JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muda, M.
Right arrow Articles by Arkinstall, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muda, M.
Right arrow Articles by Arkinstall, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 15, 9323-9329, April 10, 1998

The Mitogen-activated Protein Kinase Phosphatase-3 N-terminal Noncatalytic Region Is Responsible for Tight Substrate Binding and Enzymatic Specificity*

Marco MudaDagger §, Aspasia Theodosiou, Corine GillieronDagger , Anna Smith, Christian ChabertDagger , Montserrat CampsDagger , Ursula BoschertDagger , Nanda Rodriguespar , Kay Daviespar , Alan Ashworth, and Steve ArkinstallDagger **

From the Dagger  Serono Pharmaceutical Research Institute (formerly the Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A.), CH-1228 Plan-les-Ouates, Geneva, Switzerland,  Cancer Research Campaign Centre for Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, Fulham Road, London, SW3 6JB, United Kingdom, and par  Genetics Laboratory, Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, United Kingdom

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References

We have reported recently that the dual specificity mitogen-activated protein kinase phosphatase-3 (MKP-3) elicits highly selective inactivation of the extracellular signal-regulated kinase (ERK) class of mitogen-activated protein (MAP) kinases (Muda, M., Theodosiou, A., Rodrigues, N., Boschert, U., Camps, M., Gillieron, C., Davies, K., Ashworth, A., and Arkinstall, S. (1996) J. Biol. Chem. 271, 27205-27208). We now show that MKP-3 enzymatic specificity is paralleled by tight binding to both ERK1 and ERK2 while, in contrast, little or no interaction with either c-Jun N-terminal kinase/stress activated protein kinase (JNK/SAPK) or p38 MAP kinases was detected. Further study revealed that the N-terminal noncatalytic domain of MKP-3 (MKP-3Delta C) binds both ERK1 and ERK2, while the C-terminal MKP-3 catalytic core (MKP-3Delta N) fails to precipitate either of these MAP kinases. A chimera consisting of the N-terminal half of MKP-3 with the C-terminal catalytic core of M3-6 also bound tightly to ERK1 but not to JNK3/SAPKbeta . Consistent with a role for N-terminal binding in determining MKP-3 specificity, at least 10-fold higher concentrations of purified MKP-3Delta N than full-length MKP-3 is required to inhibit ERK2 activity. In contrast, both MKP-3Delta N and full-length MKP-3 inactivate JNK/SAPK and p38 MAP kinases at similarly high concentrations. Also, a chimera of the M3-6 N terminus with the MKP-3 catalytic core which fails to bind ERK elicits non selective inactivation of ERK1 and JNK3/SAPKbeta . Together, these observations suggest that the physiological specificity of MKP-3 for inactivation of ERK family MAP kinases reflects tight substrate binding by its N-terminal domain.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

The extracellular signal-regulated kinase (ERK),1 c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) and p38/RK/CSBP (p38) represent three major classes of mitogen-activated protein (MAP) kinase (1-4). Different cell stimuli appear to activate distinct MAP kinases preferentially. Hence, while growth factors and some oncogenes are linked to activation of ERK, inflammatory cytokines and cell stresses lead to activation of JNK/SAPK and p38 (1-4). MAP kinases are known to phosphorylate several key regulatory proteins including additional kinases, cytoskeletal proteins, nuclear receptors, as well as several transcription factors, indicating a central role in controlling cell function (1, 5-10). Indeed, ERK has been shown to be important in processes leading to neuronal differentiation, mitogenesis, and oncogenic transformation (1, 11-15), while JNK/SAPK and p38 MAP kinases play critical roles in pathways leading to the generation of inflammatory cytokines and apoptotic death (1, 16-20).

MAP kinase activation requires phosphorylation on Thr and Tyr residues located within the motif TXY of kinase domain VIII (1, 2, 4, 7). While several upstream kinases catalyze this modification on specific MAP kinases, an emerging family of dual-specificity phosphatase dephosphorylate both threonine and tyrosine residues and appear likely to inactivate MAP kinases effectively under physiological conditions (21). Ten distinct mammalian dual specificity phosphatase genes have been characterized including VHR (22), CL100 (orthologue of 3CH134 and renamed as MKP-1) (23-26), PAC1 (27, 28), MKP-2 (also cloned as hVH-2 and TYP-1) (29-31), hVH-3 (same as B23) (32, 33), M3-6 (orthologue of hVH-5) (34, 35), MKP-3 (identical to rVH-6 and orthologue of PYST1) (36-38), MKP-X (orthologue of PYST2) (36, 38), MKP-4 (39), and MKP-5.2 Of these family members MKP-3/PYST1 and M3-6 appear exceptional insofar that they display highly specific inactivation of ERK or SAPK/JNK MAP kinases, respectively (38, 40).

One important unanswered question is of the structural domains within MKP-3 and M3-6 which underlie their selectivity for inactivation of different MAP kinases. Dual specificity phosphatase family members are characterized by an extended PTP active site signature sequence localized to the C-terminal half of the molecule (41, 42), as well as one or two short N-terminal CH2 domains displaying limited similarity to noncatalytic regions of the Cdc25 phosphatase (43, 44). Despite low homology within CH2 domains, the N-terminal halves of dual specificity phosphatases are otherwise highly divergent (21, 36, 39) and the functional role of this region has not been identified. We report here experiments demonstrating that the N-terminal half of MKP-3 is responsible for tight binding to its substrates ERK1 and ERK2 but not JNK/SAPKs or p38. This interaction appears to be responsible for MKP-3 enzymatic selectivity for inactivation of ERK MAP kinases.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

