J Biol Chem, Vol. 273, Issue 14, 8398-8406, April 3, 1998
Substitution of the Degenerate Smooth Muscle (SM)
-Actin
CC(A/T-rich)6GG Elements with c-fos Serum
Response Elements Results in Increased Basal Expression but Relaxed SM
Cell Specificity and Reduced Angiotensin II Inducibility*
Martina B.
Hautmann
,
Cort S.
Madsen§,
Christopher P.
Mack
, and
Gary K.
Owens
¶
From the
Department of Molecular Physiology and
Biological Physics, University of Virginia Health Sciences Center,
Charlottesville, Virginia 22908 and § Cardiovascular Drug
Discovery, Bristol-Myers Squibb,
Princeton, New Jersey 08543
 |
ABSTRACT |
We have previously demonstrated that both
CC(A/T-rich)6GG (CArG) elements A and B of the smooth
muscle (SM)
-actin promoter are required for smooth muscle cell
(SMC)-specific expression and angiotensin II (AII)-induced stimulation.
Moreover, results provided evidence that AII responsiveness of SM
-actin was at least partially dependent on modulation of serum
response factor (SRF) binding to the SM
-actin CArGs by the
homeodomain containing protein, MHox. The goal of the present study was
to investigate whether the degeneracy of the SM
-actin CArGs (both
contain a Gua or Cyt substitution in their A/T-rich center) and their
reduced SRF binding activity as compared with c-fos serum
response element (SRE) is important for conferring cell type-specific
expression and AII responsiveness. Transient transfection assays using
SM
-actin reporter gene constructs in which the endogenous SM
-actin CArGs were replaced by c-fos SREs demonstrated
the following: 1) relaxation of cell-specific expression, 2) a 50%
reduction in AII responsiveness, and 3) reduced ability to be
transactivated by MHox. In addition, we also showed that the position
of the SM
-actin CArGs was important in that interchanging them
abolished both basal and AII-induced activities. Taken together, these
results suggest that the reduced SRF binding activities of the SM
-actin CArGs and CArG positional context contribute to SMC-specific
expression of SM
-actin as well as maximal AII responsiveness.
 |
INTRODUCTION |
The CArG1 motif,
characterized by the consensus sequence CC(A/T-rich)6GG, is
found in the promoters of several immediate-early response genes (1-5)
including c-fos and has been shown to confer serum- and
growth factor-induced transcriptional activation of these genes
(reviewed in Ref. 6). CArG boxes are also present in the promoters of
many skeletal and cardiac muscle-specific genes and are required for
developmental and tissue-specific expression (Refs. 7-15, reviewed in
Ref. 16). Although CArG elements bind the ubiquitously expressed
transcription factor SRF, it is unlikely that SRF alone is sufficient
to confer the functional diversity of CArG elements. A large body of
evidence has accumulated suggesting that CArG-dependent
gene regulation is modulated by post-translational modification of SRF
(17), interaction of SRF with SRF accessory proteins (reviewed in Refs.
6 and 18), and combinatorial interaction with other
trans-factors in a promoter-specific fashion (15, 19, 20).
For example, Sartorelli et al. (21) demonstrated that
muscle-specific expression of cardiac
-actin required the presence
of CArG boxes, binding sites for SP 1, and the muscle-specific factor
MyoD. Previous results from our laboratory also provided evidence for involvement of the SM
-actin CArGs in cell
type-specific expression of SM
-actin in concert with other
regulatory elements (20). Moreover, CArG elements have also been
shown to play a role in regulation of virtually all SMC differentiation
marker genes characterized to date including SM-22
(22, 23), SM MHC
(24, 25), telokin (26), and h-caldesmon (27).
In contrast to the c-fos gene which contains a single high
affinity binding site for SRF in its promoter, many muscle-specific genes including skeletal, cardiac, SM
-actin, SM MHC, and SM-22
contain two or more CArG elements (7, 20, 24, 28, 29). Based on direct
measurements of SRF binding (30, 31) and/or predicted SRF binding
affinity based on DNA sequence analysis (see Leung and Miyamoto (32)
for criteria) many of these CArG elements bind SRF with relatively low
affinity as compared with the c-fos SRE. For example, both
SM
-actin CArGs A and B, the two distal skeletal
-actin SREs
(31), human cardiac
-actin CArG 2, 3, and 4 (28), as well as the SM
MHC CArG 2 (24) contain Gua or Cyt substitutions within their central
A/T-rich region that reduces SRF binding activity (32). In addition,
the most proximal cardiac
-actin CArG, although not containing a Gua
or Cyt substitution, was shown to bind SRF less effectively than the
c-fos SRE (30). The preceding observations raise the
question as to why relatively low affinity CArG elements have been
highly conserved during evolution, especially in the light of strong evidence indicating that increased transcriptional activity of a number
of CArG-dependent genes is associated with increased SRF
binding activity (33-36). One possible hypothesis is that weaker CArG
elements might offer an additional level of control through mechanisms
that influence SRF binding. In contrast, strong SRF binding CArGs
appear to be regulated primarily at post-SRF-CArG binding steps through
interaction with SRF accessory proteins whose activity is controlled by
kinase/phosphatase regulatory systems (reviewed in Ref. 37).
A number of mechanisms have been shown to increase SRF binding to CArG
elements including post-translational modification of SRF (17),
increased SRF protein expression (34), and interaction of SRF with
homeodomain factors that modulate SRF binding or kinetics (38). For
example, Croissant et al. (34) have shown that increased SRF
protein levels appeared to be obligatory for increased skeletal
-actin expression during myoblast differentiation. In addition, we
have previously provided evidence that TGF-
and AII-induced increases of SM
-actin expression in SMC were accompanied by increased SRF binding to CArG A and B (39, 40). Whereas TGF-
increased SRF protein expression, AII treatment did not. Our work suggested that the AII effects on SM
-actin transcription were mediated, at least in part, by modulation of SRF binding to CArG B by
the homeodomain containing protein MHox, which has been shown to
increase SRF binding to CArG B in vitro (40). Walsh and
co-workers (41) have carried out extensive and eloquent studies of the importance of both the CArG central A/T region and flanking sequences of the skeletal
-actin muscle regulatory element for muscle-specific expression. For example, the authors demonstrated that replacement of
the muscle regulatory element by a c-fos SRE resulted in
loss of muscle-specific expression of skeletal
-actin. However, to our knowledge, no studies have specifically addressed the importance of
weakly binding degenerate CArG elements per se in regulation of muscle-specific genes nor have any studies addressed the importance of such elements in control of SMC-specific and agonist-induced transcriptional regulation.
