|
J Biol Chem, Vol. 273, Issue 15, 8958-8964, April 10, 1998
Kinetic and Thermodynamic Studies of Purine Repressor Binding
to Corepressor and Operator DNA*
Han
Xu,
Markos
Moraitis,
Ross J.
Reedstrom , and
Kathleen S.
Matthews§
From the Department of Biochemistry & Cell Biology, Rice
University, Houston, Texas 77005
 |
ABSTRACT |
The kinetic and thermodynamic parameters for
purine repressor (PurR)-operator and PurR-guanine binding were
determined using fluorescence spectroscopy and nitrocellulose filter
binding. Operator binding affinity was increased by the presence of
guanine as demonstrated previously (Choi, K. Y., Lu, F., and
Zalkin, H. (1994) J. Biol. Chem. 269, 24066-24072;
Rolfes, R. J., and Zalkin, H. (1990) J. Bacteriol.
172, 5637-5642), and conversely guanine binding affinity was
increased by the presence of operator. Guanine enhanced operator affinity by increasing the association rate constant and decreasing the
dissociation rate constant for binding. Operator had minimal effect on
the association rate constant for guanine binding; however, this DNA
decreased the dissociation rate constant for corepressor by ~10-fold.
Despite significant sequence and structural similarity between PurR and
LacI proteins, PurR binds to its corepressor ligand with a lower
association rate constant than LacI binds to its inducer ligand.
However, the rate constant for PurR-guanine binding to operator is
~3-fold higher than for LacI binding to its cognate operator under
the same solution conditions. The distinct metabolic roles of the
enzymes under regulation by these two repressor proteins provide a
rationale for the observed functional differences.
 |
INTRODUCTION |
The biosynthesis of
IMP,1 a branch point in the
synthesis of AMP and GMP, involves ten enzymatic steps (1, 2). Purine repressor (PurR) binding to multiple pur operator sequences
regulates expression of the enzymes involved in IMP synthesis, the
conversion from IMP to GMP and AMP, and other related biochemical
pathways (1, 2). PurR recognizes a series of conserved and partially symmetric DNA sequences upon binding to a corepressor ligand, guanine
or hypoxanthine (1, 3-18). In the presence of PurR-purine holorepressor, RNA polymerase transcription of enzymes from the associated promoter region is inhibited, and biosynthesis of purine nucleotides correspondingly diminishes (1, 3-20).
PurR consists of 341 amino acids and is a member of the LacI family of
DNA binding proteins (21-24). PurR is a homodimer, and each monomer
consists of a helix-turn-helix DNA binding domain connected to a core
purine binding domain by a hinge region (19, 21, 25, 26). The x-ray
crystallographic structures of holorepressor-operator and free PurR
core binding domain (amino acids ~60-341) have been determined
(26-29). The DNA binding domain and a helix formed by the hinge
sequence make direct contact with the operator DNA to recognize
features of the specific cognate sequence (26). The N-terminal
helix-turn-helix domain binds in the major groove of the DNA, whereas
the hinge helix, which appears to be disordered in the free protein,
contacts the DNA sequence in the minor groove and introduces a bend of
45-50 ° in the DNA (26, 30). Each core domain contains N- and
C-subdomains, designations based on similarity to the family of
periplasmic sugar binding proteins (21, 26, 31). The corepressor
binding pocket is located in the cleft between the N- and C-subdomains.
Upon corepressor binding, the two N-subdomains appear to change their
relative positions to generate the proper conformation for DNA binding (26, 27). Amino acids responsible for monomer-monomer interactions are
dispersed across the two subdomains to form the subunit interface (26).
The key role of PurR in regulating a central biosynthetic pathway
motivates a thorough understanding of the biochemical properties and
the relationship of structure to function in this protein. Although
corepressor binding in the absence of operator (19) and operator
binding affinity in the presence and the absence of guanine (19, 20,
31) have been measured, detailed parameters for PurR interactions with
ligands have not been established. In this study, we have determined
PurR binding constants to both operator DNA and the corepressor guanine
under a consistent set of conditions, allowing a more complete analysis
of the thermodynamics and kinetics of regulation in this system.
 |
MATERIALS AND METHODS |
Buffers and Guanine Solutions
PurR was purified in Buffer A, which contained 10 mM
HEPES-KOH, 0.1 mM EDTA, 5% glycerol, 0.1 mM
dithiothreitol, pH 7.6. All reactions for the equilibrium and kinetic
analyses were conducted in Buffer E, based on modifications of the
previously described Buffer II (20, 31). Buffer E contained 100 mM HEPES-KOH (pH 7.5), 250 mM potassium
glutamate, 150 mM sodium chloride, 10 mM magnesium acetate, and 1 mM EDTA. The binding of PurR to
operator is responsive to purine presence in this buffer (20, 31). Guanine solutions were made by either (a) dissolution of
guanine to saturation in Buffer E by stirring overnight with mild
heating (~40 °C) or (b) dissolution of guanine to 40 mM in 1 M NaOH. These stock solutions were
diluted to the appropriate concentrations for specific experiments, and
the concentrations were confirmed by absorbance. The pH of final PurR
and guanine solutions was not altered by the latter preparation
process, and no differences in results between the methods of guanine
dissolution were noted.
