, gly-5c, gly-6a, gly-6b, gly-6c, gly-7, gly-8, and gly-9). All clones encoded type II membrane proteins that shared 60-80% amino acid sequence similarity with the catalytic domain of mammalian ppGaNTase enzymes. Two sets of cDNA clones (gly-5 and gly-6) contained variants that appeared to be produced by alternative message processing. gly-6c contained a reading frameshift and premature termination codon in the C-terminal lectin-like domain found in most other ppGaNTase proteins, and a second clone (gly-8) lacked the typical C-terminal region completely. Homogenates of nematodes and immunopurified preparations of the recombinant GLY proteins demonstrated that worms express functional ppGaNTase enzymes (GLY-3, GLY-4, GLY-5A, GLY-5B, and GLY-5C), which can O-glycosylate mammalian apomucin peptide sequences in vitro. In addition to demonstrating the existence of ppGaNTase enzymes in a nematode organism, the substantial diversity of these isoforms in C. elegans suggests that mucin O-glycosylation is catalyzed by a complex gene family, which is conserved among evolutionary-distinct organisms.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The diversity of O-linked oligosaccharides displayed on secreted and cell surface glycoproteins is determined by the repertoire of glycosyltransferases present in the Golgi apparatus. The biosynthesis of mucin-type oligosaccharides at specific O-glycosylation sites begins with the transfer of the monosaccharide N-acetylgalactosamine (GalNAc)1 to specific threonines and serines of an apo-protein. This initiation event is regulated in mammals by a family of at least seven enzymes, known as UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (ppGaNTases) (EC 2.4.1.41). Four ppGaNTase isozymes have been cloned and functionally expressed from rodent and human cDNAs: ppGaNTase-T1 (1, 2), ppGaNTase-T2 (3), ppGaNTase-T3 (4, 5), and ppGaNTase-T4 (6). Evidence for three additional members of this gene family has been obtained, using a polymerase chain reaction approach.2 An eighth murine isoform having high amino acid sequence homology to ppGaNTase-T1 has also been suggested by nucleic acid cross-hybridization to a genomic library (7). Transcripts encoding specific ppGaNTase enzymes have distinct tissue patterns of expression, indicating that the acquisition of O-glycans can be regulated by differential expression of the ppGaNTase gene family. The substrate reactivity of the mammalian isozymes varies from those that are broad (ppGaNTase-T1) to those that recognize a narrow range of specific peptide sequences (ppGaNTase-T4); therefore, O-glycosylation of specific proteins in vivo requires the coordinate expression of polypeptide substrates and their cognate ppGaNTase enzymes. An analysis of the human and murine expressed sequence tag (EST) data base revealed numerous new sequence homologs, suggesting that an even larger and more complex family may exist in mammals (8).

The complexity and potential redundancy of the ppGaNTase gene family in mammalian systems is underscored by a ppGaNTase gene ablation study in mice, in which the deletion of an exon from a putative ppGaNTase gene produced mice that appeared normal and unaffected in their ability to O-glycosylate proteins (7, 9). The growing number of ppGaNTase isoforms isolated in mammals indicates that a genetic approach to ablating ppGaNTase activity in a murine model will be a lengthy undertaking.

In this present study, we have searched for a simple model organism that is suitable for using a genetic approach to study the roles of mucin-type O-glycosylation during development and differentiation. We selected Caenorhabditis elegans because nematodes express hyperabundant mucin-like glycoproteins and because C. elegans is amenable to classical and reverse genetic studies. In addition, the EST data base revealed numerous C. elegans clones, which encoded putative sequence homologs of the mammalian ppGaNTases, providing us with a system for identifying the size and properties of the complete ppGaNTase family in a whole organism. Biochemical studies performed here revealed that worms express ppGaNTase enzyme activity and that this activity is encoded by a family of enzymes. A total of 11 distinct C. elegans cDNAs (encoded by gly genes),3 containing complete open reading frames with sequence homology to mammalian ppGaNTase, were isolated, sequenced, and expressed. Two sets of these cDNAs appear to be splice variants. Functional analysis of recombinant worm enzymes demonstrated that five of the members of this family catalyzed the ppGaNTase reaction in vitro using mammalian peptides as acceptor substrates.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

C. elegans Homogenate and Extract-- C. elegans N2 worms were grown on 15-cm egg plates for 2-3 weeks, washed with M9 medium (22 mM KH2PO4, 22 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4), and harvested. Worms were purified from debris by sedimentation overnight at 4 °C in M9 medium in a graduated cylinder. The concentrated nematodes were diluted with two volumes of 100 mM NaCl. Resuspended worms were mixed with an equal volume of 60% sucrose and centrifuged at 2000 rpm in a SH3000 rotor (Sorvall) for 5 min at 4 °C. Floating worms were removed and resuspended in a large volume of 50 mM NaCl and centrifuged as above but only for 2 min. This final worm pellet was resuspended in 100 mM NaCl, incubated at 20 °C for 30 min, and then frozen at -70 °C.

To prepare a homogenate of mixed-stage nematodes, aliquots of frozen worms were thawed, and all subsequent steps were performed at 4 °C. Nematodes (0.5 grams) were placed in a 2-ml tube containing 1 ml of 1-mm glass beads and 1 ml of homogenization medium (500 mM sucrose, 2 mM Tris maleate, pH 6.4, 1 mM MnCl2 and MgCl2, 1% dextran (average molecular weight = 250,000), and 5 mM beta -mercaptoethanol). Worms were disrupted three times with 1-min pulses, using a Mini-Beadbeater-8 cell disrupter (Biospec Products). One volume of this homogenate was diluted with 10 volumes of H2O and centrifuged at 250,000 × g for 60 min. The pellet was resuspended in 230 µl of extraction solution (50 mM sodium cacodylate, 50 mM beta -mercaptoethanol, and 2.5% Triton X-100) and homogenized with a 1.5-ml tube plunger. After 30 min of rocking, the tube was centrifuged for 10 min and the supernatant was removed and saved. The pellet fraction was re-extracted as above, and the supernatants were combined, mixed, and stored at -70 °C.

ppGaNTase Enzyme Assays-- Enzyme activity was measured in vitro using the following assay conditions: a final volume of 25 µl containing a final concentration of 500 µM EA2 peptide, 50 µM UDP-[14C]GalNAc (25,000 cpm), 10 mM MnCl2, 40 mM cacodylate pH 6.5, 40 mM beta -mercaptoethanol, and 0.1% Triton X-100. Peptide substrates (amino acid sequences in parentheses) used in these assays are: EPO-T (PPDAATAAPLR), EPO-S (PPDAASAAPLR), and EA2 (PTTDSTTPAPTTK) at a concentration of 500 µM and TPPP at 1 mM. Three µl of worm extract, purified bovine colostrum ppGaNTase (2), or immunopurified recombinant enzymes were used in this standard enzyme assay (Fig. 1). All enzyme assay points were performed in duplicate, and these were repeated with duplicate enzyme preparations from worm extracts or COS7 cell supernatants. Glycosylated 14C-labeled peptides were separated from unincorporated UDP-[14C]GalNAc by anion exchange chromatography on formate form AG 1x8 resin spin columns (Bio-Rad).