The aim of the present study was to determine whether sequence
degeneracy of the SM
-actin CArG elements and their reduced SRF
binding activity contributes to cell-specific SM
-actin expression as well as the ability of the gene to be regulated in response to AII
or the mesodermally restricted homeodomain containing protein MHox.
 |
MATERIALS AND METHODS |
Construction of Promoter-CAT Expression Plasmids--
The
generation of various SM
-actin promoter CAT constructs, including
the CArG A and B mutants, have been described previously (20).
Additional CArG mutations within a 155-bp or 2.8-kb SM
-actin
promoter CAT construct (pProm CAT) were generated using the Ex-site
mutagenesis kit according to the manufacturer's instructions (Stratagene). The integrity and accuracy of the mutated constructs were
determined by dideoxy sequencing (42).
All promoter-CAT plasmid DNAs used for transfections were prepared
using an alkaline lysis procedure (43) followed by banding on two
successive ethidium bromide cesium chloride gradients. Transfection
results were not altered when independent plasmid preparations were
tested.
Cell Culture, Transient Transfections, and Reporter Gene
Assays--
SMC from rat thoracic aorta and bovine endothelial cells
(BAEC) were isolated and cultured as described previously (20, 44). The
culture conditions for the rat L6 skeletal myoblast were also described
previously (20), and fusion into myotubes was induced by reducing fetal
bovine serum (FBS) concentrations to 1% when cells reached confluency.
AKR-2B mouse embryonic fibroblasts were a gift of Dr. Harold Moses
(Vanderbilt University, Nashville, TN) and were cultured in McCoy's 5A
medium (Life Technologies, Inc.) supplemented with 5% FBS, 0.68 mM L-glutamine (Sigma), 100 units/ml
penicillin, and 100 µg/ml streptomycin (Life Technologies, Inc.). SMC
(passages 20-30), L6 skeletal myoblasts, and AKR-2B fibroblasts were
seeded for transient transfection assays into 6-well plates at a
density of 1.5 × 104 cells/cm2 and BAEC
at a density of 2 × 104 cells/cm2.
Transfection of the CAT reporter gene constructs (4 µg of DNA per
well) was performed in triplicate 30 h (in case of L6 myoblasts, 48 h) after plating using the transfection reagent DOTAP
(Boehringer Mannheim) (6.7 µl/µg DNA) according to the
manufacturer's recommendations. BAEC were transfected using the
transfection reagent Transfectam (Promega) according to the
manufacturer's instructions since transfection efficiency in these
cells was lower with DOTAP.2
No differences in transfection efficiencies were observed between Transfectam and DOTAP in other cell types. Cells were exposed to the
DNA/DOTAP or DNA/Transfectam mixture for 5 h under serum-free conditions. After incubation, the transfection medium was replaced by
serum containing medium, and the cells were harvested for the reporter
assay 72 h later by scraping into ice-cold buffer A (15 mM Tris (pH 8.0), 60 mM KCl, 15 mM
NaCl, 2 mM EDTA, 0.15 mM spermine tetrahydrochloride, 1 mM dithiothreitol) (45). Cell lysates were prepared by four freeze-thaws, followed by 10 min heat
inactivation at 65 °C; 95-µl aliquots of each cell extract were
assayed for CAT activity by enzymatic butyrylation of tritiated
chloramphenicol (NEN Life Science Products) (46). CAT activities were
normalized to that of a control promoterless construct set to one as
described previously (20). This permits comparison of the activity of the wild-type p155 region versus that of the various mutants
including disruption of the CArGs or substitution with the
c-fos SRE. Normalization of CAT activity to that of SM
-actin constructs containing mutations of CArG A and B was not
performed because CArG mutations have differential effects in SMC
versus non-SMC, and such normalization would preclude
comparison of the cell-specific functionality of the SM
-actin CArGs
versus the c-fos SRE, a major aim of the present
studies. Experiments were repeated two to three times, and relative CAT
activity data were expressed as the mean ± S.D. unless otherwise
noted.
SMC used for transfection experiments involving AII stimulation were
plated at a density of 3 × 103/cm2, grown
to confluency in 10% serum containing medium, and then growth-arrested
for 4 days in serum-free medium (SFM) (47) prior to stimulation with
AII (Peninsula Laboratories, 10
6 M) or SFM.
Cells used for these experiments were between the 6th and the 12th
passage. SMC that are growth-arrested in this fashion express multiple
SMC differentiation marker proteins including SM
-actin, SM MHC,
h-caldesmon, h1 calponin, SM tropomyosin, and SM myosin
light chain (MLC20)
(48-50).3 Confluent,
growth-arrested SMC were then transiently transfected (in triplicate in
6-well plates) with 5 µg of DNA using the transfection reagent DOTAP
(Boehringer Mannheim) according to the manufacturer's recommendations.
After an incubation period of 12-14 h, the medium was replaced with
fresh serum-free medium, and AII (10
6 M) or
vehicle were added. Cells were harvested 72 h later and processed
for the reporter assay as described above.
Preparation of Nuclear Extracts and Electrophoretic Mobility
Shift Assays (EMSA)--
Crude nuclear extracts from SMC were prepared
by the method of Dignam et al. (51). SMC were either grown
to confluency in 10% FBS or growth-arrested in SFM for 4 days when
treated with AII. SMC were then exposed to AII (10
6
M) or SFM for 4 h. Protein concentrations were
measured by the Bradford assay (Bio-Rad). Probes for EMSA were obtained
by end-labeling 20 µM single-stranded oligonucleotides
with 150 µCi of [
- 32P]ATP (6000 Ci/mmol) and T4
polynucleotide kinase. Labeled single-stranded oligonucleotides were
annealed, and unincorporated nucleotides were removed using Nuc Trap
Push columns (Stratagene) as recommended by the manufacturer. The
specific activity for all probes used was 1.0-1.1 µCi/pmol. The
following nucleotides, purchased commercially (Operon Technologies,
Inc.), were used as a probe (only sense strand shown): CArG B, 5'
GAGGTCCCTATATGGTTGTG 3'; CArG A, 5' TTGCTCCTTGTTTGGGAAGC 3';
c-fos SRE, 5' GATGTCCATATTAGGACATC 3'.