MKP-3 GST Fusion Proteins and Expression in Escherichia coli-- To produce the full-length GST-MKP3 fusion protein, the oligonucleotides GCCGGATCCATGATAGATACGCTCAGACC and GCCCTCGAGTCACGTAGATT GCAGTTGCAGGGAGTC were used to PCR amplify the complete MKP3 coding sequence from pMST-SM (36) and to introduce BamHI and XhoI sites (underlined) immediately flanking the start and stop codon. Upon restriction digestion with BamHI and XhoI the amplified cDNA was ligated to the corresponding sites in the pGEX4T3. To generate an enzymatically inactive GST-MKP3 fusion protein, the essential catalytic Cys293 was changed to Ser by site-directed mutagenesis performed using the Transformer site-directed mutagenesis kit (CLONTECH). To produce a GST fusion protein consisting of the MKP-3 C-terminal catalytic core (GST-MKP-3Delta N; amino acids 153-381) the first 151 amino acid were deleted by cutting full length pGEX4T3/MKP-3 (see above) with XbaI and BamHI followed by religation. To generate the MKP-3 N terminus as a GST fusion protein (GST-MKP-3Delta C; amino acids 1-221), the plasmid pGEX4T3/MKP-3 was digested with StyI and XhoI and ligated to a double-stranded oligonucleotide obtained by annealing the two oligonucleotides CAAGGAACTAAGAAGGGGTTCGCT and TCGAGCGAACCCCTTCTTAGTC. Fig. 1A illustrates schematically the MKP-3 amino acid sequences encoded within these fusion proteins. All MKP-3 and other GST-fusion proteins were expressed in E. coli by induction with 100 µM isopropyl-1-thio-beta -D-galactopyranoside and growth overnight at 20 °C. Fusion proteins were purified with glutathione-Sepharose using standard techniques. ERK2 and MEK-1 EE were further purified following cleavage of the GST-fusion as described (39, 45). MKP-3 phosphatase activity was measured in vitro using p-nitrophenyl phosphate as described elsewhere (39).

Mammalian Expression Plasmids for MKP-3, MKP-3 Delta C, M3-6, and two MKP-3/M3-6 chimeras (CA8, CB16)-- Constructs encoding Myc-epitope tagged MKP-3 and M3-6 subcloned into the eukaryotic expression vector pMT-SM were as described previously (34, 36, 40). To make chimeras of MKP-3 and M3-6 a truncated version of M3-6 (M3-6Delta C) consisting of amino acids 1-321 (-97 to +964 base pairs) (34) was first isolated by digesting M3-6 (in pcDNA II) with Asp718 and Bsp120I. The Myc-epitope EQKLISEEDL was constructed using the oligonucleotides GGCCCGAGCAGAAACTTATCTCCGAGGAAGATCTCTG and AATTCAGAGATCTTCCTCGGAGATAAGTTTGTCCTCG and was used together with pMT-SM vector (Asp718-EcoRI-digested) and the M3-6 fragment in a triple ligation. To make MKP-3/M3-6 chimeras the following oligonucleotides were then synthesized: M3-6(A), CCTGGGATCCCAGAAAGATGTC; M3-6(B), CTGGGATCCCAGGTAGAGGTGAG; MKP-3(A), CCTGGGATCCGCCAAGGACTCTAC; and MKP-3(B), GGCGGATCCCAGGTAAAGGAAGG together with a T3 primer and the vector primers pMT(A) TTGTTGTCAAGCTTGAGGTG and pMT(B) TCACGCTAGGATTGCCGTCA. These oligonucleotides were used for polymerase chain reaction amplification as follows. For a chimera consisting of the N-terminal half of M3-6 and C-terminal half of MKP-3 (CA8), pMT(A) with M3-6(B) using the M3-6Delta C/Myc fragment in pMT-SM as template and pMT(B) and MKP-3(A) using MKP-3/Myc in pMT-SM as template. The polymerase chain reaction products were digested using Asp718-BamHI and BamHI-EcoRI, respectively, and subcloned into Asp718-EcoRI linearized pMT-SM in a three-way ligation. For a chimera of the MKP-3 N-terminal and M3-6 C-terminal catalytic core (CB16) polymerase chain reaction was performed with T3 and MKP-3(B) using MKP-3 in pBluescript SK- (36) as template, and M3-6(A) with pMT(B) using the M3-6Delta C/Myc fragment in pMT-SM as template. These polymerase chain reaction products were then digested using XhoI-BamHI or BamHI-EcoRI, respectively, and subcloned into SalI-EcoRI linearized pMT-SM by triple ligation. An epitope tagged version of the N-terminal portion MKP3, termed MKP-3Delta C, was made using an oligonucleotide encoding the Myc epitope sequence corresponding to the sequence EQKLISEEDLN ligated to the BamHI site of the construct CB16. Fig. 6A illustrates schematically the amino acid sequences encoded by pMT-SM/MKP-3, pMT-SM/M3-6, pMT-SM/CA8, pMT-SM/CB16, and pMT-SM/MKP-3Delta C.

Cell Culture, Transfection, Binding, and Precipitation-- COS-7 cells were grown and transfected with 1 µg of each plasmid as described previously (36, 39, 40). GST-MKP-3 fusion proteins were used to precipitate transfected p44-HA-ERK1, p42-Myc-ERK2, p54-HA-JNK3/SAPKbeta , or HA-p38 using the lysis conditions described by Keyse's laboratory (38). Where indicated, binding to 150 ng of purified ERK2 protein was performed under identical conditions. Co-immunoprecipitation of MAP kinases with Myc-tagged phosphatases was performed using COS-7 cells co-expressing p44-HA-ERK1 or p54-HA-JNK3/SAPKbeta with Myc-MKP-3, Myc-MKP-3 C293S, Myc-MKP-3Delta C, Myc-M3-6, Myc-CA8, or Myc-CB16 using anti-Myc epitope monoclonal antibody 9E10 prebound to protein G-Sepharose beads and identical buffers. Immune complex and in vitro MAP kinase assays as well as Western blotting were all performed exactly as described previously (36, 39, 40).