Data Base Analysis-- The amino acid sequence of the mouse ppGaNTase-T1 was used as a query to perform a TBLASTN analysis of the data base of expressed sequence tags (dBEST) (10). All EST sequences derived from the C. elegans data base were conceptually translated and aligned to the four known mammalian ppGaNTase isoforms, ppGaNTase-T1, -T2, -T3, and -T4. Any clone that contained at least three homologous segments (eight amino acids in length) with conserved spacing between each segment was treated as a putative homolog of the ppGaNTase family and used to generate a cDNA hybridization probe. Seven different expressed sequence tag (EST) clones (yk2f11, yk3 g10, yk15e11, cm13e2, yk151a8, yk72f6, and cm16e9) were selected for probe design (probes B for gly-4, C for gly-7, D for gly-6, E for gly-5b and -5c, F for gly-8, G for gly-5a, and H for gly-9). EST clones yk2f11, yk3 g10, and yk15e11 were obtained from Dr. Y. Kohara. EST clones cm13e2 and cm16e9 were obtained from Dr. L. Fulton and Dr. Robert Waterston.

PCR Amplification of Sequence Tags and Preparation of cDNA Hybridization Probes-- Nucleic acid hybridization probes, specific for each EST, were prepared by isolating polymerase chain reaction (PCR) products of a 190-330-nt region in each cDNA from the data base. EST clones described above were used as templates for amplifying probes for gly-4, gly-6, and gly-7, while first strand cDNA from mixed stage nematode total RNA was used as a template for amplifying fragments of the remaining gly clones. First strand cDNA was synthesized using a First Strand cDNA synthesis kit (CLONTECH), oligo(dT)18, and total RNA from mixed stage C. elegans N2 nematodes. The oligonucleotides used for the amplification of each isoform is described in Table I. 32P-Labeled probes were generated using purified PCR products, antisense oligonucleotides for cDNAs gly-4 through gly-9, and a PCR labeling protocol. Briefly, 30 ng of PCR product was added to a 12.5 reaction mixture containing 1 µM primer, 1× PCR buffer, 1.5 mM MgCl2, 50 µM dATP, dGTP, dTTP (each), 0.75 units of Taq DNA polymerase (Perkin-Elmer), and 5 µl of [alpha -32P]dCTP (3000 Ci/mmol, NEN Life Science Products). Reactions were amplified for 30 cycles at 94 °C for 40 s, 49 °C for 40 s, and 72 °C for 40 s.

cDNA Library Screening and Clone Characterization-- Full-length coding regions for 10 of the sequence homologs were obtained by screening two C. elegans cDNA libraries: an oligo(dT)-primed cDNA library and a random-primed cDNA library, lambda -ACT-RB1 and lambda -ACT-RB2, respectively (kindly provided by Dr. R. Barstead; Ref. 11). Seven hundred thousand phage of each library RB1 and RB2 were plated onto 24 × 24-cm Nunc plates and a lawn of LE392 Escherichia coli cells. The plates were plaque-lifted using Hybond-N membranes (Amersham Pharmacia Biotech), and the membranes were hybridized overnight at 68 °C in 5× SSPE, 50% formamide, 5× Denhardt's, 0.1% SDS, and 100 µg/ml salmon sperm DNA, containing 3 × 105 cpm/ml of each 32P-labeled denatured probe. Filters were washed three times for 20 min each in 2× SSC and 0.1% SDS at the following three temperatures: 42, 64, and 42 °C. Initial screening was performed with a mixture of seven probes for isoforms gly-4, gly-5a, gly-5b, gly-6, gly-7, gly-8, and gly-9. Ninety-six positive plaques were cored, dot-blotted on multiple Hybond-N membranes, and probed with individual isoform-specific probes, using the conditions above. Twenty-one clones, corresponding to 10 different cDNAs, were isolated to homogeneity. Cre-lox excision of the pACT plasmid from each lambda  clone was accomplished by transduction into the E. coli strain RB4, which expresses the Cre recombinase. CsCl2 quality plasmid DNA was prepared in the RB4 host and used directly for infrared fluorescence DNA sequencing, using Bca DNA polymerase in a Ladderman Core sequencing protocol (PanVera) and a LICOR model 4000L DNA sequencer. IRD41 dye-labeled primers were designed for the pACT plasmid, using the following sequences: PACT-F primer d(CTATCTATTCGATGATGAAG) and PACT-R primer d(ACAGTTGAAGTGAACTTGCG). Both strands of clones gly-4 through gly-9 were completely sequenced by creating deletion from both the 5' and 3' ends of the cDNA inserts. Radioactive DNA sequencing was used to fill small gaps in sequence reads. Splice variants were completely sequenced on one strand, and the alternative spliced region was sequenced on both strands. One splice variant, gly-6b, was present on a partial cDNA, lacking the first 151 amino acid codons. The full-length sequence of gly-6b was obtained by using overlapping gly-6 cDNA clones. Similarly, the 5' end of the gly-5a isoform was obtained by using overlapping gly-5 clones. The sequence of the 11th cDNA, gly-3, cDNA was determined by sequencing a gly-3 PCR product (using the primers in Table I) and the sequence data in the GenBank data base from clones CE17E3 (EST) and ZK688.8 (genomic clone).