EMSA were performed with 20-µl binding reactions that contained ~50
pg of 32P-labeled annealed oligonucleotides, nuclear
extracts (3 or 5 µg in Dignam buffer D), human recombinant SRF (1 or
2 µl), 100 mM KCl, 5 mM HEPES (pH 7.9), 1 mM EDTA, 35 mM Tris (pH 7.5), 1.125 mM dithiothreitol, 10% glycerol, and 0.125 µg of
poly(dI-dC) as a nonspecific competitor. Specific antibodies against
SRF (Santa Cruz, 2 µg/reaction) were added when indicated. The
binding reaction was incubated for 20 min at room temperature before
radiolabeled probe was added, followed by another 20 min at room
temperature incubation. All binding reactions were loaded on a 4.5%
polyacrylamide gel and electrophoresed at 170 V in 0.5× TBE. The gels
were dried and subjected to autoradiography at
70 °C.
In Vitro Synthesis of SRF--
In vitro synthesis of
SRF was performed using a TNT®-coupled reticulocyte lysate translation
system (Promega) with the human SRF cDNA clone p T7 Æ ATG (52) as
a template.
 |
RESULTS |
The SM
-Actin CArG Elements A And B Showed Reduced SRF Binding
as Compared with the c-fos SRE--
There is extensive evidence
showing that the internal A/T-rich center of CArG elements affects SRF
binding affinities (24, 31, 32, 53). Leung and Miyamoto (32)
demonstrated that substitution of A/Ts in the core of the
c-fos SRE by guanidines or cytosines resulted in marked
reduction of SRF binding affinity, especially when the substitution was
made in the middle of the A/T-rich center. In contrast to the
c-fos SRE, the A/T-rich center of CArG B of the SM
-actin
promoter contains a cytosine substitution (see
Fig. 1), and CArG A contains a guanidine
substitution in the middle of the A/T-rich center (see Fig. 1). Thus,
we would predict that binding activity of the SM
-actin CArGs for
SRF would be reduced as compared with the c-fos SRE. To test
this directly, recombinant, in vitro translated SRF was
incubated at different concentrations with radiolabeled CArG A, B, and
c-fos SRE oligonucleotides. EMSA demonstrated that SRF
binding activity was lowest with the CArG A probe, intermediate with
the CArG B probe, and highest with the c-fos SRE probe (Fig.
2A, lanes 1-6). To determine
whether the pattern of SRF binding activities to the different CArG
elements was similar with SMC nuclear extracts as compared with those
observed with recombinant SRF, we performed gel shift assays using
nuclear extracts derived from SMC grown in 10% serum. Similar to the
results obtained with recombinant SRF, SRF binding activity derived
from SMC was lowest with CArG A, intermediate with CArG B, and highest
with the c-fos SRE (Fig. 2B, lanes 1-3). These
identical binding patterns suggest that SRF obtained from the SMC
extract was not modified in such a manner as to significantly affect
binding activity to each of these three probes and that SRF binding
activity was not altered by any additional SMC proteins present in the
extract, at least under the conditions of our gel shift assays.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
A schematic description of CArG mutations
made in a 155-bp or 2.8-kb SM -actin promoter context (pProm
CAT).
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
A, comparative gel shift analysis of the
SRF binding activities of CArG A, CArG B, and the c-fos SRE.
Radiolabeled 20-bp CArG A (lanes 1 and 2), CArG B
(lanes 3 and 4), and c-fos SRE
(lanes 5 and 6) double-stranded oligonucleotides
were incubated with 1 or 2 µl of in vitro translated human
SRF (rec.SRF) for 20 min at room temperature. Polyclonal SRF antibodies (Santa Cruz) raised against the COOH
terminus of human SRF was added at a concentration of 2 µg/reaction
(lanes 7 and 9). Unprogrammed lysate
(UP) was incubated with a CArG B probe (lane 10).
B, nuclear extracts (5 µg) from rat SMC growing in 10%
FBS were incubated with radiolabeled CArG A, B, and c-fos
SRE oligonucleotides (lanes 1-3). An SRF antibody (Santa
Cruz) was added to the binding reaction in lanes 4-6. Based
on cold competition experiments (lanes 7-9, and Ref. 20)
and the SRF supershift analyses (Ref. 20 and this figure) only the band
labeled SRF represents specific SRF binding. The faint lower
mobility bands seen in virtually all lanes of this figure and in Fig.
7, lanes 5, 6, and 9, were not consistently
observed and appeared to represent nonspecific binding based on
competition experiments with wild-type and mutant oligonucleotides
(Ref. 20 and data not shown).
|
|
Transcriptional Activity of SM
-Actin Varied as a Function of
SRF Binding Activities of Its CArG Motifs--
Previous studies
including our own (33-36, 39, 40) have shown a correlation between
increased SRF binding activity and transcriptional activity of a number
of CArG-dependent genes. Thus, replacement of the SM
-actin CArGs by stronger or weaker SRF binding sites should alter SM
-actin transcription correspondingly. To test this, we generated
various combinations of "strong CArGs" (c-fos SRE),
"intermediate CArGs" (CArG B), and "weak CArGs" (CArG A) within
a 155-bp SM
-actin promoter context by changing the internal CArG
sequences as depicted in Fig. 1. Since the focus of the present study
was to investigate the effects of SRF binding activities on
transcriptional regulation of SM
-actin, we did not change the
flanking sequences. Results of transient transfection assays, carried
out in SMC growing in 10% serum, showed that replacement of either
CArG A or B, or both with a c-fos SRE, resulted in increased SM
-actin transcription as compared with a wild-type p155 CAT construct (2-3.5-fold) with maximal increases seen with the SRE-SRE construct (Fig. 3). Due to the high
activity of c-fos SRE-containing constructs, special care
was taken to ensure that the CAT assay was performed in the linear
range of the assay. In contrast, when two CArG A elements were present,
almost all activity was lost. These results indicate that SM
-actin
transcription varies as a function of the relative SRF binding
activities of its CArG elements.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of strong and weak CArGs on reporter
activity. Wild-type SM -actin p155 CAT (subcloned into a
promoterless pBL CAT vector) and constructs containing a
c-fos SRE ("strong CArG") substituting CArG B (pBL
155 CAT SRE-A) or CArG A (pBL 155 CAT B-SRE) or both
(pBL 155 CAT SRE-SRE) as well as a construct containing two
CArG A ("weak CArGs") were transiently transfected into
subconfluent SMC, growing in 10% FBS. CAT activities were expressed
relative to the base-line CAT activity of a promoterless CAT construct.