Purification of PurR
Purine repressor was overexpressed and purified according to
previously published procedures (20) with the following modifications. Escherichia coli BL21 cells were lysed by sonication instead
of French press; phosphocellulose was used for further purification following DEAE chromatography instead of heparin agarose; and the
gradient for the phosphocellulose column was 30-400 mM KCl in Buffer A. PurR was eluted from phosphocellulose at 300-350 mM KCl. The binding activity of the protein was determined
by titration under stoichiometric conditions to be >90% for DNA and for guanine.
Intrinsic Fluorescence
The intrinsic fluorescence changes of PurR upon guanine binding
were recorded within either 1-cm2 or 0.2 × 1.0-cm
pathlength quartz cuvettes at room temperature in an SLM-8100
fluorescence spectrometer. The excitation wavelength for emission
spectra was 290 nm. In some experiments, a cut-off filter (Corning,
O-52) was used to record the total fluorescence change at wavelengths
longer than 340 nm. Two methods were employed to correct for the
fluorescence decrease caused by guanine absorption at the excitation
wavelength (inner filter effect). The first method used the absorbance
of each sample at 290 (Aex) and 350 nm
(Aem), using the equation F = Fobs antilog [(Aex + Aem)/2] for correction. The second method
employed the effect of guanine on the fluorescence of
N-acetyltryptophanamide. The fluorescence of the sample was
corrected by the ratio of
Fo/Fi for
N-acetyltryptophanamide, where Fo
corresponds to the initial fluorescence and Fi
corresponds to the fluorescence value at each guanine concentration.
These methods resulted in similar correction values. PurR concentration was fixed at 2 × 10 7 M monomer; guanine
(1 × 10 8 M to 3 × 10 5 M) was added for binding assays with
operator, whereas a higher concentration range (5 × 10 7 M to 5 × 10 5
M) was added for assays without operator. When present,
operator concentration was 2 × 10 7 M.
All samples were incubated at room temperature for 1-2 h before the
fluorescence measurements were taken. Corepressor binding affinity was
determined by globally fitting the data using a 2 guanine:1 PurR dimer
noncooperative binding model with the software package BIOEQS (32).
Binding affinity was linked across data sets, while all other
parameters were allowed to float.
Filter Binding
Operator Binding Assay--
Operator DNA binding in the absence
and the presence of corepressor, guanine (1 × 10 5
M), was measured by nitrocellulose filter binding. Operator
DNA (30 bp) was synthesized by the Great American Gene Company. The sequences of the two single-stranded DNAs were: 5'
GAATCCCTACGCAAACGTTTGCGTTTTCTG 3', 5'
GACAGAAAACGCAAACGTTTGCGTAGGGAT 3'. These oligonucleotides were
hybridized to form double-stranded operator fragments with 2-bp
5'-overhangs at either end. The operator fragments were then labeled by
polynucleotide kinase using [ -32P]ATP. The incubation
buffer for these measurements was Buffer E with 50 µg/ml bovine serum
albumin (BSA). Operator concentration was 2 × 10 12
M. PurR was added in concentrations from 1 × 10 10 M to 5 × 10 6
M dimer in the absence of guanine and from 1 × 10 12 M to 1 × 10 7
M dimer in the presence of guanine. PurR was incubated with
1 × 10 5 M guanine in Buffer E with BSA
for 20 min before operator DNA was added. Samples were incubated at
room temperature for 20 min before filtration through a 0.45-µm
nitrocellulose membrane (Schleicher & Schuell). Samples were filtered
through the membrane, and the retention of radioactivity on each filter
was determined by scintillation counting. Operator affinity was
determined by fitting the data to Equation 1.
|
(Eq. 1)
|
where Y is fractional saturation,
Ym is a factor that allows
Ymax (the saturation value) to float, [PurR]
is purine repressor concentration in dimer, and Kd
is the equilibrium dissociation constant, using IgorPro
(Wavemetrics).