    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Full-length PYST1 has been shown previously to form stable complexes with p42-ERK2 (38), although binding to p44-ERK1, JNK/SAPK, or p38 MAP kinases was not investigated. To test this, we transfected COS-7 cells with p44-HA-ERK1, p42-Myc-ERK2, p54-HA-JNK3/SAPKbeta , or HA-p38 and compared the ability of a range of GST-MKP-3 fusion proteins immobilized on glutathione beads to precipitate these MAP kinases from cell extracts. To perform these experiments the following fusion proteins were purified following expression in E. coli: full-length GST-MKP-3, the inactive mutant GST-MKP-3 C293S, the MKP-3 N-terminal GST-MKP-3Delta C (amino acids 1-221), and the MKP-3 C-terminal GST-MKP-3Delta N (amino acids 153-381) (Fig. 1). When incubated with lysates from transfected COS-7 cells, GST-MKP-3 is able to precipitate both p44-HA-ERK1 and p42-Myc-ERK2 (Fig. 2). In contrast, no precipitation of p54-HA-JNK3/SAPKbeta or HA-p38 MAP kinases by GST-MKP-3 was detected under identical conditions (Fig. 2). In a similar manner, the inactive mutant GST-MKP-3 C293S binds tightly and precipitates both p44-HA-ERK1 and p42-Myc-ERK2 while binding only weakly to HA-p38 MAP kinase. No precipitation of p54-HA-JNK3/SAPKbeta was observed under identical conditions (Fig. 2).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   GST-MKP-3 fusion proteins. A, schematic representation of GST-MKP-3 fusion proteins expressed in E. coli. Indicated are the first and last amino acids encompassed within each fusion protein numbered according to the 381 residues within the full-length MKP-3 protein (36). Cys293 is essential for MKP-3 catalytic activity, and its substitution by Ser (C293S) generates an inactive enzyme. Two conserved CH2 domains are included within the N-terminal MKP-3Delta C construct while the catalytic core resides within the C-terminal MKP-3Delta N. B, Coomassie Blue-stained GST-MKP-3 fusion proteins as described in A following their purification with glutathione-Sepharose beads and separation with SDS-polyacrylamide gel electrophoresis, 12% gel.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2.   Selective binding of ERK1 and ERK2 MAP kinases to GST-MKP-3 fusion proteins. COS-7 cells transfected with p44-HA-ERK1, p42-Myc-ERK2, p54-HA-JNK3/SAPKbeta or HA-p38 MAP kinases were lysed and incubated with glutathione-Sepharose beads prebound either to GST alone or each of the GST-MKP-3 fusion proteins as indicated above each lane. Western analysis of washed beads was performed using anti-HA or anti-Myc epitope monoclonal antibodies with goat anti-mouse monoclonal antibody horseradish peroxidase conjugate and chemiluminescence. Crude lysates from the transfected cells were used as positive controls for each MAP kinase. Data shown is indicative of three identical experiments.

To test whether MKP-3 binding to ERK MAP kinases reflects interaction through N- and/or C-terminal regions, we next performed precipitations using either GST-MKP-3Delta C or GST-MKP-3Delta N (Fig. 1). Unlike the full- length MKP-3 molecule, GST-MKP-3Delta N containing the C-terminal catalytic core is unable to precipitate detectable levels of either p44-HA-ERK1 or p42-Myc-ERK2 (Fig. 2). GST-MKP-3Delta N was also unable to bind detectably to either p54-HA-JNK3/SAPKbeta or HA-p38 MAP kinases (Fig. 2). The inability of GST-MKP-3Delta N to bind ERK MAP kinases is unlikely to reflect misfolding as this fusion protein displayed similar enzymatic activity as full-length GST-MKP-3 when using the artificial substrate p-nitrophenyl phosphate (Fig. 3). Somewhat surprisingly, and in contrast to the C-terminal catalytic core of MKP-3, the N-terminal GST-MKP-3Delta C was found to bind tightly and precipitate both p44-HA-ERK1 and p42-Myc-ERK2 at least as well as the full length GST-MKP-3 molecule (Fig. 2). GST-MKP-3Delta C was also able to bind weakly to HA-p38 MAP kinase while this fusion was completely ineffective at binding p54-HA-JNK3/SAPKbeta (Fig. 2). Overall, the rank-order for MKP-3 N-terminal binding and precipitation of MAP kinases is p44-ERK1 = p42-ERK2 >>  p38 > p54SAPKbeta . Together, these observations indicate that the N-terminal half of MKP-3 is alone able to bind tightly to ERK family MAP kinases and probably accounts, at least in part, for the precipitation observed with the full-length molecule.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   In vitro measurement of MKP-3 phosphatase activity. Hydrolysis of p-nitrophenyl phosphate (pNPP) by 10-40 µg of purified GST-MKP-3 or GST-MKP-3Delta N during a 1-h incubation at 37 °C. Optical density was measured at 410 nm. No hydrolytic activity was detected by incubation with either GST-MKP-3 C293S or GST-MKP-3Delta C. This experiment was performed twice with identical observations.

Studies in yeast and mammalian cells have demonstrated that elements within MAP kinase cascades as well as other signal transduction pathways form multicomponent complexes through tight association with various anchoring proteins. For instance, the yeast pheromone mating response MAP kinases FUS3 or KSS1, as well as the upstream kinases STE7 and STE11 and G protein beta -subunit STE4 all bind simultaneously to the scaffold protein STE5, while the mammalian cell protein AKAP79 maintains protein kinase A and C, as well as the serine threonine protein phosphatase calcineurin in close proximity to their target substrates (46, 47). To test whether MKP-3 is able to bind to ERK MAP kinases directly and independently of additional cellular proteins, we next tested binding to p42 ERK2 protein purified following its expression in E. coli and cleavage from its GST fusion. Fig. 4 shows that, as observed with cell lysates, GST-MKP-3, GST-MKP-3 C293S, and GST-MKP-3Delta C immobilized on glutathione-Sepharose beads are all able to bind and precipitate purified p42 ERK2 from lysis buffer, while GST-MKP-3 Delta N binds only very weakly to this MAP kinase. This result indicates that binding between the MKP-3 N-terminal and ERK MAP kinases is direct and independent of additional cellular proteins.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4.   GST-MKP-3 binds ERK2 directly. ERK2 protein purified following expression in E. coli and cleavage from its GST fusion (45) was incubated with glutathione-Sepharose beads prebound either to GST alone or each of the GST-MKP-3 fusion proteins as indicated above each lane. Western analysis of washed beads was performed using antibody 122 specific for ERK2 with goat anti-rabbit monoclonal antibody horseradish peroxidase conjugate and chemiluminescence. Purified ERK2 protein (~5 ng) was loaded as a positive control.