Data represent means ± S.E. of three independent
experiments.
|
|
Positioning of CArG Elements Was Critical for SM
-Actin
Transcriptional Activity--
Previous studies study by Lee et
al. (54) provided evidence that the three skeletal
-actin CArGs
are bound by SRF in a specific order as determined by their relative
SRF binding affinities and that the position of the individual CArGs to
each other plays an important role in formation of transcriptionally
active complexes. To test whether CArG positioning was also critical
for activation of the SM
-actin promoter, we tested three sets of
paired constructs in which the SRF binding elements (c-fos
SRE, CArGs A, and B) were replaced at position 1 (proximal) and
position 2 (distal) in reversed combinations (see Fig. 1). As shown in
Fig. 4, differences in activities between
these constructs clearly demonstrate that positions 1 and 2 are not
functional equivalents of each other. In all instances, when the lesser
affinity CArG was located at position 2 activity was decreased.
Particularly striking was the significant decrease in activity when
CArG A and B were switched (pBL 155 CAT A-B). This loss was not due to
a negative effect of placing CArG B at position 1 since pBL 155 CAT A-A
also had essentially the same low activity (see Fig. 3). No significant changes in transcriptional activity were observed when the positions of
the two CArG elements with relatively high SRF binding capacities (CArG
B and c-fos SRE) were interchanged. These results
demonstrate that positioning of the CArG elements is critical in the
regulation of the SM
-actin gene and that maximal levels of activity
appeared to require the presence of an intermediate or high affinity
SRF binding motif at position 2.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of the effects of CArG positions on
reporter activity. Three pairs of constructs containing the CArG
elements in a reversed position were transfected into subconfluent SMC
growing in 10% FBS. CAT activities were expressed relative to the
base-line CAT activity of a promoterless CAT construct. Data represent
means ± S.E. of three independent experiments.
|
|
Replacement of the SM
-Actin CArGs by c-fos SREs Resulted in
Relaxation of Cell Specificity--
Previously, we have demonstrated
that the SM
-actin CArG elements A and B contribute to cell-specific
regulation of this gene (20) in that mutation of either CArG A or B
completely abolished activity of a p125 bp SM
-actin promoter CAT
construct in SMC but not in BAEC. These results suggested that factors
other than SRF were required for the high transcriptional activity of the p125 CAT construct in BAEC. Results of our earlier studies (20)
also demonstrated that the region of the SM
-actin promoter upstream
from
125 bp to
2.8 kb contained negative regulatory elements that
completely suppressed the transcriptional activity of the
125-bp
region in BAEC. To test whether CArG elements with strong SRF
affinities like the c-fos SREs would alter the activity of
the SM
-actin promoter in BAEC, we transfected a pBL 155 CAT wild-type (Wt) construct and a pBL 155 CAT construct containing two
c-fos SREs (pBL 155 CAT SRE-SRE) into BAEC (Fig.
5). For comparison, constructs were also
transfected in parallel into SMC. Transfection data demonstrated that
activity of the pBL 155 CAT Wt construct was ~6-fold higher in SMC as
compared with BAEC. Consistent with our earlier studies, mutations of
the CArG elements A and B alone or in combination completely abolished
CAT activities in SMC but had little effect in BAEC. However,
replacement of the SM
-actin CArGs with c-fos SREs
(i.e. pBL 155 CAT SRE-SRE) resulted in a marked increase in
CAT activity in BAEC (~600-fold over promoterless controls). This
activity was CArG-dependent, since mutation of the SRE at
either position 1 or 2 reduced CAT activity in BAEC to that of the pBL
155 CAT Wt construct. Importantly, single SRE mutations reduced but did
not abolish CAT activities in SMC. This is in marked contrast to
observations with wild-type promoter constructs where mutation of CArG
A or B alone completely abolished activity in SMC. Taken together,
these results suggest the following: 1) replacement of the relatively
weak SRF binding sites of the SM
-actin promoter with strong CArG
elements resulted in high level SM
-actin expression in BAEC; 2) the
gain in transcriptional activity obtained with the pBL 155 CAT SRE-SRE
construct in BAEC was mediated through a CArG-dependent
mechanism whereas CArG-independent factors regulated the activity of
the pBL 155 CAT Wt construct; and 3) the presence of a c-fos
SRE at either position 1 or 2 reduced the dependence of transcriptional
activity on a second CArG element in SMC.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5.
Analysis of the contribution of
c-fos SREs to SM -actin promoter activities in BAEC and
SMC. A wild-type SM -actin p155 CAT construct and constructs
containing a mutation of CArG A (pBL 155 CAT B-Am) or B
(pBL 155 CAT Bm-A) or both CArGs together (pBL 155 CAT
Bm+Am) as well as constructs in which CArG A and B have been
replaced by c-fos SREs or in which the SRE has been mutated
either in position of CArG B (pBL 155 CAT SRE Bm-SRE) or
CArG A (pBL 155 CAT SRE-SRE Am) were transiently transfected
into subconfluent SMC or BAEC growing in 10% FBS. CAT activities were
expressed relative to the base-line CAT activity of a promoterless CAT
construct. Data represent means ± S.E. of three independent
experiments. , SMC; , EC.
|
|
Since we previously have shown that upstream sequences in the SM
-actin promoter selectively repressed transcriptional activity of SM
-actin in BAEC, we also tested whether c-fos SRE
substitutions in the context of a 2.8-kb SM
-actin promoter
(designated pProm CAT SRE-SRE) could overcome the effects of these
negative acting elements. Transfection results demonstrated that the
activity of the pProm CAT SRE-SRE construct in BAEC was increased as
compared with the wild-type (pProm CAT) construct (Fig.
6). However, activity of pProm CAT
SRE-SRE in BAEC was much less than the activity of the same construct
in SMC. Taken together, these results indicate that strong CArG
elements could only partially overcome negative regulatory elements
between
125 bp to
2.8 kb that suppress activity in BAEC.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of replacement of the SM -actin
wild-type CArGs by c-fos SREs within a 2.8-kb promoter
context on reporter activity in BAEC and SMC. A 2.8-kb SM
-actin CAT wild-type (pProm CAT) construct along with a
construct containing two c-fos SREs (pProm CAT
SRE-SRE) were transiently transfected in subconfluent BAEC and
SMC, growing in 10% FBS. CAT activities were expressed relative to the
base-line CAT activity of a promoterless CAT construct. Data represent
means ± S.E. of three independent experiments. , SMC; ,
EC.
|
|
To test further the importance of the SM
-actin CArGs for
SMC-specific regulation of this gene, we tested the activity of SRE
containing SM
-actin constructs in L6 skeletal myotubes. Skeletal
myotubes express SM
-actin transiently during development (55), but
expression is differentially regulated as compared with SMC (20). For
example, high transcriptional activity in skeletal myotubes was shown
to be dependent on the upstream region from
125 bp to
271 bp,
whereas little or no activity was seen with the p125 CAT construct
(20). Moreover, we have shown that this gene is a target of the
skeletal muscle-specific HLHs whose effects are mediated by two E boxes
located at
214 bp and
254 bp (56). Transfection results
demonstrated that the pBL 155 CAT SRE-SRE construct had markedly higher
activity in skeletal myotubes as compared with the wild-type construct
(Fig. 7A). Indeed, activities
exceeded that of the pProm CAT construct indicating that the presence
of two strong CArG elements supplants the normal requirement for E
boxes for expression of SM
-actin in skeletal myotubes.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of SM -actin promoter
constructs with the wild-type CArGs replaced by c-fos SREs
in skeletal myotubes and AKR-2B mouse fibroblasts. Constructs
described previously (Figs. 1, 2, and 5) were transiently transfected
in skeletal myotubes (A, ) and AKR-2B fibroblasts
(B, ), growing in 10% FBS. CAT activities were expressed
relative to the base-line CAT activity of a promoterless CAT construct.