Corepressor Binding Assay--
Guanine binding affinities in the
absence and the presence of operator DNA were measured by
nitrocellulose filter binding. [14C]Guanine concentration
was 3 × 10 8 M with or without operator
present. When present, operator concentration was 1 × 10 6 M for protein concentrations <1 × 10 6 M and was equimolar at protein
concentrations 1 × 10 6 M. Samples
were incubated at room temperature for 2-3 h before filtration through
a nitrocellulose membrane. The retention of radioactivity on the filter
was determined by scintillation counting. Guanine binding affinity was
determined by fitting the data to Equation 2.
|
(Eq. 2)
|
where Y is the fractional saturation,
Ym is a factor that allows
Ymax (the saturation value) to float,
Kd is the equilibrium dissociation constant,
[PurR] is PurR concentration in monomer, and n is the Hill
coefficient. Values for n were near unity in all cases.
Operator Binding Kinetics
The association and dissociation rates for operator binding in
the presence and the absence of guanine were measured by nitrocellulose filter binding. For association reactions, PurR at three different concentrations in Buffer E plus 50 µg/ml BSA was incubated with 8.3 × 10 11 M 32P-labeled
operator DNA. Samples were filtered through nitrocellulose membranes
following different incubation times. The amount of PurR-operator
complex was determined by scintillation counting of each individual
filter. The observed association rate (kobs) was
determined by fitting the data at each individual protein concentration
to Equation 3.
|
(Eq. 3)
|
where F is the amount of operator-PurR, A
is the amount of operator-PurR at equilibrium, A is the
total change in operator-PurR between zero time and equilibrium,
kobs is the observed rate constant, and
t is time. F was measured by scintillation
counting. The association rate constants were determined by fitting
kobs at different protein concentrations into
Equation 4.
|
(Eq. 4)
|
where kobs is the observed rate,
kassoc is the association rate constant,
kdissoc is the dissociation constant, and
[PurR] is the protein concentration in dimer. Dissociation rates were measured in a similar manner, except that 5 × 10 8
M PurR (dimer concentration) was incubated with 2.5 × 10 12 M 32P-labeled operator DNA
at room temperature for 10 min before 3 × 10 7
M cold operator DNA was added. When guanine was present,
PurR (5 × 10 9 M dimer) was incubated
with 1 × 10 5 M guanine at room
temperature for 20 min prior to operator addition. The amount of
complex present after different times following addition of cold
operator was measured by filtering samples through nitrocellulose
membranes. The dissociation rate constants were determined by fitting
data into Equation 5.
|
(Eq. 5)
|
where F is the amount of
32P-labeled operator-PurR, A is the amount of
32P-labeled operator-PurR at equilibrium, A
is the total change of 32P-labeled operator-PurR
between zero time and equilibrium, kdissoc is
the dissociation rate constant, and t is time.
Guanine Binding Kinetics by Stopped Flow
The association and dissociation rates of guanine binding to
PurR in the presence and the absence of operator DNA were measured using a stopped flow system in an SLM-8100 fluorescence spectrometer. For association rates, PurR (4 × 10 7 M)
was mixed with an equal volume of various concentrations of guanine in
Buffer E. When present, operator concentration was equimolar to PurR
dimer concentration. For dissociation rates, PurR (4 × 10 6 M monomer) and guanine (8 × 10 6 M) were incubated in Buffer E at room
temperature for 1 h before being diluted 3.5-fold with Buffer E. The dissociation rate in the presence of operator was measured by
manually diluting a solution containing PurR (4 × 10 6 M monomer), operator DNA (4 × 10 6 M), and guanine (4.5 × 10 6 M) into a 20-fold volume of Buffer E in a
1-cm2 quartz cuvette. Fluorescence signal changes during
the association or dissociation processes were monitored using an
excitation wavelength of 290 nm and following emission using a 340 nm
cut-off filter. The association rate constants and dissociation rate
constant in the absence of operator were determined by fitting data to Equation 6.
|
(Eq. 6)
|
where m is a constant slope term that accounts for
observed photobleaching. In the presence of operator, the dissociation rate data were fit to Equation 7.
|
(Eq. 7)
|
where A1 and
A2 correspond to the change in fluorescence
attributable to PurR and PurR-operator complex, respectively. Because
fits to this equation yielded a value for k1
that is within error of that measured for PurR-guanine dissociation in
the absence of operator, k1 was fixed to this
value for determining k2.
 |
RESULTS |
Guanine Binding Affinity--
Guanine binding affinity for PurR in
the presence and the absence of operator DNA was determined by
nitrocellulose filter binding. Guanine concentration was fixed well
below the equilibrium constant, and PurR concentration was varied.
There are two guanine binding sites in each dimer of PurR, and the end
point of this titration is a single guanine bound to each dimer.
Therefore, the affinity for the first binding site was the value
measured in this assay (Fig. 1). The
results in the presence and the absence of operator DNA are summarized
in Table I.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
Guanine binding affinity. The
measurements were carried out and multiple sets of data were fit
simultaneously according to the procedures described under "Materials
and Methods." Data shown are averages for the indicated numbers of
sets with standard deviation shown. , in the presence of operator;
, in the absence of operator. A, fluorescence titration.