Design of Expression Constructs-- Expression constructs were designed such that the cDNAs were expressed as secreted recombinant proteins, lacking their natural N-terminal membrane anchors (for amino acid sequence, see Fig. 2). To clone all of the isoforms, a new expression vector construct, pIMKF3, was created. The SV40 promoter-driven expression plasmid pIMKF3 is virtually identical to pIMKF1 (6), except that the multiple cloning site was expanded to include four new unique restriction sites: ApaI, BglII, NotI, and SacII (Fig. 5). Seven cDNA clones (gly-3, gly-4, gly-5a, gly-6a, gly-7, gly-8, and gly-9) were introduced into the 5' MluI and 3' multiple cloning site of pIMKF3, creating the constructs pF3-GLY3, pF3-GLY4, pF3-GLY5a, pF3-GLY6a, pF3-GLY7, pF3-GLY8, and pF3-GLY9, respectively. The MluI restriction site was introduced into all constructs by PCR amplification of the stem region with a PCR primer (Table I, column two) and a downstream antisense strand primer in the 3'-untranslated region (UTR) or vector sequences (Table I, column four). Only the cDNA sequences encoding the full-stem, catalytic region, C-terminal coding region, and part of the 3'-UTR was present in each expression construct (the first amino acids used in the secretion construct are indicated in Fig. 2). With the exception of pF3-GLY3, the majority of the coding region was replaced by a restriction fragment of the cDNA clone obtained from the original library screen, such that the PCR-derived fragment was minimal in size. All PCR-derived sequences and cloning sites were completely re-sequenced to verify that no random PCR-induced mutations or frameshift artifacts existed in the expression constructs. Expression constructs of the "b" and "c" splice variants of gly-5 and gly-6 were constructed by replacing the 3' end of the cDNA in the pF3-GLY5a and pF3-GLY6a clones with the original cDNAs that contain the variant regions. These splice variant constructs were sequenced to verify that the sequence and reading frames matched the original cDNAs. The pF3-GLY6b construct was unstable in E. coli.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Oligonucleotides used for screening and expression constructs

Transient Expression of Recombinant Proteins-- Recombinant enzymes were expressed by transient transfection of COS7 cells, using these pF3-GLY3 through pF3-GLY9 constructs and LipofectAMINE (Life Technologies, Inc.) as described previously (6). Briefly, 1 µg of supercoiled DNA and 8 µl of LipofectAMINE was used to transfect a 35-mm dish of COS7 cells at 90-100% confluence. After 5 h, 1 ml of Dulbecco's modified Eagle's medium containing 20% fetal bovine serum was gently added to the cells. Eighteen hours after the start of transfection, the transfection medium was removed and replaced with fresh Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and cells were grown at 30 °C for 2-3 days. Medium was harvested from these cultures and clarified by a centrifugation at 100 × g for 10 min. The transfected cells were washed with phosphate-buffered saline and then extracted by adding 500 µl Cell Extraction Buffer (20 mM MES, pH 6.5, 50 mM NaCl, 1% Triton X-100, 5% glycerol). The extract was clarified by centrifugation at 12,000 × g for 5 min.

Immunopurification of Recombinant Proteins and Analysis of Expression Levels-- The recombinant proteins were partially purified by incubating the culture medium (1.5 ml) or the cell extract (375 µl) with 150 µl of anti-FLAG M2 antibody-agarose (Eastman Kodak Co.) for 3 h to overnight at 4 °C with rocking. After a 5-s centrifugation step at 2000 × g, the supernatant was removed using a 30-gauge needle and syringe. The antibody-agarose pellet was resuspended in 75 µl of Storage Buffer (50 mM sodium cacodylate, 50% glycerol, 100 mM NaCl, and FLAG peptide at a concentration of 0.4 mg/ml). After 30 min at 4 °C with gentle rocking, the antibody-agarose was centrifuged as above, and the eluted recombinant enzyme was removed with a 30 gauge needle and syringe. To determine the yield of recombinant proteins, immunopurified enzymes were 32P-labeled and analyzed by Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS-PAGE) (21). 32P Labeling of proteins was accomplished by first incubating 1 µl of the FLAG-purified recombinant proteins in 10 µl of heart muscle kinase (HMK) buffer (20 mM HEPES, pH 7.0, 75 mM NaCl, 15 mM MgCl2) with 5 units of heart muscle kinase (Sigma) and 5 µCi of [gamma -32P]rATP (6000 Ci/mmol) (NEN Life Science Products) at 37 °C for 60 min. Next, 6 µl of 5× Tricine Gel Loading Buffer (20% SDS, 60% glycerol, 250 mM Tris, pH 7, 0.05% Coomassie G-250, and 10% beta -mercaptoethanol) was added to the labeled protein and heated at 65 °C for 20 min; 2 µl were analyzed by Tricine-SDS-PAGE. Enzyme assays were performed with 3 µl of the FLAG-purified recombinant GLY proteins.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Functional ppGaNTase Activity in Nematode Homogenates-- Detergent extracts of homogenates from mixed stage worms were assayed for ppGaNTase activity using a mammalian multisite peptide substrate EA2 (PTTDSTTPAPTTK), which was derived from the tandem repeat motif in the rat submandibular gland (RSMG) mucin (12). Minimal ppGaNTase activity was detected at 37 °C. Because C. elegans is a soil organism that thrives at a temperature of 16 to 25 °C, the temperature optimum of the native nematode enzyme activity was determined. In vitro ppGaNTase enzyme assays were performed at incubation temperatures varying from 4 °C to 60 °C in a 2-h transferase reaction. The native enzymes from C. elegans reached a maximal enzyme activity between 20 and 25 °C (Fig. 1A). In contrast, the native mammalian enzyme isolated from bovine colostrum was maximally active at 40 °C. Temperatures above 30 °C resulted in a sharp drop in worm enzyme activity, and at 50 °C both the worm and mammalian ppGaNTase enzyme activities were undetectable.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   Temperature-dependent ppGaNTase activity of worm and mammalian enzymes. Activity of the mammalian enzyme is indicated by a box, and that of the worm enzyme is indicated by a closed circle. Enzyme assays were conducted at the temperatures indicated on the abscissa, using a mammalian multisite peptide substrate EA2 with the amino acid sequence PTTDSTTPAPTTK. A, native enzymes were derived from whole worm homogenates or from a partially purified bovine colostrum ppGaNTase preparation (2). B, recombinant enzymes (worm GLY-3 or mouse ppGaNTase-mT1) were expressed in COS7 cells and isolated as truncated secreted proteins. Activity of recombinant enzymes was determined using 2.5 pmol of GLY-3 and 1 pmol of mouse ppGaNTase-mT1.