Data represent the means ± S.D. of triplicate samples. Similar
results were seen in two independent repeats.
|
|
Cell specificity of the SM
-actin CArGs was also tested in AKR-2B
fibroblasts that do not express their endogenous SM
-actin gene
under normal circumstances, although they express mouse SM
-actin
promoter/reporter constructs containing disruption or deletion of the
promoter region from
191 bp to
221 bp which acts as a repressor in
these cells (57). Results of our studies demonstrated significant
activity of the p155 CAT construct in AKR-2B cells that was increased
to extremely high levels by replacement of the CArGs with
c-fos SREs (i.e. p155 CAT SRE-SRE was ~600-fold over control) (Fig. 7B). However in marked contrast to
observations in SMC, inclusion of the upstream region from
155 bp to
2.8 kb completely abolished activity of the wild-type p155 CAT
construct in AKR-2B cells, and also greatly reduced the activity of the pProm CAT SRE-SRE construct. These data indicate that strong CArGs cannot counteract the potent repressor activity associated with the
region upstream of
155 bp in AKR-2B fibroblasts, whereas they can
override negative regulatory elements upstream from
155 bp in
SMC.
AII Increased SRF Binding to the SM
-Actin CArGs as Well as to
the c-fos SRE--
The preceding studies provide clear evidence that
the relatively weak SRF binding sites of the SM
-actin promoter are
important for cell type-specific expression of SM
-actin. Results of
recent studies from our laboratory demonstrated that AII inducibility of SM
-actin was dependent on both CArG boxes A and B and partially dependent on a MHox binding site (ATTA) situated 5' to CArG B (40).
Moreover, AII-induced stimulation of SM
-actin was associated with
markedly increased SRF binding to both CArG elements, and MHox was
shown to enhance SRF binding to CArG B and overexpression of MHox
transactivated SM
-actin expression. These results suggest that
enhancement of SRF binding to lesser affinity SRF binding sites may
represent an important mechanism to maximally up-regulate SM
-actin
expression. If so, then replacement of low SRF binding sites by high
SRF binding sites should result in higher constitutive activity and
reduced responsiveness to AII.
To test this hypothesis, we first addressed whether SRF binding
activity was increased in nuclear extracts from SMC treated with AII as
compared with SFM vehicle and whether similar differences in binding
activity of probes for CArG A, CArG B, and the c-fos SRE
were seen with SMC extracts as observed with recombinant SRF (Fig. 2).
This is important to rule out possible post-translational modifications
of SRF that might differentially affect binding to these probes.
Consistent with our previous findings, results showed that AII
treatment was associated with increased SRF binding activity, with
binding activity being greatest with the c-fos SRE,
intermediate with CArG B, and lowest with CArG A in a manner similar to
that seen with recombinant SRF (Fig. 8).
Interestingly, the fact that AII was capable of increasing SRF binding
to the c-fos SRE suggests that some degree of AII-mediated
stimulation of constructs containing c-fos SREs might be
expected.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 8.
Gel shift analysis of the effects of AII
treatment of SMC on SRF binding to CArG A and B and c-fos
SRE oligonucleotides. Radiolabeled 20-bp CArG A (lanes
1 and 2), CArG B (lanes 3 and 4),
and c-fos SREs (lanes 5 and 6)
double-stranded oligonucleotides were incubated with nuclear extracts
(3 µg) from rat SMC treated with AII (10 6
M) or SFM. Polyclonal SRF antibodies (Santa Cruz) were
added to the binding reaction in the absence of radiolabeled probe and
incubated for 20 min at room temperature.
|
|
AII Responsiveness of SM
-Actin Was Reduced When CArG A and B
Were Replaced by c-fos SREs and Was Abolished by the Presence of a Weak
SRF Binding Site at Position 2--
To address whether the reduced SRF
binding activities of the SM
-actin CArGs and their position were
important for AII responsiveness of SM
-actin, we performed
transfection studies using various constructs described earlier (see
Figs. 1-3). It should be noted that transfections were carried out
under serum-free conditions in confluent, growth-arrested SMC, since we
(44, 47) and others (58) have previously demonstrated that such
conditions are necessary for AII-induced hypertrophic responses.
However, transfection efficiencies and corresponding reporter
activities are lower under such conditions as compared with SMC growing
exponentially in serum. For this reason, and due to other undefined
changes due to serum withdrawal, results of these AII experiments
cannot be directly compared with results of our earlier experiments
(Figs. 1-7) which were carried out in growing, subconfluent cells in
serum-containing media. Results demonstrated that replacement of SM
-actin CArGs by either one or two c-fos SREs resulted in
an increase in basal as well as AII-stimulated activity of each of the
c-fos SRE-substituted pBL 155 CAT constructs (Fig.
9A). However, as depicted in
Fig. 9B, the extent of AII inducibility of these constructs
(pBL 155 CAT B-SRE, pBL 155 CAT SRE-SRE, and pBL 155 CAT SRE-A) was
reduced approximately by half as compared with the pBL 155 CAT
wild-type construct. AII inducibility was also found to be greatly
reduced (pBL 155 CAT A-SRE) or completely abolished (pBL 155 CAT A-B or A-A) when a weak CArG was placed at position 2. Taken together, these
results indicate that AII inducibility of SM
-actin is reduced when
the endogenous SM
-actin CArGs are replaced by high affinity
c-fos SREs. In addition, results suggest that AII
inducibility requires the presence of at least an intermediate SRF
binding site at position 2.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 9.