The excitation wavelength was 290 nm, and fluorescence emission was
monitored at wavelengths above 340 nm. PurR concentration was fixed at
2 × 10 7 M monomer. All the reactions
were incubated at room temperature for ~1-2 h before the
measurements. The data for fluorescence titrations were scaled
appropriately by the individual data set parameters from the global
fit. The data shown are from eight data sets in the presence of
operator and seven in the absence of operator. B, filter
binding. [14C]Guanine concentration was fixed at 3 × 10 8 M. Operator concentration was
10 6 M at protein concentrations
<10 6 M and was equimolar at protein
concentrations 10 6 M. The data shown are
from ten data sets in the presence of operator and three in the absence
of operator DNA.
|
|
Alternatively, the affinities were measured by fluorescence titration
(Fig. 1), which monitors both binding sites for purine. PurR contains
four tryptophans in each monomer of PurR (22, 26). Trp147
is positioned near the opening to the corepressor binding pocket in
aporepressor (27). Based on the crystal structures, the environment of
Trp147 is less aromatic in the purine-PurR-operator complex
than the free core binding domain (26, 27). This environmental change for Trp147 presumably generates the observed increase of
the intrinsic fluorescence signal and the slight red shift of the
emission spectrum from 340 to 342 nm (19). Using this intrinsic
fluorescence signal, the effects of different concentrations of guanine
were recorded (Fig. 1). Due to the absorbance of guanine at the
excitation wavelength, correction of the observed fluorescence as
reported under "Materials and Methods" was essential. The results
from both filter binding and fluorescence measurements demonstrated
that the presence of operator DNA increased PurR affinity for guanine
by 7-17-fold (Table I).
Operator Binding Affinity--
A DNA sequence derived from the
purF operator was used in operator binding assays for
convenient comparison with previously published results (31). PurR
exhibits higher affinity for this optimized sequence over a 30-bp purF
operator but lower affinity compared with a 270-bp purF operator
sequence (19, 20, 31). Operator affinities in the presence and the
absence of guanine were determined by filter binding. As shown in Fig.
2, guanine increased operator affinity
significantly. According to the equilibrium dissociation constants
derived from these titrations, the presence of guanine increases PurR
affinity for operator by ~210-fold.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Operator binding affinity. The
measurements were carried out according to procedures described under
"Materials and Methods." Operator concentration was 2 × 10 12 M. Guanine concentration was 1 × 10 5 M when present. All the reactions were
incubated at room temperature for 20 min before filtration through
nitrocellulose membranes. Multiple sets of data (n = 3)
were fit as described under "Materials and Methods." , in the
presence of guanine; , in the absence of guanine.
|
|
Thermodynamic Analysis--
Two paths exist from aporepressor to
purine- and operator-bound holorepressor as shown in Fig.
3. As predicted by thermodynamic principles, the total free energy for route 1 ( G1 = GA + 2 GB) should equal that of the alternative
path, route 2 ( G2 = 2 GD + GC). These
equations assume equivalent affinity for both purine binding sites in a
dimer, as indicated by the binding studies. The equilibrium
dissociation constants and G values calculated for
different conditions are listed in Table I. Using values derived from
filter binding experiments, G1 and
G2 were 27.5 kcal and 27.2 kcal,
respectively, taking the stoichiometry for guanine into account. The
0.3-kcal difference between the total free energy changes for these two
paths may derive from experimental limitations, in particular
difficulty with filter binding at high protein concentrations. Values
of 26.5 and 27.2 kcal are calculated for
G1 and G2,
respectively, using Kd values determined by
fluorescence for the guanine binding free energy determination. The
difference between G1 values calculated from
filter binding and fluorescence measurements may be ascribed to the
high error for the fluorescence measurements.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
Thermodynamic loop for PurR-operator-guanine
association. PurR can follow two paths from aporepressor to
operator-bound holorepressor, route 1 and route 2. The free energy
change for these two pathways is equivalent.