To investigate the relationship between MKP-3 binding and MAP kinase inactivation we next incubated purified ERK2 activated by the constitutively active MAP kinase kinase MEK-1 mutant S218E S222E (39, 45) together with increasing concentrations of either full-length GST-MKP-3 or GST-MKP-3Delta N. While 0.5 µg of MKP-3 completely blocked MEK-1-dependent ERK2 activation, 10-fold higher concentrations of MKP-3Delta N were required to elicit similar inhibition of this MAP kinase (Fig. 5). In contrast to potent and selective inactivation of ERK2 by MKP-3, similarly high concentrations of MKP-3 and MKP-3Delta N were required to inhibit either JNK2/SAPKalpha or JNK3/SAPKbeta activated in vitro by purified SEK1 or to reverse p38 MAP kinase activation by MKK6 (Fig. 5). This suggests that, in contrast to full-length MKP-3, MKP-3Delta N displays little selectivity for inactivating different MAP kinase isoforms. These experiments demonstrate a clear correlation between ERK binding to full-length MKP-3 and specificity for ERK MAP kinase inactivation.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 5.   Selective inactivation of ERK2 MAP kinase requires the MKP-3 N terminus. Purified MAP kinases (0.5 µg) were activated by 0.1 µg of the appropriate MAP kinase kinase (MEK-1 S218E S222E for ERK2, SEK-1 for JNK2/SAPKalpha and JNK3/SAPKbeta , and MKK6 for p38) and incubated with 0.01-10 µg of either full-length GST-MKP-3 or GST-MKP-3Delta N (amino acids 153-381) as indicated. MAP kinase enzymatic activity was assessed by phosphorylation of 10 µg of myelin basic protein (ERK2), c-Jun 1-79 (JNK2/SAPKalpha and JNK3/SAPKbeta ) or ATF-2 19-96 (p38). Autoradiogram shows substrate proteins following separation with SDS-polyacrylamide gel electrophoresis, 15% gel, and is representative of three identical experiments.

We next co-expressed in COS-7 cells either p44-HA-ERK1 or p54-HA-JNK3/SAPKbeta together with Myc epitope-tagged versions of MKP-3, MKP-3 C293S, MKP-3Delta C (amino acids 1-217), M3-6, CB16 (chimera consisting of N-terminal 217 residues of MKP-3 and amino acids 172-321 M3-6), or CA8 (chimera of M3-6 N-terminal 171 residues with amino acids 218-381 of MKP-3) (Fig. 6). In agreement with observations using the GST fusion proteins, when cell extracts were subject to immunoprecipitation using the Myc epitope-specific monoclonal antibody 9E10, p44-HA-ERK1 can be seen clearly to bind tightly to MKP-3, MKP-3 C293S, and MKP-3Delta C, while p54-HA-JNK3/SAPKbeta failed to immunoprecipitate detectably with any of these MKP-3 constructs (Fig. 7). Also consistent with our previous observations, p44-HA-ERK1 binds tightly and co-immunoprecipitates with the chimera CB16 (with the MKP-3 N terminus) despite consistently lower levels of expression with this construct (Fig. 7). In contrast, p44-HA-ERK1 failed to co-immunoprecipitate detectably with either M3-6 or the chimera CA8 comprising the M3-6 N terminus (Fig. 7). Neither M3-6, CB16, or CA8 bind detectably to p54-SAPKbeta under identical conditions (Fig. 7).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 6.   Mutant MKP-3, M3-6 and MKP-3/M3-6 chimeras expressed in mammalian cells. A, schematic representation of Myc-epitope tagged MKP-3, MKP-3 C293S, MKP-3Delta C, M3-6, M3-6Delta C, as well as the chimeras CB16 and CA8 encoded by constructs subcloned into the eukaryotic expression vector pMT-SM. Cys293 is essential for MKP-3 catalytic activity and its substitution by Ser (C293S) generates an inactive enzyme. Numbering corresponds to the first and last amino acids of the MKP-3 and M3-6 proteins included in each construct. The full-length MKP-3 and M3-6 molecules possess 381 and 663 amino acids, respectively (34, 36). The C-terminal half of M3-6 is not predicted to encode catalytic activity and represents a C-terminal extension including the translation of a complex trinucleotide repeat (34). B, COS-7 cells were transfected with either empty plasmid (Control) or pMT-SM containing MKP-3-Myc, MKP-3 C293S-Myc, MKP-3Delta C-Myc, M3-6-Myc, CB16-Myc, or CA8-Myc using LipofectAMINE (1 µg of plasmid). Cells were lysed after 40 h and subjected to Western analysis using anti-Myc monoclonal antibody together with goat anti-mouse monoclonal antibody horseradish peroxidase conjugate and chemiluminescence.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   Co-immunoprecipitation of ERK1 but not SAPKbeta with MKP-3. COS-7 cells were transfected with either 1 µg of p44-HA-ERK1 or p54-HA-JNK3/SAPKbeta plasmid together with empty vector or pMT-SM containing MKP-3-Myc, MKP-3 C293S-Myc, MKP-3Delta C-Myc, M3-6-Myc, CB16-Myc, or CA8-Myc as indicated (1 µg of each plasmid). Following culture for 40 h, cells were incubated for 2 h in serum-free medium, lysed, and subject to immunoprecipitation using anti-Myc epitope monoclonal antibody 9E10 and protein G-Sepharose beads. Washed beads were analyzed by Western blotting using biotinylated anti-HA epitope monoclonal antibody 12CA5 with detection using avidin-horseradish peroxidase conjugate and chemiluminescence (upper panel). To control for expression of MAP kinases the cell lysates used for immunoprecipitations (IP) were subjected to Western analysis using anti-HA epitope monoclonal antibody (lower panel). Levels of p44-HA-ERK1 and p54-HA-JNK3/SAPKbeta expression were similar following co-transfection with all MKP-3, M3-6 and chimeric constructs. Data shown is representative of four separate experiments.