Effects of SM -actin
CArG-c-fos SRE substitutions and the effects of CArG
positions on AII-induced stimulation of reporter activity. SMC
cultures were grown to confluency and growth-arrested in SFM for 4-5
days. Cells were then transiently transfected with constructs described
earlier (Figs. 2 and 3) and stimulated with AII ( )
(10 6 M) or SFM ( ) for 72 h. CAT
activities of AII- or SFM-treated groups were expressed relative to the
base-line CAT activity of a promoterless CAT construct (A)
or expressed as percent of SFM controls (B). Data represent
means ± S.E. of three independent experiments.
|
|
MHox-mediated Transactivation of SM
-Actin Was Markedly Reduced
by Replacement of the SM
-Actin CArGs by c-fos SREs--
Previous
studies in our laboratory demonstrated that an MHox binding site at
145 bp of the SM
-actin promoter was required for maximal AII
responsiveness of SM
-actin and that overexpression of MHox
transactivated SM
-actin expression 3-4-fold (40). To gain insight
into the mechanisms contributing to reduced AII inducibility in the
presence of c-fos SREs, we tested whether MHox-mediated
transactivation of SM
-actin was altered when SM
-actin CArGs
were replaced by c-fos SREs. An MHox expression vector was
co-transfected along with a p155 CAT construct containing either the SM
-actin wild-type CArGs or c-fos SRE substitutions, whereas controls were co-transfected with the empty expression vector.
Results showed that MHox-mediated transactivation of the wild-type p155
CAT was ~400% and only ~40% in the presence of c-fos
SREs (Fig. 10). No transactivation was
observed with a construct carrying two weak CArGs (CArG A). Consistent
with these results, we have previously shown that MHox fails to enhance
SRF binding to CArG A (40) and Grueneberg et al. (53) showed
that Phox1, the human homologue of MHox, failed to impart serum
responsiveness to weak SRF binding sites. In summary, these results
suggest that the ability of MHox to transactivate transcription is
markedly influenced by the SRF binding activities of CArG elements.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 10.
Effects of high and low SRF binding sites on
MHox-mediated transactivation of SM -actin. Confluent,
growth-arrested SMC ( ) were co-transfected with SM -actin
promoter constructs (0.75 µg each) as described earlier (Figs. 2 and
3) subcloned into a pCAT Basic vector (Promega) and a MHox expression
vector (3.5 µg). Controls were co-transfected with the empty p Zeo SV
vector (Invitrogen). Cells were placed in 10% serum after transfection
and harvested 48 h later. Data represent the means ± S.D. of
triplicate samples. Similar results were seen in three independent
repeats.
|
|
 |
DISCUSSION |
The aim of the present study was to determine whether the reduced
SRF binding activities of CArG A (
62) and B (
112) within the SM
-actin promoter contribute to cell type-specific expression of SM
-actin and responsiveness to AII, a contractile agonist shown to
mediate hypertrophic growth responses in SMC. We demonstrated that
replacement of CArG A and CArG B by the strong SRF binding site
c-fos SRE resulted in increased basal activity. However, it
also resulted in relaxed cell-specific expression, reduced inducibility
by AII, and markedly reduced transactivation by MHox. Moreover, we
provided evidence that the position of the CArG elements was also
important for basal and AII-mediated stimulation of SM
-actin
expression. These results suggest that CArG elements with reduced SRF
binding activities contribute to cell type-specific expression of SM
-actin and are required for maximal AII responsiveness.
CArG elements are present in the promoters of many genes that are
independently regulated including immediate-early genes (Refs. 1-5,
reviewed in Ref. 6) and muscle-specific genes (Refs. 7-15, reviewed in
Ref. 16). Gene-specific differences are due at least in part to
sequence variations within the internal A/T-rich center of the CArGs as
well as by changes in flanking sequences that provide additional
binding sites for factors that interact with SRF and modulate its
function (reviewed in Refs. 6, 37, 38, 40, 53, 54, 59). For example,
Walsh and co-workers (41, 60) demonstrated that CArG elements are not
functionally interchangeable. Replacement of the most proximal CArG box
of the skeletal (SK)
-actin promoter (muscle regulatory element) by
a c-fos SRE led to constitutive expression of SK
-actin in non-muscle cells. Consistent with the observations by Walsh et
al. (41, 60), we also found that replacement of the SM
-actin
CArGs by c-fos SREs was associated with relaxed cell
type-specific expression of SM
-actin. However, our studies also
revealed a fundamental difference between cells that express their
endogenous SM
-actin gene (SMC and skeletal myotubes) and those that
do not (e.g. BAEC and AKR-2B fibroblasts) with respect to
the effects of c-fos SRE substitutions when examined in a
short (155 bp) versus a longer (2.8 kb) SM
-actin
promoter context. In SMC, strong CArGs completely overcame the effects
of negative acting elements located between
155 bp and
2.8 kb.
However, whereas the presence of strong CArGs within a
155-bp context
resulted in high transcriptional activity in BAEC and AKR-2B, strong
CArG elements were only modestly effective in overcoming the repressor
effects of negative regulatory elements upstream of
155 bp in the
longer promoter context. In L6 skeletal myotubes, expression of
wild-type SM
-actin promoter constructs was dependent on the
combinatorial interaction of the CArG boxes and E boxes (20). However,
substitution of the SM
-actin CArGs with c-fos SREs
resulted in high transcriptional activity of the p155 CAT construct
that lacks the E box elements that are normally required for expression
in this cell type. Taken together, these results indicate that cell
type-specific expression is not only dependent on the reduced SRF
binding activity of the degenerate SM
-actin CArGs but also on
powerful cell type-specific repressor elements that limit expression
even in the presence of c-fos CArG elements that bind SRF
with very high affinity.
Based on genomic footprint analysis showing that the c-fos
SRE is constitutively occupied, many models of
CArG-dependent regulation of c-fos have assumed
that SRF-CArG interaction was not rate-limiting/or regulated (61).