|
|
Kinetic Measurements of Guanine Binding--
Kinetic constants for
guanine binding were determined by monitoring the fluorescence signal
change in PurR as described under "Materials and Methods." As shown
in Fig. 4, the association rate constants
in the presence and in the absence of operator were very similar,
~1 × 104 M 1
s 1. However, these values were 10-fold lower than the
corresponding rate constant for the homologous LacI protein to its
ligand IPTG (Table II). The purine-PurR
dissociation rate constant was decreased ~10-fold in the presence of
operator (Fig. 5 and Table II),
demonstrating that operator binding elicits increased guanine binding
affinity primarily by affecting the dissociation rate for the
corepressor.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
Measurement of association rate constant for
guanine binding. The association rates for guanine binding were
determined by stopped flow as described under "Materials and
Methods." PurR (2 × 10 7 M dimer) was
mixed with an equal volume of Buffer E containing various
concentrations of guanine. When present, operator concentration was
2 × 10 7 M. Fluorescence signal changes
during the association processes were monitored using an excitation
wavelength of 290 nm and following emission using a O-52 filter
(cut-off ~340 nm). The data were fit as described under "Materials
and Methods." Error range, representing standard deviation for
multiple measurements, was smaller than the symbols. Each point
represents the average of three to seven determinations. A,
in the presence of operator. B, in the absence of
operator.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Summary of ligand binding constants
PurR parameters are for binding to guanine, whereas LacI parameters are
for binding to IPTG. All the measurements were carried out in Buffer E. The values reported for association rate constants for PurR and
PurR-operator are the weighted averages of two separate sets of
replicate measurements, one set of which is shown in Fig. 4.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
Measurement of dissociation rate constant for
guanine binding. The dissociation rates for guanine binding in the
absence of operator were determined by stopped flow fluorescence
spectroscopy. The excitation wavelength was 290 nm, and a O-52 filter
( 340 nm) was used to monitor emission. The dissociation rate
constants were determined as described under "Materials and
Methods" from multiple data sets. A, in the presence of
operator. The data shown are the scaled average of six data sets. A
mixture of PurR (4 × 10 6 M monomer),
operator (4 × 10 6 M), and guanine
(4.5 × 10 6 M) was diluted 20-fold with
Buffer E manually in a 1-cm2 quartz cuvette. B,
in the absence of operator. The data are the scaled average of seven
data sets. PurR (4 × 10 6 M of monomer)
and guanine (8 × 10 6 M) were incubated
in Buffer E at room temperature for 1 h before being diluted
3.5-fold with Buffer E in a stopped flow apparatus.
|
|
Kinetic Measurements of Operator Binding--
The kinetics for
PurR-operator binding were determined by nitrocellulose filter binding.
As shown in Figs. 6 and
7, guanine increased the association rate
constant for operator by ~50-fold and decreased the dissociation rate
constant by ~20-fold, resulting in substantial stabilization of the
PurR-operator complex. The dissociation rate and equilibrium constants
for LacI binding to its operator were determined in the same buffer.
Interestingly, the association rate constant for PurR holorepressor
binding to its operator is greater than that for LacI binding to its
operator at the ionic strengths employed for this assay, as shown in
Table III.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6.
Measurement of association rate constant for
operator binding. The association rates for operator binding were
determined by nitrocellulose filter binding in Buffer E with 50 µg/ml
of BSA. PurR concentrations of ~1-5 nM (dimer) were used
in the presence of guanine. PurR concentrations of ~20-100
nM (dimer) were used in the absence of guanine. Operator
concentration was 8.3 × 10 11 M. Where
present, guanine concentration was 1 × 10 5
M, and PurR and guanine were incubated at room temperature
for 20 min before the addition of operator. The association rate
constants were determined as described under "Materials and
Methods," and error bars represent the standard deviation
for multiple experiments. A, in the presence of guanine.
B, in the absence of guanine.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7.
Determination of dissociation rate constants
for operator binding. The dissociation rates for operator binding
were determined by filter binding. All the reactions were carried out
in Buffer E with 50 µg/ml BSA. PurR (5 × 10 8
M dimer) was incubated with 2.5 × 10 12
M 32P-labeled operator DNA at room temperature
for 10 min before 3 × 10 7 M cold
operator DNA was added. PurR (5 × 10 9 M
dimer) was incubated with 1 × 10 5 M of
guanine, when present, at room temperature for 20 min prior to
initiation of dissociation. The amount of complex present after
different times following addition of cold operator was measured by
filtering samples through a nitrocellulose membrane. The data from
multiple determinations were fit as described under "Materials and
Methods." A, in the presence of guanine. B, in
the absence of guanine.
|
|
View this table:
[in this window]
[in a new window]
|
Table III
Summary of operator binding constants
All the measurements were carried out in Buffer E, and all protein
concentrations correspond to dimer. PurR binding is to the operator
sequence described under "Materials and Methods," whereas LacI
binding is to a 40-bp double-stranded DNA sequence from E. coli that encompasses the lac operator.
|
|
 |
DISCUSSION |
Thermodynamic Studies--
All the equilibrium dissociation
constants for guanine and operator binding to the purine repressor,
constituting a complete thermodynamic loop, were determined in this
study. The results demonstrated that guanine increased the operator
binding affinity for PurR by ~210-fold, a value greater than found
previously (~14-fold) (31). Furthermore, these measurements
demonstrated for the first time that the presence of operator increases
PurR affinity for guanine. PurR, as a master regulator for expression
of genes whose products are involved in purine and pyrimidine
nucleotide biosynthesis, must be able to respond appropriately to
in vivo environmental changes, specifically alterations in
the level of purine available. In the absence of purine, the expression
of biosynthetic enzymes is unimpeded, and free purine levels rise from
nucleotide/nucleoside degradation as production exceeds demands. As
purine levels approach the Kd for binding to PurR,
the holorepressor binds to the operator and diminishes expression for
the genes associated with that operator site. If PurR binds to the
operator in the absence of purine, its affinity for available purine is
increased, and the sensitivity of the system to repression is
enhanced.