To confirm that tight binding between the MKP-3 N terminus and ERK also parallels specific inactivation of this class of MAP kinase within intact cells, immune complex assays were performed on p44-HA-ERK1 and p54-HA-JNK3/SAPKbeta co-expressed with the same MKP-3 and M3-6 constructs. As we have reported previously (40) MKP-3 co-expression abolishes EGF-stimulated activation of p44-HA-ERK1 (Fig. 8). In contrast, the catalytically inactive mutants MKP-3 (C293S) and MKP-3Delta C fail to inhibit, and rather augment by 2-3-fold the activation state of p44-HA-ERK1 (Fig. 8). Also as seen before (40), co-expression of M3-6 is completely unable to suppress EGF-stimulated p44-HA-ERK1, while anisomycin-dependent stimulation of p54-HA-JNK3/SAPKbeta is inhibited by >90% (Fig. 8). It is of note that a truncated version of this dual specificity phosphatase, M3-6Delta C (Fig. 6A), elicits indistinguishable selective inhibition of p54-HA-JNK3/SAPKbeta (not shown). Dramatically, and in contrast to tight binding of CB16 to p44-HA-ERK1 (Fig. 7), CB16 is totally ineffective in its ability to inhibit EGF-stimulated activation of this MAP kinase (Fig. 8). Rather, as observed with the enzymatically inactive mutants MKP-3 C293S and MKP-3Delta C, co-expression of CB16 facilitates p44-HA-ERK1 activation state by approximately 2-fold (Fig. 8). Importantly, CB16 appears to be an active enzyme as its co-expression with p54-HA-JNK3/SAPKbeta results in an ~80% inhibition of anisomycin-stimulated activity (Fig. 8). The chimera CB16 therefore retains the enzymatic specificity of its M3-6 catalytic core despite tight interaction with p44-HA-ERK1. In contrast to these observations, the chimera CA8 possessing the catalytic core of MKP-3 and which fails to bind to p44-HA-ERK1 (Fig. 7), mediates complete inactivation of EGF-stimulated activation of this MAP kinase (Fig. 8). Notably however, and as observed in vitro using GST-MKP-3Delta N (Fig. 5), CA8 differs from MKP-3 insofar that it displays no selectivity for inactivation of p44-HA-ERK1 when compared with p54-HA-JNK3/SAPKbeta (Fig. 9). This indicates that binding of the MKP-3 N terminus to ERK isoforms within intact cells also plays a critical role in determining specificity for inactivation of this class of MAP kinase.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 8.   Inactivation of ERK1 and SAPKbeta activation by mutant MKP-3, M3-6, and MKP-3/M3-6 chimeras. COS-7 cells were transfected with 1 µg of p44-HA-ERK1 or p54-HA-JNK3/SAPKbeta plasmid together with empty vector or pMT-SM containing MKP-3-Myc, MKP-3 C293S-Myc, MKP-3Delta C-Myc, M3-6-Myc, CB16-Myc, or CA8-Myc as indicated (1 µg of each plasmid). Following culture for 40 h, cells were incubated for 2 h in serum-free medium and stimulated with either 10 nM EGF (p44-HA-ERK1) or 10 µg/ml anisomycin (p54-HA-JNK3/SAPKbeta ). Following incubation for either 10 min (p44-HA-ERK1) or 30 min (p54-HA-JNK3/SAPKbeta ) the MAP kinases were immunoprecipitated using anti-HA epitope monoclonal antibody HA.11 prebound to protein G-Sepharose beads. Immune complex assays were then performed using MBP (p44-HA-ERK1) or GST-c-Jun 1-79 (p54-HA-JNK3/SAPKbeta ) as substrates in the presence of [gamma -32P]ATP. The upper panel shows an autoradiogram of phosphorylated substrates separated with SDS-polyacrylamide gel electrophoresis, 15% gel. Following drying of the gel, substrate bands were excised for counting by scintillation spectrometry and calculation of relative kinase activity. This is indicated numerically below each lane relative to basal unstimulated activity (defined as 1.0). The lower panel shows a Western blot of immunoprecipitated p44-HA-ERK1 and p54-HA-JNK3/SAPKbeta used for the immune complex assays. Detection is with biotinylated anti-HA monoclonal antibody 12CA5 detected using avidin-horseradish peroxidase conjugate and chemiluminescence. Data is representative of four identical experiments.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 9.   Inhibition of ERK1 and SAPKbeta by MKP-3 and the M3-6/MKP-3 chimera CA8. COS-7 cells were transfected with 1 µg of p44-HA-ERK1 (A and C) or p54-HA-JNK3/SAPKbeta (B and D) alone or together with increasing concentrations of the MKP-3 (A and B) or CA8 (C and D) plasmid as indicated. Plasmid concentrations were kept constant using the empty pMT-SM vector. After culture for 40 h, cells were incubated for 2 h in serum-free medium and then stimulated with either 10 nM EGF (p44-HA-ERK1) or 10 µg/ml anisomycin (p54-HA-JNK3/SAPKbeta ). Following cell lysis, MAP kinase immunoprecipitation and immunecomplex assays were performed as described in Fig. 8. Upper panels in A-D show autoradiograms of phosphorylated MBP (p44-HA-ERK1) or c-Jun (p54-HA-JNK3/SAPKbeta ) upon co-expression with the indicated amounts of MKP-3 (A and B) or CA8 (C and D) plasmid. Substrate bands were excised for counting by scintillation spectrometry and calculation of relative kinase activity which is indicated numerically below each lane. Western blot of immunoprecipitated (IP) p44-HA-ERK1 and p54-HA-JNK3/SAPKbeta used for immune complex assays is shown below each autoradiogram. Detection is as described in Fig. 8. Data are representative of three identical experiments.