Rather, serum and growth factor responsiveness of the c-fos
gene was shown to be mediated at least in part by the interaction of
SRF with members of the ets domain containing transcription
factors including ELK-1 and SAP-1 (reviewed in Refs. 18, and 37) that
formed ternary complexes with SRF as well as non-ternary
complex-dependent pathways that signal via Rho family
GTPases (62). A growing body of recent evidence, however, suggests
that CArG-dependent regulation of the c-fos as
well as other cell type-specific genes is also regulated at the level of SRF-CArG interactions (33-36, 39, 40). This includes
post-translational modifications of SRF that modify its binding (17,
63), alterations in the level of SRF expression (34, 39), and
interaction of SRF with factors including YY1 (54, 64, 65) and
homeodomain factors (38, 40, 53). Studies by Grueneberg et
al. (53) have shown that Phox1, the human counterpart of MHox,
enhanced SRF binding to the c-fos SRE and that
overexpression of Phox1 transactivated a test construct consisting of a
single copy of the c-fos SRE coupled to a minimal
c-fos promoter. The present studies are consistent with
those of Grueneberg et al. (53) and for the first time
identify a gene and a cell context in which regulation of SRF binding
to highly conserved degenerate CArG motifs by a homeodomain factor are
critical for both SMC-specific and agonist inducibility. Our results in
this and previous studies (40) suggest that the presence of relatively
weak SRF binding CArG motifs within the SM
-actin promoter permits a
greater extent of regulation of this gene than would be possible with
strong CArGs that are likely to constitutively bind SRF even under
basal conditions. Several lines of evidence support this hypothesis. First, AII responsiveness was reduced by half in the presence of
c-fos SREs. Second, overexpression of MHox transactivated
the wild-type promoter by ~400%, whereas transactivation of a
construct containing two c-fos SREs was only ~40% (Fig.
10). Third, the presence of a homeodomain binding site at
145 was
required for maximal MHox-induced transactivation in that effects were
reduced by 50% with a p125 CAT construct missing the MHox binding
site, or by mutation of the homeodomain site within a p155 CAT context
(40). However, when the SM
-actin CArGs were substituted by
c-fos SREs within the 155- or 125-bp context, no differences
in transcriptional activities were observed2 indicating
that transcriptional activity of SM
-actin is less dependent on MHox
in the presence of strong SRF binding sites.
Results of the present studies also provide evidence that the
positional context of the SM
-actin CArGs was critical for transcriptional activity in that switching of CArG A and B resulted in
almost complete loss of both basal and AII-induced activity. Whereas
results of our previous studies (20) have clearly shown that both CArG
A (position 1) and CArG B (position 2) are required for transcriptional
activity in SMC, there appears to be a requirement for the stronger of
the two CArGs be located in the more distal position (Figs. 3 and 4).
This may be important because of proximity to the homeodomain binding
site or alternatively may relate to structural requirements for
formation of a higher order transcription initiation complex (66). Of
interest, however, our data show that the SRF binding activity of CArG
A appears to be too low to function effectively at position 2, although
it is essential for activity in its normal context (20). Consistent
with these observations, Grueneberg et al. (53) has shown
that Phox1, the human homologue of MHox, failed to impart serum
responsiveness to very poor SRF-binding sites, and we found that MHox
did not transactivate a construct containing two CArG A elements. In
addition, MHox did not increase SRF binding to CArG A in gel shift
assays using recombinant proteins (40). Together these results suggest that binding of SRF to CArG B, promoted by MHox, may be a crucial initial step in transcriptional activation. Subsequently, SRF-CArG B
interaction may induce DNA bending (67), allowing the weaker SRF-binding site CArG A to be occupied, thereby forming an
energetically favorable multiprotein-DNA complex. Consistent with this
model, Lee et al. (54) demonstrated that the two high
affinity proximal and distal skeletal
-actin SREs are first bound
cooperatively by SRF with concurrent DNA bending, which then
facilitates SRF interaction with the weak central site CArG. Taken
together, these data suggest that cooperative interaction of strong and
weak CArGs contribute to CArG-dependent regulation of
multiple muscle-specific genes including SM
-actin.
Although our studies focused on a single SMC differentiation marker, SM
-actin, the observation that SRF binding is modulated by homeodomain
proteins may represent a general regulatory paradigm that may
contribute to control of other CArG-dependent muscle genes.
Consistent with this, Chen and Schwartz (59), have demonstrated that
the homeodomain protein Nkx-2.5, in concert with SRF, was required for
expression of cardiac
-actin in nonmyogenic fibroblasts suggesting a
role for Nkx-2.5 in conferring cell type-specific expression of cardiac
-actin. In addition, it is interesting to speculate that the
interaction of homeodomain proteins and SRF may also contribute to the
coordinate expression of multiple CArG-dependent genes that
are characteristic of mature differentiated smooth muscle, including SM
MHC and SM-22
. However, there is also evidence that
CArG-dependent expression of these SMC genes is regulated
in a gene-specific manner. For example, both CArG boxes A and B were
required for high level expression of SM
-actin (20). In contrast, a
single proximal CArG element with relatively high SRF binding activity
(predicted based on the lack of Gua or Cyt substitution in the A/T-rich
CArG center) was sufficient for high level expression of SM MHC and
SM-22
in SMC (22, 24) suggesting that a single strong CArG might be
sufficient to drive significant transcription of these genes.
Consistent with this, our results demonstrated that SM
-actin
promoter constructs containing a single c-fos SRE were
sufficient to drive transcription of SM
-actin (Fig. 5), whereas a
single wild-type SM
-actin CArG failed to do so. Finally, it is
critical to emphasize that MHox-dependent regulation of SRF
binding to the SM
-actin CArGs alone is unlikely to be sufficient to
control cell type-specific expression of SM
-actin, since MHox
expression is clearly not restricted exclusively to SMC, although it
does show mesodermally restricted activity (68). Rather, cell
type-specific expression of SM
-actin appears to depend on the
combinatorial interaction of multiple cis-elements and
trans-factors in a manner analogous to many cardiac specific genes (reviewed in Ref. 16).
 |
ACKNOWLEDGEMENT |
We gratefully acknowledge the expert technical
assistance of Andrea Tanner.
 |
FOOTNOTES |
*
This work was supported by Grants RO1 HL 38854 and PO1 HL
19242 from the National Institutes of Health (to G. K. O.) and
Fellowship Grants VA-94-F-14 (to M. B. H.), VA-96-F20 (to
C. P. M.), and VA-95-F-18 (to C. S. M.) from the Virginia Affiliate
of the American Heart Association.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of Molecular
Physiology and Biological Physics, Box 449, University of Virginia Health Sciences Center, Charlottesville, VA 22908. Tel.: 804-924-2652; Fax: 804-982-0055; E-mail: gko{at}virginia.edu.
1
The abbreviations used are: CArG element,
CC(A/T-rich)6GG; SMC, smooth muscle cell(s); SM MHC, smooth
muscle myosin heavy chain; bp, base pair(s); kb, kilobase pair(s); SRF,
serum response factor; SRE, serum response element; CAT,
chloramphenicol acetyltransferase; TGF-
, transforming growth factor
1; AII, angiotensin II; BAEC, bovine endothelial cells; DOTAP,
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate; FBS, fetal bovine serum; EMSA, electrophoretic mobility
shift assays; SFM, serum-free medium; Wt, wild type.
2
M. Hautmann and G. Owens, unpublished
observations.