Cloning, Expression, and Temperature Dependence of GLY-3 Protein-- At present, only one cosmid (ZK688) in the completed portion of the C. elegans genome sequence data base encodes a putative homolog for a ppGaNTase. The ZK688.8 gene, designated gly-3, contains six exons that encode a 612-amino acid protein with a type II membrane structure. The total 612-aa size is similar to that of mammalian ppGaNTase enzymes. The sequence of the central 330 amino acids of ZK688.8 is 80% similar to the catalytic domain of the mammalian ppGaNTase-T1 enzyme. The gly-3 cDNA was isolated by reverse transcription-polymerase chain reaction, using total RNA from wild type C. elegans N2 and sequence information from C. elegans genome sequencing project (13). The sequence of the PCR-amplified gly-3 cDNA was identical to that predicted by the genomic sequence and the GeneFinder DNA analysis computer program, except for an asparagine to serine codon change at position 560 in the protein. The coding region following the N-terminal transmembrane domain was cloned downstream from an insulin secretion signal into the mammalian expression vector pIMKF3, such that the recombinant protein is produced as a secreted soluble protein. The pIMKF3 expression construct containing this truncated GLY-3/ZK688.8 protein is labeled pF3-GLY3. Protein expression was obtained by transient transfection of COS7 cells, which secreted the recombinant GLY-3 protein into the culture medium. To assay the functional activity of GLY-3, the recombinant GLY-3 protein was immunopurified using an anti-FLAG M2 antibody to remove any potential COS7 cell endogenous enzyme contamination. In parallel, pF3-mT1, encoding the secreted form of the mouse ppGaNTase-T1 isozyme, was transfected into COS7 cells. The pF3-GLY3 clone expressed sufficient ZK688.8 protein to demonstrated ppGaNTase activity (Fig. 1B). Enzyme assays performed at a range of incubation temperatures revealed that the temperature optimum for the recombinant worm GLY-3 protein was approximately 23 °C, while the recombinant mouse ppGaNTase-T1 had a temperature optimum of 45 °C.

cDNA Cloning of 10 Additional ppGaNTase-like Clones-- Putative sequence homologs of the ppGaNTase family were detected in a C. elegans expressed sequence tag (EST) data base using the mouse ppGaNTase-T1 amino acid sequence (6) as a query and the program TBLASTN (10). A total of 20 EST cDNA clones contained at least three blocks of sequences conserved with mouse ppGaNTase-T1; however, many of these were overlapping clones. Nucleic acid hybridization probes were designed from seven non-overlapping C. elegans EST clones: probes B, C, D, E, F, G, and H in Table II. Two C. elegans lambda  ACT cDNA libraries, RB1 and RB2, containing oligo(dT) and random-primed cDNA clones, respectively, were hybridized with a mixture of the seven 32P-labeled EST probes. A total of 1.4 million phage were screened, resulting in 584 clones with a moderate to strong hybridization signal. Therefore, on average, one positive clone was detected for every 2400 clones plated. Dot-blot analysis of 96 clones (48 from each library) revealed the frequency of each EST in the cDNA library (Table II). Hybridization with individual probes revealed that some cDNA clones hybridized to two probes, E and G. The abundance of these RNA messages in the cDNA library suggested the following relative frequency of each clone: most abundant = gly-7 > gly-5 gly-8 > gly-6 > gly-4 > gly-9 > least abundant. The frequency of these cDNAs in the RB1 cDNA library was not an accurate representation of the frequency of the message in the RNA population because the 3'-UTR of some of the cDNAs (gly-6 and gly-9) were unstable in high copy DNA vehicles. Surprisingly, gly-8 was not detected in the random-primed RB1 cDNA library, although 19 clones out of 48 encoded gly-8 in the RB2 library. DNA sequence analysis of the available 5'-UTR did not reveal any evidence of SL1 or SL2 splice leaders; however, not all clones recovered significant lengths of 5'-UTR sequences.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Frequency of cDNA clones detected by each probe

DNA sequence and restriction analysis of 26 cDNA clones revealed a total of 10 novel cDNAs (designated gly-4, gly-5a, gly-5b, gly-5c, gly-6a, gly-6b, gly-6c, gly-7, gly-8, and gly-9), which were distinct from gly-3, the ZK688.8 C. elegans ppGaNTase gene. (The nucleotide sequence is available in the GenBankTM/NCBI Data Bank, using the accession numbers listed in the title page footnote.) Comparisons of gly-5a, gly-5b, and gly-5c cDNA sequences revealed that these three clones were 100% identical, except for an internal segment (about 100 nt) within the 3' end of the coding region. Similarly, gly-6a, gly-6b, and gly-6 cDNAs were identical for the complete sequence, except for an approximately 100-150-nt span in the 3'end of the coding region. No sequence variants were found for gly-3, gly-4, gly-7, gly-8, and gly-9 cDNA.

Conceptual translation of all 11 worm cDNAs revealed a single large open reading frame in each transcription unit. Type II membrane proteins were encoded by each cDNA (amino acid sequence, shown in Fig. 2). The generalized protein sequence features of these putative ppGaNTase homologs are summarized in Fig. 3. The overall size of these proteins typically ranges from 578 to 634 amino acids in length, except for GLY-8, which is 421 amino acids. GLY-8 appears to lack about 140 amino acid residues normally present at the C terminus in all the other ppGaNTase-like proteins. The N-terminal cytoplasmic domain is between 4 and 20 amino acids in length and in each case includes between 2 and 6 basic amino acid side chains. The transmembrane domain is defined by a segment of 15-25 hydrophobic amino acids next to the N terminus. The amino acid sequence of the N-terminal hydrophobic region is not highly conserved among the various clones. The C-terminal lumenal Golgi domain begins with a stem region that is composed of a variable length amino acid segment and sequence preceding the first motif conserved in ppGaNTase enzymes. Sequence alignments demonstrate that all 11 proteins share approximately a 333-amino region that is similar to the murine ppGaNTase-T1 protein (Figs. 2 and 3, see line labeled mT1 for mouse ppGaNTase-T1). The 333-aa conserved region begins with a "FN" amino acid sequence at position 84 in murine ppGaNTase-T1 and ends with a "KWYLXN" segment at aa position 417. The size of the evolutionarily conserved sequences in these C. elegans ppGaNTase proteins is substantially larger than the highly conserved 81-amino acid segment reported in mammals (14); however, it is smaller than the 420-amino acid region conserved in mammalian ppGaNTases-T1, -T2, -T3, and -T4 (6). Most isoforms contained putative N-glycosylation sequeons in or close to the stem region (Fig. 3).