The crystal structure of several PTP family members (Yersinina PTPase, PTP1B, PTPalpha ) including the dual-specificity phosphatase VHR have now been solved and, despite limited primary amino acid sequence homology, all have been shown to possess a very similar three-dimensional structure within their catalytic domains (42, 48-52). Based on the crystal structure of VHR, reliable secondary structure prediction of rVH6 (identical to MKP-3) is possible and demonstrates that the C-terminal domain (amino acids 134-381) is alone able to form the catalytic core of this dual specificity phosphatase (41). We have obtained essentially identical results modeling the primary amino acids 209-348 of MKP-3 on the crystal structure of VHR using the SWISS MODEL program (53) (not shown). These secondary structure predictions are also consistent with experimental observations that the MKP-3 C-terminal half displays indistinguishable enzymatic activity to the full-length molecule when using the artificial substrate p-nitrophenyl phosphate (Fig. 3). What then is the function of the N-terminal noncatalytic halves of this gene family? Experiments described in this report demonstrate that one role for the N terminus of MKP-3 is likely to be tight binding to its substrate MAP kinases p44-ERK1 and p42-ERK2. Tight substrate binding may ensure highly restricted enzyme action within the environment of an intact cell. One untested hypothesis is that the highly divergent N termini of dual specificity phosphatase family members (39) bind tightly to a distinct set of target substrates. Interestingly, examination of the gene structures of CL100 and PAC1 indicates that their N termini are encoded by exons 1 and 2 and may have distinct evolutionary origins to the C-terminal catalytic core (44, 54, 55). Diverse substrate binding capabilities for this gene family may therefore have arisen through convergence of gene structures encoding a limited set of catalytic cores with a more varied range of N-teminal targeting sequences. The emergence of gene structures for other dual specificity phosphatase family members will help clarify this issue.

In summary, these observations demonstrate that MKP-3 binds directly the MAP kinases ERK1 and ERK2 through its non-catalytic N terminus. MKP-3 binding displays the rank order p44-ERK1 = p42-ERK2 >>  p38 > p54SAPKbeta which parallels its enzymatic specificity for MAP kinase inactivation (38, 40). Experiments described in this report using the MKP-3Delta N catalytic core as well as with chimeras of MKP-3 and M3-6 indicate that this binding may underlie MKP-3 selectivity for ERK family MAP kinases. Restricted substrate binding by the structurally diverse N termini of different dual-specificity phosphatases may provide a general mechanism ensuring enzymatic selectivity for this gene family.

    ACKNOWLEDGEMENTS

We are grateful to the following for generous gifts. J. Pouysségur (CNRS, Nice, France) for pcDNA1-HA-p44 ERK1, J. R. Woodgett (Ontario Cancer Institute, Canada) for pMT2T-HA-p54-SAPKbeta , pGEX-SAPKalpha 2 and pGEX-c-Jun-(5-89), J. S. Gutkind (NIDR, National Institutes of Health) for pcDNA3-HA-p38, E. Bettini (Glaxo Wellcome, Verona, Italy) for pGEX-c-Jun-(1-79), L. I. Zon (Harvard Medical School, Boston, MA) for pEBG-SEK1, S. Stimpson (Glaxo Wellcome, Research Triangle Park, NC) for purified p38 and MKK6 protein, and C. J. Marshall (Chester Beatty Labs, ICR, London, UK) for pGEX-2T-ERK2, pGEX-3X-MEK-1 (S218E S222E), pEXV3-Myc-ERK2, and rabbit antibody 122 specific for ERK2. We also thank Bruno Antonsson for purification of mouse ERK2 and rabbit MEK-1 EE protein and Chris Hebert for photographic work.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Present address: Dept. of Biological Chemistry, University of Michigan, Ann Arbor, MI 48109.

** To whom correspondence should be addressed: Serono Pharmaceutical Research Institute, CH-1228 Plan-les-Ouates, Geneva, Switzerland, Tel.: 00 41 22 706 98 42; Fax: 00 41 22 794 69 65; E-mail: steve.arkinstall.ch_gva03{at}serono.com

1 The abbreviations used are: ERK, extracellular signal-regulated kinase: MAP kinase, mitogen-activated protein kinase; JNK/SAPK, c-Jun N-terminal kinase/stress-activated protein kinase; MKP, MAP kinase phosphatase; PTP, protein tyrosine phosphatase; GST, glutathione S-transferase; MBP, myelin basic protein; HA, hemagglutinin; EGF, epidermal growth factor.