Exogenous sources and endogenous degradation of high levels of
nucleosides and nucleotides provide sufficient free purine to bind PurR
and promote pur operator binding. PurR holorepressor exerts
tighter control over the pathway from phosphoribosylpyrophosphate to
IMP than the conversion from IMP to AMP or GMP (1, 4, 6, 9). When
de novo IMP synthesis is decreased in response to
PurR-purine binding to pur operator sites, salvage pathways are used for production of IMP, AMP, and GMP, using the available free
bases (33). In this way, E. coli cells avoid the complicated and energy-expensive de novo pathway from
phosphoribosylpyrophosphate to AMP and GMP when free purine is
available. As free purine concentrations decrease, pur
operators are released from PurR repression until the levels of free
purine rise again. These mechanisms not only ensure that purine
mononucleotides are available but also that the pool of free purine is
depleted rapidly, thereby avoiding the accumulation of potentially
toxic levels (33).
Kinetic Studies--
We have measured the association and
dissociation rates for PurR binding both to operator DNA sequences and
to a corepressor, guanine. The equilibrium binding constants determined
from the kinetic values are consistent with the direct measurements of affinity (Tables II and III). Guanine increases the affinity of PurR
for its operator by (a) increasing the association rate and (b) decreasing the dissociation rate. When the cellular
purine concentrations are low, PurR aporepressor interacts with its
operator sites with a slower association rate constant and a faster
dissociation rate constant, minimizing occupancy of operator sites and
avoiding inhibition of necessary downstream gene expression. When
cellular purine levels increase, PurR-purine complex binds to its
cognate operator sites with an increased association rate constant and dissociates more slowly from the operator, thereby blocking downstream gene expression.
In the presence of operator, PurR binds to its corepressor ligand with
lower rate constants for both association and dissociation compared
with the homologous LacI protein (Figs. 4 and 5). In the presence of
guanine, PurR binds to its operator with a faster association rate
constant than LacI and a diminished dissociation rate constant. In the
absence of guanine, PurR binds to its operator with a lower association
rate constant, and a similar dissociation rate constant as observed for
LacI. These differences can be rationalized by the different
physiological roles for these proteins. Although both proteins are
members of the LacI family of proteins, the role of PurR in the
metabolism of the cell is distinct from that of LacI. Specifically, the
lactose operon encodes proteins involved in the catabolism of sugars.
LacI controls the expression of mRNA encoding -galactosidase,
lactose permease, and thiogalactoside transacetylase, enzymes involved
in the transport and breakdown of lactose and other -galactosides to
generate an energy source. LacI affinity for operator is diminished
upon binding to inducer ligands (e.g. IPTG or allolactose).
The release of operator allows transcription of the downstream genes
and production of the enzymes for lactose transport and digestion. LacI
must both bind to its ligand rapidly (~1 × 104
M 1 s 1 for LacI-operator binding
to IPTG and ~1 × 105 M 1
s 1 for LacI binding to IPTG) and release operator quickly
(>0.1 s 1 for LacI-IPTG dissociation from lac
operator) to free the promoter for transcription. This process
generates the requisite enzymes in a short time frame to ensure rapid
utilization of environmentally available lactose as a carbon
source.
In contrast, PurR controls the expression of multiple enzymes involved
in the biosynthesis of nucleotides and other related anabolic pathways.
PurR represses the expression of these genes upon binding to its
corepressor ligand (guanine or hypoxanthine). In the absence of purine,
the operator is primarily in the free state, and biosynthesis of
mRNA and encoded biosynthetic enzymes can proceed. As purine levels
accumulate, either from nucleoside/nucleotide breakdown or from
environmental sources, binding to PurR occurs but with a lower
association rate constant than observed for the LacI protein. The
PurR-guanine complex then binds with increased affinity to the operator
sequence. With respect to the dissociation process, rate constants for
release of DNA are lower than for the corresponding states of LacI, and
the rate constant for release of guanine in the presence of operator
DNA is also significantly diminished.