View larger version (108K):
[in this window]
[in a new window]
 
Fig. 2.   Amino acid sequence alignments of murine ppGaNTase-mT1 and 11 nematode sequence homologs. The gene names for each isoform appear in the left column: mT1 refers to the murine ppGaNTase-T1 isoform and the GLY gene name is used for the nematode clones. Nucleotide sequence is available in GenBankTM, using the accession numbers indicated in the title page footnote. Alignments were performed using the Clustal method in MacVector. Amino acids below the alignment indicate consensus residues defined by a 67% threshold. The beginning and end of the 333-aa central conserved catalytic region are indicated by a left and right horizontal arrow on the consensus line. Boxes were drawn around the blocks of conserved sequences (AGGLF and CHGXGGNQ) that were used to design hybridization probes and PCR primers in a previous study (6). Note that the "CHGXGGNQ" sequence is not highly conserved in two clones and absent in one clone (GLY-8). The first amino acid codon that was used in the expression construct in Fig. 5 is enclosed in a bold circle.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 3.   Predicted protein domains of the ppGaNTases. Predicted amino acid sequences were used to define the size of the cytoplasmic, transmembrane, and lumenal Golgi domains. A Kyte-Doolittle hydrophilicity analysis was used to size the transmembrane region (black box). The conserved catalytic domain was determined by amino acid alignments from Fig. 2. The size of each region is indicated below the box. Gaps are introduced between boxes to maximize alignments. A putative ricin-like lectin domain, predicted by Hazes (15), is indicated by a box with three segments, corresponding to three QXW-like repeats (alpha , beta , gamma ). The conserved cysteine, hydrophobic and polar residues ("CLD" sequence at positions 13, 14, and 15) in each QXW repeat are indicated below each repeat. The alternatively spliced regions in GLY-5 and GLY-6 are indicated by different hatched patterns. Predicted N-glycosylation sites are indicated by a solid lollipop. Position of N-glycosylation sites that have been experimentally mapped is indicated by an open lollipop (18).

Amino acid sequence alignments of the GLY-5A, -5B, and -5C proteins revealed that at position 491 these proteins varied only in 32-, 35-, and 33-aa segments, respectively, while the N-terminal and C-terminal translated sequences flanking these segments were identical (Figs. 2 and 3). Analysis of the cDNA sequence suggests that the variant gly-5 cDNAs are produced by alternative message processing, because on the nucleic acid sequence level the variant segment is introduced at the same cDNA position in each clone (Fig. 4A). Preliminary genome sequence data revealed that the variant regions of GLY-5B and GLY-5C were present in the same gene as alternatively spliced exons on a single 1.6-kilobase pair fragment (data not shown). The position of this sequence variation begins at amino acid 491 in GLY-5 and resides in a domain of the protein that has homology to sugar-binding domain of the lectin ricin (15). This ricin-like lectin domain in ppGaNTase clones is located on the C terminus and is composed of three 39-50-amino acid tandem repeats that contain a "CLD" amino acid sequence that is important in sugar binding in the ricin lectin. The functional significance of this region in the ppGaNTases is not known.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Sequence alignments of the 3' coding region of the gly-5 and gly-6 variant clones. The complete nucleotide sequence flanking the variant regions is 100% identical and is aligned on the left and right sides of the figure. Dashes are introduced to indicate borders of the regions that vary in sequence. Borders were chosen to maximize sequence alignments and to agree with splice junction consensus sequence rules. A, despite the sequence variation, each of the gly-6 variants contains an amino acid sequence element (cysteine, hydrophobic residue, aspartic acid: CLD is underlined), which is present in the ricin-like motif of many ppGaNTase clones (15). The reading frame of the downstream sequences of gly-5 are conserved (see right side of alignments). B, gly-6a and gly-6c contain two variant segments, in which the first segments in both of these clones are identical. The second segment of gly-6a is unique, while the second segment of gly-6c is identical to that in gly-6b, except that the gly-6b segment is one nucleotide shorter. This difference in one nucleotide produces a reading frameshift (at asterisk) in the downstream sequence of gly-6c (see right side of alignments).

In a similar theme, the sequence variation for GLY-6A, -6B, and -6C is restricted to the C terminus in the first repeat in the ricin-like lectin domain. The nucleic acid sequences on either side of these variant regions are completely identical, indicating that three gly-6 cDNAs could also represent alternative splice variants. The splice variation in gly-6, however, appears to be more complex than for gly-5. gly-6a contains two segments of 51 and 58 nt in the variant region, while only a single 103-nt segment is present in gly-6b (Fig. 4B). The reading frames and flanking amino acid sequences are identical for these two clones (Figs. 2 and 4B). gly-6c contained two segments in the variant region; the first segment is identical to the first segment of gly-6a, and the second segment is identical to the gly-6b variant segment. However, the latter segment of gly-6c is missing one nucleotide, which produced a reading frameshift and utilization of a premature termination codon in the downstream sequence (Figs. 2, 3, and 4B). Therefore, the reading frameshift results in the translation of an 80-amino acid C-terminal segment in GLY-6C that strongly diverges from GLY-6A and GLY-6B and a premature termination codon results in a 56-amino acid truncation in the C-terminal end of GLY-6C, relative to GLY-6A. The positions marking the beginning and end of the variant segments in both gly-5 and gly-6 cDNAs correspond to comparable splice junction positions in the mammalian ppGaNTase-T1 gene and the C. elegans gly-3 gene (data not shown).

Functional Expression-- Soluble recombinant protein expression was achieved by cloning the lumenal domain of each coding region into the mammalian expression vector, pIMKF3. cDNA sequences were introduced downstream of an insulin secretion signal and a series of epitope tags (Fig. 5). The length of the 3'-UTR sequence incorporated into the expression vehicle varied with each clone. For construction of expression constructs using gly-6a, gly-6c, and gly-9 isoform cDNAs, the complete 3'-UTR was deleted to attempt to increase stability of the plasmid construct and the yield of the recombinant proteins. Transient transfection of COS7 cells with nine of the GLY protein expression constructs resulted in the production of secreted recombinant proteins, which were then purified from either the cell culture medium or a detergent cell extract, using anti-FLAG M2 antibody-agarose. Detection of recombinant proteins was achieved using 32P labeling with heart muscle kinase enzyme and [gamma -32P]rATP. The relative electrophoretic mobility of each protein, as determined by SDS-PAGE, agreed with the sizes expected from conceptually translated sequences (Fig. 6). All GLY proteins from C. elegans were expressed and readily detectable, except for the GLY-6 series of isoforms. GLY-4 migrated as a doublet in SDS-PAGE, while all other recombinant proteins appeared as single species. GLY-9 and GLY-6A were detected at low levels, and GLY-6C appeared to be too rapidly degraded for detection. Metabolic labeling of cells transfected with pF3-GLY6c indicated that no recombinant protein accumulated either in the secreted or cellular fractions (data not shown). Removal of most of the 3'-UTR of pF3-GLY6c did not increase recombinant protein yields.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   Design of vector for expression and secretion of recombinant proteins. Truncated cDNAs encoding the 10 worm GLY proteins were introduced into the expression vector pIMKF3. A, pIMKF1, the parent plasmid pIMKF3, was previously constructed in pSVL, a SV40 promoter/enhancer-driven mammalian expression vector (6). B, pIMKF3 contains an expanded multiple cloning site between MluI and BamHI. C, the nucleotide and N-terminal amino acid sequences are indicated for the secreted region of the recombinant proteins. Boxes indicate translated regions encoding for the following: I, the insulin signal peptide; M, the histidine-rich metal binding site; K, the heart muscle kinase site for 32P labeling of recombinant proteins; and F, the FLAG antibody recognition sequence, used for immunoprecipitations. The cDNA insert begins with the stem region of the GLY proteins, which is cloned into the MluI site of pIMKF3 (circled residue in Fig. 2 indicates the first amino acid codon used in each expression clone); therefore, each construct directs secretion of a truncated GLY protein.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6.   Tricine-SDS-PAGE analysis of truncated recombinant GLY proteins. Expression constructs described in Fig. 5 and under "Experimental Procedures" were used to transiently transfect COS7 cells. A, the medium containing the secreted recombinant proteins was harvested, immunoprecipitated with anti-FLAG M2 antibody, and 32P-labeled with heart muscle kinase before electrophoretic analysis. B, detergent extracts of the transfected cells were treated as in A, to determine the level of recombinant protein retained in the intracellular fraction. Mock transfections were performed using the parent plasmid, pIMKF3. Arrows on the left side of the gel indicate bands that are autophosphorylated in the heart muscle kinase preparation (see mock lane).