2 A. Smith and A. Ashworth, manuscript in preparation.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

  1. Cohen, P. (1997) Trends Cell Biol. 7, 353-361
  2. Marshall, C. J. (1995) Cell 80, 179-185[CrossRef][Medline] [Order article via Infotrieve]
  3. Gupta, S., Barrett, T., Whitmarsh, A. J., Cavanagh, J., Sluss, H. K., Derijard, B., and Davies, R. J. (1996) EMBO J. 15, 2760-2770[Medline] [Order article via Infotrieve]
  4. Cano, E., and Mahadevan, L. C. (1995) Trends Biochem. Sci. 20, 117-122[CrossRef][Medline] [Order article via Infotrieve]
  5. Treisman, R. (1996) Curr. Opin. Cell Biol. 8, 205-215[CrossRef][Medline] [Order article via Infotrieve]
  6. Karin, M. (1995) J. Biol. Chem. 270, 16483-16486[Free Full Text]
  7. Cahill, M. A., Janknecht, R., and Nordheim, A. (1996) Current Biol. 6, 16-19[CrossRef][Medline] [Order article via Infotrieve]
  8. Xiao Zhong, W., and Ron, D. (1996) Science 272, 1347-1349[Abstract]
  9. Whitmarsh, A. J., Shore, P., Sharrocks, A. D., and Davis, R. J. (1995) Science 269, 403-407[Abstract/Free Full Text]
  10. Gupta, S., Campbell, D., Derijard, B., and Davis, R. J. (1995) Science 267, 389-393[Abstract/Free Full Text]
  11. Pages, G., Lenormand, P., L'Allemain, G., Chambard, J. C., Meloche, S., and Pouysségur, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8319-8328[Abstract/Free Full Text]
  12. Sontag, E., Fedorov, S., Kamibayashi, C., Robbins, D., Cobb, M., and Mumby, M. (1993) Cell 75, 887-897[CrossRef][Medline] [Order article via Infotrieve]
  13. Cowley, S., Paterson, H., Kemp, P., and Marshall, C. J. (1994) Cell 77, 841-852[CrossRef][Medline] [Order article via Infotrieve]
  14. Mansour, S. J., Matten, W. T., Hermann, A. S., Candia, J. M., Rong, S., Fukasawa, K., Vande Woude, G. F., and Ahn, N. G. (1994) Science 265, 966-970[Abstract/Free Full Text]
  15. Dudley, D. T., Pang, L., Decker, S. J., Bridges, A. J., and Saltiel, A. R. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7686-7689[Abstract/Free Full Text]
  16. Ichijo, H., Nishida, E., Irie, K., Dijke, P. T., Saitoh, M., Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K., and Gotoh, Y. Science 275, 90-94
  17. Yang, X., Khosravi-Far, R., Chang, H. Y., and Baltimore, D. (1997) Cell 89, 1067-1076[CrossRef][Medline] [Order article via Infotrieve]
  18. Xia, Z., Dickens, M., Raingeaud, J., Davis, R. J., and Greenberg, M. E. (1995) Science 270, 1326-1331[Abstract/Free Full Text]
  19. Verheij, M., Bose, R., Lin, X. H., Yao, B., Jarvis, W. D., Grant, S., Birrer, M. J., Szabo, E., Zon, L. I., Kyriakis, J. M., Haimovitz-Friedman, A., Fuks, Z., and Kolesnick, R. N. (1996) Nature 380, 75-79[CrossRef][Medline] [Order article via Infotrieve]
  20. Zanke, B. W., Boudreau, K., Rubie, E., Winnett, E., Tibbles, L. A., Zon, L., Kyriakis, J., Liu, F.-F., and Woodgett, J. R. (1996) Curr. Biol. 6, 606-613[CrossRef][Medline] [Order article via Infotrieve]
  21. Keyse, S. M. (1995) Biochem. Biophys. Acta 1265, 152-160[Medline] [Order article via Infotrieve]
  22. Ishibashi, T., Bottaro, D. P., Chan, A., Miki, T., and Aaronson, S. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 89, 12170-12174[Abstract/Free Full Text]
  23. Keyse, S. M., and Emslie, E. A. (1992) Nature 359, 644-646[CrossRef][Medline] [Order article via Infotrieve]
  24. Charles, C. H., Abler, A. S., and Lau, L. F. (1992) Oncogene 7, 187-190[Medline] [Order article via Infotrieve]
  25. Alessi, D. R., Smythe, C., and Keyse, S. M. (1993) Oncogene 8, 2015-2020[Medline] [Order article via Infotrieve]
  26. Sun, H., Charles, C. H., Lau, L. F., and Tonks, N. K. (1993) Cell 75, 487-493[CrossRef][Medline] [Order article via Infotrieve]
  27. Rohan, P. J., Davis, P., Moskaluk, C. A., Kearns, M., Krutzsch, H., Siebenlist, U., and Kelly, K. (1993) Science 259, 1763-1766[Abstract/Free Full Text]
  28. Ward, Y., Gupta, S., Jensen, P., Wartmann, M., Davis, R. J., and Kelly, K. (1994) Nature 367, 651-654[CrossRef][Medline] [Order article via Infotrieve]
  29. Guan, K.-L., and Butch, E. (1995) J. Biol. Chem. 270, 7197-7203[Abstract/Free Full Text]
  30. Misra-Press, A., Rim, C. S., Yao, H., Roberson, M. S., and Stork, P. J. S. (1995) J. Biol. Chem. 270, 14587-14596[Abstract/Free Full Text]
  31. King, A. G., Ozanne, B. W., Smythe, C., and Ashworth, A. (1995) Oncogene 11, 2553-2563[Medline] [Order article via Infotrieve]
  32. Kwak, S. P, and Dixon, J. E. (1995) J. Biol. Chem. 270, 1156-1160[Abstract/Free Full Text]
  33. Ishibashi, T., Bottaro, D. P., Michieli, P., Kelley, C. A., and Aaronson, S. A. (1994) J. Biol. Chem. 269, 29897-29902[Abstract/Free Full Text]
  34. Theodosiou, A. M., Rodrigues, N. R., Nesbit, M. A., Ambrose, H. J., Paterson, H., McLellan-Arnold, E., Boyd, Y., Leversha, M. A., Owen, N., Blake, D. J., Ashworth, A., and Davies, K. E. (1996) Hum. Mol. Genet. 96, 675-684
  35. Martell, K. J., Seasholtz, A. F., Kwak, S. P., Clemens, K. K., and Dickson, J. E. (1995) J. Neurochem. 65, 1823-1833[Medline] [Order article via Infotrieve]
  36. Muda, M., Boschert, U., Dickinson, R., Martinou, J.-C., Martinou, I., Camps, M., Schlegel, W., and Arkinstall, S. (1996) J. Biol. Chem. 271, 4319-4326[Abstract/Free Full Text]