The kinetic differences observed for PurR compared with LacI parallel
the distinct metabolic roles of the enzymes controlled by these
regulatory proteins. LacI must respond rapidly to the presence of
lactose in the environment, and the enzymes must be generated quickly
to ensure capture of this energy source. In contrast, PurR effectively
"integrates" the concentration of available purine over a period of
time before generating a transcriptional response to alterations in
purine levels. Minor changes in the pool of free purine do not elicit
an immediate alteration in the production of biosynthetic enzymes;
rather, an enduring rise in the levels of free purine results in the
shut-down of mRNA for the enzymes in this pathway. Once the
PurR-corepressor-operator complex forms, the release of corepressor
from PurR-operator and PurR-corepressor from its operator are both
slowed by ~10-fold and are slower than the corresponding reactions
for LacI. The lower dissociation rate constant for PurR
holorepressor-operator results in concomitantly slow generation of
enzymes for de novo synthesis when purines are available for
salvage.
These kinetic differences in proteins with high sequence, structure,
and functional similarity (21-24, 26, 34, 35) mirror the distinctions
in the metabolic roles of the enzymes under their regulation. Such
differences presumably arise from subtle alterations in structure that
control rates for the respective binding reactions. Previous work has
shown that a single amino acid change (K84L) in LacI can significantly
decrease the inducer binding rate constants for this protein by
>100-fold and consequently alter the rate of release for operator DNA
substantially (36). Thus, small changes in sequence can be presumed to
have dramatic effects on the functional properties of even closely
related proteins. Despite high levels of sequence similarity and
structural alignment (21-27, 34, 35), the sequence differences
observed between PurR and LacI result in significant divergence in
equilibrium and kinetic properties. Further comparison of structure and
function relationships in these closely related proteins may provide
insight into the mechanisms used broadly to modulate protein binding
parameters for ligands.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Howard Zalkin and Fu Lu for
providing plasmid pPR1010 for the overexpression of PurR as well as for
advice on purification of PurR.
 |
FOOTNOTES |
*
This work was supported by Grant GM22441 from the National
Institutes of Health and Grant C-576 from the Robert A. Welch
Foundation and employed facilities of the Keck Center for Computational
Biology and the Lucille P. Markey Charitable Trust.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by National Science Foundation Post-doctoral Fellowship
RTG BIR-94-13229 from the Keck Center for Computational Biology.
§
To whom correspondence should be addressed. Tel.: 713-527-4871;
Fax: 713-285-5154; E-mail: ksm{at}bioc.rice.edu.
1
The abbreviations used are: IMP, inosine
monophosphate; IPTG, isopropyl- ,D-thiogalactoside; PurR,
purine repressor; bp, base pair(s); BSA, bovine serum albumin.
 |
REFERENCES |
-
He, B.,
Shiau, A.,
Choi, K. Y.,
Zalkin, H.,
and Smith, J. M.
(1990)
J. Bacteriol.
172,
4555-4562[Abstract/Free Full Text]
-
Zalkin, H.,
and Dixon, J. E.
(1992)
Prog. Nucleic Acid Res. Mol. Biol.
42,
259-287[Medline]
[Order article via Infotrieve]
-
He, B.,
and Zalkin, H.
(1992)
J. Bacteriol.
174,
7121-7127[Abstract/Free Full Text]
-
He, B.,
and Zalkin, H.
(1994)
J. Bacteriol.
176,
1009-1013[Abstract/Free Full Text]
-
He, B.,
Choi, K. Y.,
and Zalkin, H.
(1993)
J. Bacteriol.
175,
3598-3606[Abstract/Free Full Text]
-
He, B.,
Smith, J. M.,
and Zalkin, H.
(1992)
J. Bacteriol.
174,
130-136[Abstract/Free Full Text]
-
Choi, K. Y.,
and Zalkin, H.
(1990)
J. Bacteriol.
172,
3201-3207[Abstract/Free Full Text]
-
Aiba, A.,
and Mizobuchi, K.
(1989)
J. Biol. Chem.
264,
21239-21246[Abstract/Free Full Text]
-
Meng, L. M.,
Kilstrup, M.,
and Nygaard, P.
(1990)
Eur. J. Biochem.
187,
373-379[Medline]
[Order article via Infotrieve]
-
Tiedeman, A. A.,
DeMarini, D. J.,
Parker, J.,
and Smith, J. M.
(1990)
J. Bacteriol.
172,
6035-6041[Abstract/Free Full Text]
-
Wilson, R. L.,
Stauffer, L. T.,
and Stauffer, G. V.
(1993)
J. Bacteriol.
175,
5129-5134[Abstract/Free Full Text]
-
Rolfes, R. J.,
and Zalkin, H.