Proteins GLY-5A, GLY-5B, and GLY-5C migrated with the largest apparent molecular weight, while GLY-8 migrated with the smallest. The inferred molecular weight of GLY-8 supported the cDNA sequence data, indicating that the size of its coding region was significantly smaller than the other transferase homologs, and confirmed our observations that a termination codon occurs immediately after a C-terminal HDEL sequence. This sequence confers endoplasmic reticular retention in the yeast Saccharomyces cerevisiae (16). Immunoprecipitations of the cellular fraction of transfected COS7 cells revealed that only GLY-8 and not ppGaNTase-mT1 (Fig. 6B), nor any of the other nematode GLY proteins (data not shown), were efficiently retained in the cell, indicating that the HDEL C-terminal sequence of GLY-8 could be functioning as a retrieval signal in COS7 cells. PhosphorImager quantitation indicated that approximately 80% of the GLY-8 truncated protein is retained in the cellular fraction, while for mouse ppGaNTase-T1, 85% is secreted (Fig. 6B).

To assess the functional identity of the nematode clones, ppGaNTase enzyme assays were initially performed with the recombinant GLY proteins and a multisite substrate (EA2) at two different temperatures, 23 °C and 37 °C (Table III). Because GLY-6B and GLY-6C clones were not stably expressed or did not express detectable levels of recombinant protein, only 9 of the 11 gly gene products were examined for ppGaNTase activity. Transferase assays showed that recombinant worm proteins (GLY-3, GLY-4, GLY-5A, GLY-5B, and GLY-5C) exhibited ppGaNTase activity in vitro at both temperatures; however, they catalyzed GalNAc transfer with a temperature optimum of 23 °C. GLY-7 and GLY-6A, on the other hand, showed a low rate of UDP-GalNAc hydrolytic activity, but Sep-Pak C18 reverse phase HPLC analysis revealed that this [14C]GalNAc was not transferred to the peptide acceptor substrate and the hydrolysis persisted in the absence of peptides. To assess if the GLY proteins could O-glycosylate different sequence motifs, ppGaNTase assays were performed with a panel of four diverse peptide substrates (Fig. 7). In enzyme assays at 23 °C, the worm enzymes GLY-3, -4, -5A, -5B, and -5C showed a similar preference for the multisite threonine-containing substrate EA2. GLY-4, -5A, -5B, and -5C were shown to glycosylate single-site threonine-containing peptides (EPO-T and TPPP) to a greater extent than GLY-3. The serine in EPO-S was glycosylated by GLY-3, -4, -5A, -5B, and -5C, however, at an extremely low rate, relative to threonine. Therefore, none of these GLY clones appeared to have a preference of serine over threonine in the human erythropoietin-derived peptide sequence (PPDAASAAPLR). The secreted truncated GLY-7 recombinant protein was abundantly expressed in the COS7 cell transfection system; however, it was not active with any peptide in this panel of substrates. Affinity-purified GLY-8 from either the secreted or intracellular fraction (Fig. 6, A and B) did not initiate O-glycosylation with the peptides tested (Fig. 7). GLY-6A and GLY-9 exhibited no detectable ppGaNTase activity; however, the level of recombinant proteins was significantly lower than the other affinity-purified enzyme preparations, and thus these enzymes may not have been as stable at the standard in vitro enzyme assay conditions.

                              
View this table:
[in this window]
[in a new window]
 
Table III
ppGaNTase enzyme activity of recombinant worm proteins
GalNAc transferase activity is measured using EA2 as a peptide acceptor. Rates are determined for 3 µl of anti-FLAG M2 antibody-purified recombinant proteins. A background of 150 cpm was subtracted from these values. Values were not normalized for levels of protein expression.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7.   ppGaNTase enzyme activity of recombinant GLY proteins. Each recombinant protein was assayed at 23 °C against a panel of four peptide substrates. The peptide sequences of the acceptor substrates are: EA2 (PTTDSTTPAPTTK), EPO-T (PPDAATAAPLR), EPO-S (PPDAASAAPLR), and TPPP (TPPP). A homogeneous preparation of murine ppGaNTase-mT1 was used to quantitate the relative yield of the COS7 cell-expressed recombinant proteins, determined by PhosphorImager scanning of the Tricine-SDS-PAGE gel in Fig. 6. Activity is represented for 1 pmol of recombinant protein.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

To determine if C. elegans could be used as a model system for studying the role of glycosylation in development, we have defined the family of enzymes that initiate, and thereby regulate, the acquisition of sugar chains on mucin-type glycoproteins. Genome sequence data suggest that nematodes express an abundance of mucin-type glycoproteins. Some surface-associated glycoproteins are modified with mammalian mucin-like O-linked glycans (17). The expression of specific cell surface-associated O-linked glycoproteins or O-glycan epitopes is also developmentally regulated at specific larval stages in C. elegans. Surprisingly, only one ppGaNTase gene (gly-3/ZK688.8) has been reported by the finished sequences of the C. elegans genome project, despite the fact that the genome sequence is about 70% complete. Therefore, in this present study, we focused on identifying the size and members of the ppGaNTase family through analysis of the EST project. To increase the probability of cloning cDNAs encoding this complete gene family, we screened two cDNA libraries generated from the whole organism at different developmental stages. By this method, we isolated 11 distinct ppGaNTase cDNAs and full-length coding regions in a single effort and accounted for all EST clones with homology to mammalian ppGaNTase enzymes in the C. elegans data base, placing the putative size of the ppGaNTase family of proteins at 11 members in this organism. Ultimately, we expect that with the expansion of the EST data base and the completion of the C. elegans genome sequence (predicted completion date in 1999), the absolute size of this family of sequence homologs will be unambiguously determined.