3
M. Thompson and G. K. Owens, unpublished
observations.
 |
REFERENCES |
-
Treisman, R.
(1990)
Semin. Cancer Biol.
1,
47-58[Medline]
[Order article via Infotrieve]
-
Chavrier, P.,
Janssen-Timmen, U.,
Mattei, M.-G.,
Zerial, M.,
Bravo, R.,
and Charnay, P.
(1989)
Mol. Cell. Biol.
9,
787-797[Abstract/Free Full Text]
-
Christy, B.,
and Nathans, D.
(1989)
Mol. Cell. Biol.
9,
4889-4895[Abstract/Free Full Text]
-
Latinkic, B.,
O'Brien, T.,
and Lau, L.
(1991)
Nucleic Acids Res.
19,
3261-3267[Abstract/Free Full Text]
-
Latinkic, B. V.,
and Lau, L. F.
(1994)
J. Biol. Chem.
269,
23163-23170[Abstract/Free Full Text]
-
Treisman, R.,
and Ammerer, G.
(1992)
Curr. Opin. Genet. & Dev.
2,
221-226[CrossRef][Medline]
[Order article via Infotrieve]
-
Chow, K. L.,
and Schwartz, R. J.
(1990)
Mol. Cell. Biol.
10,
528-538[Abstract/Free Full Text]
-
Gustafson, T. A.,
Miwa, T.,
Boxer, L. M.,
and Kedes, L.
(1988)
Mol. Cell. Biol.
8,
4110-4119[Abstract/Free Full Text]
-
Minty, A.,
and Kedes, L.
(1986)
Mol. Cell. Biol.
6,
2125-2136[Abstract/Free Full Text]
-
Mohun, T. J.,
Taylor, M. V.,
Garrett, N.,
and Gurdon, J. B.
(1989)
EMBO J.
8,
1153-1161[Medline]
[Order article via Infotrieve]
-
Navankasattusas, S.,
Zhu, H.,
Garcia, A. V.,
Evans, S. M.,
and Chien, K. R.
(1992)
Mol. Cell. Biol.
12,
1469-1479[Abstract/Free Full Text]
-
Papadopoulos, N.,
and Crow, M. T.
(1993)
Mol. Cell. Biol.
13,
6907-6918[Abstract/Free Full Text]
-
Kharbanda, S.,
Rubin, E.,
Datta, R.,
Hass, R.,
Sukhatme, V.,
and Kufe, D.
(1993)
Cell Growth Differ.
4,
17-23[Abstract]
-
Galvagni, F.,
Lestingi, M.,
Cartocci, E.,
and Oliviero, S.
(1997)
Mol. Cell. Biol.
17,
1731-1743[Abstract]
-
Catala, F.,
Wanner, R.,
Barton, P.,
Cohen, A.,
Wright, W.,
and Buckingham, M.
(1995)
Mol. Cell. Biol.
15,
4585-4596[Abstract]
-
Sartorelli, V.,
Kurabayashi, M.,
and Kedes, L.
(1993)
Circ. Res.
72,
925-931[Free Full Text]
-
Rivera, V. M.,
Miranti, C. K.,
Misra, R. P.,
Ginty, D. D.,
Chen, R.-H.,
Blessis, J.,
and Greenberg, M. E.
(1993)
Mol. Cell. Biol.
13,
6260-6273[Abstract/Free Full Text]
-
Shore, P.,
and Sharrocks, A. D.
(1995)
Eur. J. Biochem.
229,
1-13[Medline]
[Order article via Infotrieve]
-
Amacher, S. L.,
Buskin, J. N.,
and Hauschka, S. D.
(1993)
Mol. Cell. Biol.
13,
2753-2764[Abstract/Free Full Text]
-
Shimizu, R. T.,
Blank, R. S.,
Jervis, R.,
Lawrenz-Smith, S. C.,
and Owens, G. K.
(1995)
J. Biol. Chem.
270,
7631-7643[Abstract/Free Full Text]
-
Sartorelli, V.,
Webster, K. A.,
and Kedes, L.
(1990)
Genes Dev.
4,
1811-1822[Abstract/Free Full Text]
-
Kim, S.,
Ip, H. S.,
Lu, M. M.,
Clendenin, C.,
and Parmacek, M. S.
(1997)
Mol. Cell. Biol.
17,
2266-2278[Abstract]
-
Li, L.,
Miano, J. M.,
Mercer, B.,
and Olson, E. N.
(1996)
J. Cell Biol.
132,
849-859[Abstract/Free Full Text]
-
Madsen, C. S.,
Hershey, J. C.,
Hautmann, M. B.,
White, S. L.,
and Owens, G. K.
(1997)
J. Biol. Chem.
272,
6332-6340[Abstract/Free Full Text]
-
White, S. L.,
and Low, R. B.
(1996)
J. Biol. Chem.
271,
15008-15017[Abstract/Free Full Text]
-
Herring, B. P.,
and Smith, A. F.
(1996)
Am. J. Physiol.
270,
C1656-C1665[Abstract/Free Full Text]
-
Yano, H.,
Hayashi, K.,
Momiyama, T.,
Saga, H.,
Haruna, M.,
and Sobue, K.
(1995)
J. Biol. Chem.
270,
23661-23666[Abstract/Free Full Text]
-
Gustafson, T. A.,
and Kedes, L.
(1989)
Mol. Cell. Biol.
8,
3269-3283
-
Moessler, H.,
Mericskay, M.,
Li, Z.,
Nagl, S.,
Paulin, D.,
and Small, J. V.
(1996)
Development
122,
2415-2425[Abstract]
-
Tuil, D.,
Clergue, N.,
Montarras, D.,
Pinset, Ch,
Kahn, A.,
and Phan- Dinh- Tuy, F.
(1990)
J. Mol. Biol.
213,
677-686[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, C. Y.,
Croissant, J.,
Majesky, M.,
Topouzis, S.,
McQuinn, T.,
Frankovsky, M. J.,
and Schwartz, R. J.
(1996)
Dev. Genet.
19,
119-130[CrossRef][Medline]
[Order article via Infotrieve]
-
Leung, S.,
and Miyamoto, N. G.
(1989)
Nucleic Acids Res.
17,
1177-1195[Abstract/Free Full Text]
-
Lee, T.-C.,
Shi, Y.,
and Schwartz, R. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9814-9818[Abstract/Free Full Text]
-
Croissant, J. D.,
Kim, J.-H.,
Eichele, G.,
Goering, L.,
Lough, J.,
Prywes, R.,
and Schwartz, R. J.
(1996)
Dev. Biol.
177,
250-264[CrossRef]