(1988)
J. Biol. Chem.
263,
19649-19652[Abstract/Free Full Text]
-
Watanabe, W.,
Sampei, G.-I.,
Aiba, A.,
and Mizobuchi, K.
(1989)
J. Bacteriol.
171,
198-204[Abstract/Free Full Text]
-
Kilstrup, M.,
Meng, L. M.,
Neuhard, J.,
and Nygaard, P.
(1989)
J. Bacteriol.
171,
2124-2127[Abstract/Free Full Text]
-
Meng, L. M.,
and Nygaard, P.
(1990)
Mol. Microbiol.
4,
2187-2192[CrossRef][Medline]
[Order article via Infotrieve]
-
Steiert, J. G.,
Rolfes, R. J.,
Zalkin, H.,
and Stauffer, G. V.
(1990)
J. Bacteriol.
172,
3799-3803[Abstract/Free Full Text]
-
Wilson, H. R.,
and Turnbough, C. L., Jr.
(1990)
J. Bacteriol.
172,
3208-3213[Abstract/Free Full Text]
-
Makaroff, C. A.,
and Zalkin, H.
(1985)
J. Biol. Chem.
260,
10378-10387[Abstract/Free Full Text]
-
Choi, K. Y.,
and Zalkin, H.
(1992)
J. Bacteriol.
174,
6207-6214[Abstract/Free Full Text]
-
Rolfes, R. J.,
and Zalkin, H.
(1990)
J. Bacteriol.
172,
5637-5642[Abstract/Free Full Text]
-
Schumacher, M. A.,
Macdonald, J. R.,
Björkman, J.,
Mowbray, S. L.,
and Brennan, R. G.
(1993)
J. Biol. Chem.
268,
12282-12288[Abstract/Free Full Text]
-
Rolfes, R. J.,
and Zalkin, H.
(1988)
J. Biol. Chem.
263,
19653-19661[Abstract/Free Full Text]
-
Weikert, M. J.,
and Adhya, S.
(1992)
J. Biol. Chem.
267,
15869-15874[Abstract/Free Full Text]
-
Nguyen, C. C.,
and Saier, M.
(1995)
FEBS Lett.
377,
98-102[CrossRef][Medline]
[Order article via Infotrieve]
-
Choi, K. Y.,
and Zalkin, H.
(1994)
J. Bacteriol.
176,
1767-1772[Abstract/Free Full Text]
-
Schumacher, M. A.,
Choi, K. Y.,
Zalkin, H.,
and Brennan, R. G.
(1994)
Science
266,
763-770[Abstract/Free Full Text]
-
Schumacher, M. A.,
Choi, K. Y.,
Lu, F.,
Zalkin, H.,
and Brennan, R. G.
(1995)
Cell
83,
147-155[CrossRef][Medline]
[Order article via Infotrieve]
-
Schumacher, M. A.,
Choi, K. Y.,
Zalkin, H.,
and Brennan, R. G.
(1994)
J. Mol. Biol.
242,
302-305[CrossRef][Medline]
[Order article via Infotrieve]
-
Schumacher, M. A.,
Choi, K. Y.,
Zalkin, H.,
and Brennan, R. G.
(1992)
J. Mol. Biol.
225,
1131-1133[CrossRef][Medline]
[Order article via Infotrieve]
-
Nagadoi, A.,
Morikawa, S.,
Nakamura, H.,
Enari, M.,
Kobayashi, K.,
Yamamoto, H.,
Sampei, G.,
Mizobuchi, K.,
Schumacher, M. A.,
Brennan, R. G.,
and Nishimura, Y.
(1995)
Structure
3,
1217-1224[Medline]
[Order article via Infotrieve]
-
Choi, K. Y.,
Lu, F.,
and Zalkin, H.
(1994)
J. Biol. Chem.
269,
24066-24072[Abstract/Free Full Text]
-
Royer, C. A.
(1993)
Anal. Biochem.
210,
91-97[CrossRef][Medline]
[Order article via Infotrieve]
-
Neuhard, J.,
and Nygaard, P.
(1987)
in
Escherichia coli and Salmonella typhimirium: Cellular and Molecular Biology (Neidhardt, F. C., ed), Vol. 1, pp. 445-473, American Society for Microbiology, Washington, D. C.
-
Friedman, A. M.,
Fischmann, T. O.,
and Steitz, T. A.
(1995)
Science
268,
1721-1727[Abstract/Free Full Text]
-
Lewis, M.,
Chang, G.,
Horton, N. C.,
Kercher, M. A.,
Pace, H. C.,
Schumacher, M. A.,
Brennan, R. G.,
and Lu, P.
(1996)
Science
271,
1247-1254[Abstract]
-
Chang, W. I.,
Olson, J. S.,
and Matthews, K. S.
(1993)
J. Biol. Chem.
268,
17613-17622[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|