ppGaNTase activity in both mammals and nematodes is catalyzed by a family of proteins having a highly conserved primary structure. The predicted structural domains are summarized in Fig. 3. In mammals, two processed forms are naturally produced by each gene: a membrane-bound Golgi resident enzyme and a catalytically active soluble form, which is secreted into most body fluids upon protease cleavage of its N-terminal membrane anchor. At least one putative N-glycosylation site is present in all GLY proteins; this is consistent with the bovine ppGaNTase-mT1 isozyme, which is efficiently produced if one of the N-glycosylation sites is occupied (18). Based on previous studies with four mammalian ppGaNTase isoforms, we identified a 420-amino acid region of the enzyme that appears to be highly conserved (6). However, sequence comparisons between homologous mammalian and worm enzymes identified in this current study caused us to re-evaluate the size of the central catalytic domain and to suggest that the evolutionarily conserved region actually spans approximately 333 amino acids, not 420 aa. The intraspecies amino acid sequence conservation (percent similarity) in this catalytic region of either mammalian or nematode transferases is about 60-80%. The size of the catalytic domain was supported by N-terminal deletion analysis of the murine ppGaNTase-mT1, which revealed that the N terminus and part of the stem region (between the transmembrane anchor and the beginning of the conserved sequence in the catalytic domain) are not required for catalysis (18). The amino acid alignments of the 11 C. elegans sequence homologs indicated that the greatest source of sequence diversity of this gene family is in the N- and C-terminal sequences flanking the central catalytic domain. C-terminal to the catalytic region, most ppGaNTase enzymes share structural homology to a putative ricin-like lectin domain, first reported by Hazes (15); however, the GLY-8, GLY-6A, GLY-6B, and GLY-6C proteins either lack the lectin-like segment or have an extremely divergent sequence. The functional importance of this lectin-like motif is presently not understood, but appears to be important for production, secretion, or stability, because GLY-6C protein lacks part of this motif and is not expressed at a detectable level. Surprisingly, GLY-8 lacks this C-terminal lectin-like domain completely, and instead ends with a HDEL motif, which has been previously shown to act as a retrieval signal for lumenal endoplasmic reticulum proteins in S. cerevisiae (16). The C-terminal primary sequence has an additional source of sequence variation in two pairs of cDNAs, gly-5 and gly-6, which both contain three variant segments.

Preliminary analysis of shotgun genome sequence data indicates that at least the GLY-5B and GLY-5C proteins are encoded by a single gene that is alternatively spliced. If the variants of GLY-6 are similarly derived by alternative splicing, then the 11 homologous cDNAs will be encoded by seven different genetic loci in worms. The number of functionally active ppGaNTase isozymes detected in C. elegans (five isozymes catalyze in vitro ppGaNTase activity) is similar to the number that has been reported in mammals. However, the actual number of ppGaNTase sequence homologs in mammals is expected to be larger, because mammals have a more complex genome and because the human EST data base contains additional novel ppGaNTase-like cDNAs (8), which have not been functionally expressed at this time. The combined sequence data of the mammalian and worm ppGaNTase homologs is useful for identifying candidate amino acid residues in the active site. The amino acid sequence alignment of the ppGaNTases in mammals and C. elegans indicates numerous residues and positions that are invariant among evolutionarily diverse organisms. Site-directed mutagenesis of the invariant positions is currently being performed to identify those residues that are essential for enzyme function.

In this study, we observed that not all the recombinant GLY proteins were functionally active on the set of four mammalian peptide substrates tested. O-Glycosylation of a serine-containing human erythropoietin peptide and its threonine homolog were used to test if any of the ppGaNTases had a preference for serine. All worm transferases (as well as mammalian ppGaNTase-T1, -T3, and -T4) appeared to catalyze GalNAc transfer to threonine at a much higher rate than to serine in the erythropoietin-derived peptides, under in vitro conditions. Four members of this gene product family (GLY-6A, -7, -8, and -9) did not transfer GalNAc to the mammalian peptide substrates tested in this study, using an in vitro assay. This observation suggests that either the in vitro conditions do not reproduce the in vivo intracellular environment or that the correct substrates (peptide or nucleotide-sugar) of these enzymes have not been identified. The inability to simulate an appropriate Golgi environment in vitro may interfere with the O-glycosylation assay, as has been observed with a polypeptide mannosyltransferase. Polypeptide mannosyltransferase 4 is functionally responsible for glycosylating the O-mannosyl protein Ggp1p in vivo in yeast, but would not glycosylate its cognate substrate in vitro, using a protocol that had functioned for other members of the polypeptide mannosyltransferase family (19). Therefore, the functional identity of the GLY-6A, -6B, -6C, -7, -8, and -9 proteins is not clear, despite their remarkable similarity to bona fide ppGaNTase enzymes. In the case of the C. elegans GLY-6A and GLY-7 recombinant proteins, we observed UDP-GalNAc hydrolytic activity in the absence of peptide substrates. This low rate of hydrolysis is a trait shared with many ppGaNTases from both worms and mammals identified to date. This suggests that the GLY-6A and GLY-7 enzymes are capable of recognizing UDP-GalNAc as a potential sugar donor. Future in vivo studies will be directed at identifying the substrates and reaction requirements of GLY-6A, -6B, -7, -8, and -9 isozymes.

Given the diversity of sequences that are O-glycosylated and the large number of ppGaNTase substrates expressed by a given cell or organism, the existence of a complex gene family of ppGaNTase isozymes is not surprising. However, it is not clear why both mammals and nematode ppGaNTases display such a large overlap in their peptide substrate reactivity. Five members of the gene family from nematodes identified in this study (GLY-3, GLY-4, GLY-5A, GLY-5B, and GLY-5C) are each capable of glycosylating most of the peptide substrates tested, though the rates of transfer for each isoform differed. The other isoforms identified here lack observable ppGaNTase activity with those same peptide substrates. These may then represent members of the gene family with a more rigid or restricted specificity. Gene ablation studies of polypeptide mannosyl transferases in S. cerevisiae and Drosophila melanogaster have indicated that protein mannosylation is essential for viability in yeast and for the symmetry and alignment of the adult body plan and musculature in the fly (19, 20). More significantly, multiple mannosyltransferases from the yeast need to be ablated before phenotypic variance can be detected. This could prove to hold true for ppGaNTases in nematodes, as well, and may help to determine if ppGaNTase isoforms are functionally redundant in a biological model.