  37. Mourey, R. J., Quinn, C. V., Campbell, J. S., Wenderoth, M. P., Hauschka, S. D., Krebs, E. G., and Dixon, J. E. (1996) J. Biol. Chem. 271, 3795-3802[Abstract/Free Full Text]
  38. Groom, L. A., Sneddon, A. A., Alessi, D. R., Dowd, S., and Keyse, S. M. (1996) EMBO J. 15, 3621-3632[Medline] [Order article via Infotrieve]
  39. Muda, M., Boschert, U., Smith, A., Antonsson, B., Gillieron, C., Chabert, C., Camps, M., Martinou, I., Ashworth, A., and Arkinstall, S. (1997) J. Biol. Chem. 272, 5141-5151[Abstract/Free Full Text]
  40. Muda, M., Theodosiou, A., Rodrigues, N., Boschert, U., Camps, M., Gillieron, C., Davies, K., Ashworth, A., and Arkinstall, S. (1996) J. Biol. Chem. 271, 27205-27208[Abstract/Free Full Text]
  41. Wiland, A. M., Denu, J. M., Mourey, R. J., and Dixon, J. E. (1996) J. Biol. Chem. 271, 33486-33492[Abstract/Free Full Text]
  42. Yuvaniyama, J., Denu, J. M., Dixon, J. E., and Saper, M. A. (1996) Science 272, 1328-1331[Abstract]
  43. Keyse, S. M., and Ginsburg, M. (1993) Trends Biochem. Sci. 18, 377-378[CrossRef][Medline] [Order article via Infotrieve]
  44. Kwak, S. P., Hakes, D. J., Martell, K. J., and Dixon, J. E. (1994) J. Biol. Chem. 269, 3596-3604[Abstract/Free Full Text]
  45. Stokoe, D., Campbell, D. G., Nakielny, S., Hidaka, H., Leevers, S. J., Marshall, C. J., and Cohen, P. (1992) EMBO J. 11, 3985-3994[Medline] [Order article via Infotrieve]
  46. Klauck, T. M., Faux, M. C., Labudda, K., Langeberg, L. K., Jaken, S., and Scott, J. D. (1996) Science 271, 1589-1592[Abstract]
  47. Leberer, E., Thomas, D. Y., and Whiteway, M. (1997) Curr. Opin. Genet. Dev. 7, 59-66[CrossRef][Medline] [Order article via Infotrieve]
  48. Fauman, E. B., and Saper, M. A. (1996) Trends Biochem. Sci. 21, 413-417[CrossRef][Medline] [Order article via Infotrieve]
  49. Stuckey, J. A., Schubert, H. L., Fauman, E. B., Zhang, Z. Y., Dixon, J. E., and Saper, M. A. (1994) Nature 370, 571-575[CrossRef][Medline] [Order article via Infotrieve]
  50. Barford, D., Flint, A. J., and Tonks, N. K. (1994) Science 263, 1397-1404[Abstract/Free Full Text]
  51. Jia, Z., Barford, D., Flint, A. J., and Tonks, N. K. (1995) Science 268, 1754-1758[Abstract/Free Full Text]
  52. Bilwes, A. M., den Hertog, J., Hunter, T., and Noel, J. P. (1996) Nature 382, 555-559[CrossRef][Medline] [Order article via Infotrieve]
  53. Peitsch, M. C. (1995) Bio/Technology 13, 658-660[CrossRef]
  54. Noguchi, T., Metz, R., Chen, L., Mattei, M.-G., Carrasco, D., and Bravo, R. (1993) Mol. Cell. Biol. 13, 5195-5205[Abstract/Free Full Text]
  55. Gerondakis, S., Economou, C., and Grumont, R. J. (1994) Genomics 24, 182-184[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
D. W. Chan, V. W.S. Liu, G. S.W. Tsao, K.-M. Yao, T. Furukawa, K. K.L. Chan, and H. Y.S. Ngan
Loss of MKP3 mediated by oxidative stress enhances tumorigenicity and chemoresistance of ovarian cancer cells
Carcinogenesis, September 1, 2008; 29(9): 1742 - 1750.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Zhao and S. Ding
A high-throughput siRNA library screen identifies osteogenic suppressors in human mesenchymal stem cells
PNAS, June 5, 2007; 104(23): 9673 - 9678.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. R. Jayakumar, K. S. Panickar, Ch. R. K. Murthy, and M. D. Norenberg
Oxidative stress and mitogen-activated protein kinase phosphorylation mediate ammonia-induced cell swelling and glutamate uptake inhibition in cultured astrocytes.
J. Neurosci., May 3, 2006; 26(18): 4774 - 4784.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Tarrega, P. Rios, R. Cejudo-Marin, C. Blanco-Aparicio, L. van den Berk, J. Schepens, W. Hendriks, L. Tabernero, and R. Pulido
ERK2 Shows a Restrictive and Locally Selective Mechanism of Recognition by Its Tyrosine Phosphatase Inactivators Not Shared by Its Activator MEK1
J. Biol. Chem., November 11, 2005; 280(45): 37885 - 37894.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. R. Christie, D. J. Williams, F. MacIsaac, R. J. Dickinson, I. Rosewell, and S. M. Keyse
The Dual-Specificity Protein Phosphatase DUSP9/MKP-4 Is Essential for Placental Function but Is Not Required for Normal Embryonic Development
Mol. Cell. Biol., September 15, 2005; 25(18): 8323 - 8333.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. Nazarian, K. Bouri, and E. P. Hoffman
Intracellular expression profiling by laser capture microdissection: three novel components of the neuromuscular junction
Physiol Genomics, March 21, 2005; 21(1): 70 - 80.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. G. Smith, D. Sweetman, M. Patterson, S. M. Keyse, and A. Munsterberg
Feedback interactions between MKP3 and ERK MAP kinase control scleraxis expression and the specification of rib progenitors in the developing chick somite
Development, March 15, 2005; 132(6): 1305 - 1314.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Marchetti, C. Gimond, J.-C. Chambard, T. Touboul, D. Roux, J. Pouyssegur, and G. Pages
Extracellular Signal-Regulated Kinases Phosphorylate Mitogen-Activated Protein Kinase Phosphatase 3/DUSP6 at Serines 159 and 197, Two Sites Critical for Its Proteasomal Degradation
Mol. Cell. Biol., January 15, 2005; 25(2): 854 - 864.
[Abstract] [Full Text] [PDF]