    ACKNOWLEDGEMENTS

We thank Dr. Robert Barstead for the cDNA library; Dr. Yuji Kohara, Dr. Robert Waterston, and Dr. Lucinda Fulton for some of the EST clones; and Marlene Balys for technical assistance. We also gratefully thank Dr. Lawrence Tabak for supporting this effort and reviewing this work.

    Note Added in Proof

Recent submissions to the C. elegans EST database revealed two additional ppGaNTase sequence homologs, placing the size of the family to a total of 13 isoforms, encoded by 9 genes.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grant DE-08108.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF031833 (gly-3), AF031834 (gly-4), AF031835 (gly-5a), AF031836 (gly-5b), AF031837 (gly-5c) AF031838 (gly-6a), AF031839 (gly-6b), AF031840 (gly-6c), AF031841 (gly-7), AF031842 (gly-8), and AF031843 (gly-9).

Dagger To whom correspondence should be addressed: Center for Oral Biology, School of Medicine and Dentistry, University of Rochester, 601 Elmwood Ave., Box 611, Rochester, NY 14642. Tel.: 716-275-0380; Fax: 716-473-2679; E-mail: fred_hagen{at}urmc.rochester.edu.

1 The abbreviations used are: GalNAc, N-acetylgalactosamine; ppGaNTase, UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase; EST, expressed sequence tag; PCR, polymerase chain reaction; UTR, untranslated region; nt, nucleotide(s); aa, amino acid(s); PAGE, polyacrylamide gel electrophoresis; Tricine, N-tris(hydroxymethyl)methylglycine; MES, 2-(N-morpholino)ethanesulfonic acid.

2 K. G. Ten Hagen, F. K. Hagen, and L. A. Tabak, manuscript in preparation.

3 The gly gene name designation is used by the C. elegans community to refer to glycosylation-related gene products; therefore, "gly" genes include the ppGaNTase homologs identified in this study, as well as other glycosyl transferases, glycosidases, and components related to the N- and O-linked glycosylation pathway.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Homa, F. L., Hollander, T., Lehman, D. J., Thomsen, D. R., and Elhammer, A. (1993) J. Biol. Chem. 268, 12609-12616[Abstract/Free Full Text]
  2. Hagen, F. K., VanWuyckhuyse, B. C., and Tabak, L. A. (1993) J. Biol. Chem. 268, 18960-18965[Abstract/Free Full Text]
  3. White, T., Bennett, E. P., Takio, K., Sorensen, T., Bonding, N., and Clausen, H. (1995) J. Biol. Chem. 270, 24156-24165[Abstract/Free Full Text]
  4. Bennett, E. P., Hassan, H., and Clausen, H. (1996) J. Biol. Chem. 271, 17006-17012[Abstract/Free Full Text]
  5. Zara, J., Hagen, F. K., Ten Hagen, K. G., VanWuyckhuyse, B. C., and Tabak, L. A. (1996) Biochem. Biophys. Res. Commun. 228, 38-44[CrossRef][Medline] [Order article via Infotrieve]
  6. Hagen, F. K., Ten Hagen, K. G., Beres, T. M., Balys, M. M., VanWuyckhuyse, B. C., and Tabak, L. A. (1997) J. Biol. Chem. 272, 13843-13848[Abstract/Free Full Text]
  7. Hennet, T., Hagen, F. K., Tabak, L. A., and Marth, J. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 92, 12070-12074[Abstract/Free Full Text]
  8. Hagen, F. K., Gregoire, C., and Tabak, L. A. (1995) Glycoconjugate J. 12, 901-909[CrossRef][Medline] [Order article via Infotrieve]
  9. Marth, J. D. (1996) Glycobiology 6, 701-705[Free Full Text]
  10. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410[CrossRef][Medline] [Order article via Infotrieve]
  11. Barstead, R. J., and Waterston, R. H. (1989) J. Biol. Chem. 264, 10177-10185[Abstract/Free Full Text]
  12. Albone, E. F., Hagen, F. K., VanWuyckhuyse, B. C., and Tabak, L. A. (1994) J. Biol. Chem. 269, 16845-16852[Abstract/Free Full Text]
  13. Sulston, J., Du, Z., Thomas, K., Wilson, R., Hillier, L., Staden, R., Halloran, N., Green, P., Thierry-Mieg, J., Qiu, L., Dear, S., Coulson, A., Craxton, M., Durbin, R., Berks, M., Metxstein, M., Hawkins, T., Ainscough, R., and Waterston, R. (1992) Nature 356, 37-41[CrossRef][Medline] [Order article via Infotrieve]
  14. Clausen, H., and Bennett, E. P. (1996) Glycobiology 6, 635-646[Free Full Text]
  15. Hazes, B. (1996) Protein Sci. 5, 1490-1501[Abstract]
  16. Hardwick, K. G., Lewis, M. J., Semenza, J., Dean, N., and Pelham, H. R. (1990) EMBO J. 3, 623-630[Medline] [Order article via Infotrieve]
  17. Hemmer, R. M., Donkin, S. G., Chin, K. J., Grenache, D. G., Bhatt, H., and Politz, S. M. (1991) J. Cell. Biol. 115, 1237-1247[Abstract/Free Full Text]
  18. Wragg, S., Hagen, F. K., and Tabak, L. A. (1998) Biochem. J. 328, 193-197
  19. Gentzsch, M., and Tanner, W. (1997) Glycobiology 7, 481-486[Abstract/Free Full Text]
  20. Martin-Blanco, E., and Garcia-Bellido, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6048-6052[Abstract/Free Full Text]
  21. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Nehrke, J. Denton, and W. Mowrey
Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program
Am J Physiol Cell Physiol, January 1, 2008; 294(1): C333 - C344.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. Nguyen, I. van Die, K. M Grundahl, Z. S Kawar, and R. D Cummings
Molecular cloning and characterization of the Caenorhabditis elegans {alpha}1,3-fucosyltransferase family
Glycobiology, June 1, 2007; 17(6): 586 - 599.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Wang, K. Julenius, J. Hryhorenko, and F. K. Hagen
Systematic Analysis of Proteoglycan Modification Sites in Caenorhabditis elegans by Scanning Mutagenesis
J. Biol. Chem., May 11, 2007; 282(19): 14586 - 14597.
[Abstract] [Full Text] [PDF]