![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 15, 9323-9329, April 10, 1998
From the We have reported recently that the dual
specificity mitogen-activated protein kinase phosphatase-3
(MKP-3) elicits highly selective inactivation of the
extracellular signal-regulated kinase (ERK) class of mitogen-activated
protein (MAP) kinases (Muda, M., Theodosiou, A., Rodrigues, N.,
Boschert, U., Camps, M., Gillieron, C., Davies, K., Ashworth, A., and
Arkinstall, S. (1996) J. Biol. Chem. 271, 27205-27208). We now show that MKP-3 enzymatic specificity is
paralleled by tight binding to both ERK1 and ERK2 while, in contrast,
little or no interaction with either c-Jun N-terminal kinase/stress
activated protein kinase (JNK/SAPK) or p38 MAP kinases was
detected. Further study revealed that the N-terminal noncatalytic domain of MKP-3 (MKP-3 The extracellular signal-regulated kinase
(ERK),1 c-Jun N-terminal
kinase/stress-activated protein kinase (JNK/SAPK) and p38/RK/CSBP (p38)
represent three major classes of mitogen-activated protein (MAP) kinase
(1-4). Different cell stimuli appear to activate distinct MAP kinases
preferentially. Hence, while growth factors and some oncogenes are
linked to activation of ERK, inflammatory cytokines and cell stresses
lead to activation of JNK/SAPK and p38 (1-4). MAP kinases are known to
phosphorylate several key regulatory proteins including additional
kinases, cytoskeletal proteins, nuclear receptors, as well as several
transcription factors, indicating a central role in controlling cell
function (1, 5-10). Indeed, ERK has been shown to be important in
processes leading to neuronal differentiation, mitogenesis, and
oncogenic transformation (1, 11-15), while JNK/SAPK and p38 MAP
kinases play critical roles in pathways leading to the generation of
inflammatory cytokines and apoptotic death (1, 16-20).
MAP kinase activation requires phosphorylation on Thr and Tyr residues
located within the motif TXY of kinase domain VIII (1, 2, 4,
7). While several upstream kinases catalyze this modification on
specific MAP kinases, an emerging family of dual-specificity
phosphatase dephosphorylate both threonine and tyrosine residues and
appear likely to inactivate MAP kinases effectively under physiological
conditions (21). Ten distinct mammalian dual specificity phosphatase
genes have been characterized including VHR (22), CL100 (orthologue of
3CH134 and renamed as MKP-1) (23-26), PAC1 (27, 28), MKP-2 (also
cloned as hVH-2 and TYP-1) (29-31), hVH-3 (same as B23) (32, 33), M3-6
(orthologue of hVH-5) (34, 35), MKP-3 (identical to rVH-6 and
orthologue of PYST1) (36-38), MKP-X (orthologue of PYST2) (36, 38),
MKP-4 (39), and MKP-5.2 Of
these family members MKP-3/PYST1 and M3-6 appear exceptional insofar
that they display highly specific inactivation of ERK or SAPK/JNK MAP
kinases, respectively (38, 40).
One important unanswered question is of the structural domains within
MKP-3 and M3-6 which underlie their selectivity for inactivation of
different MAP kinases. Dual specificity phosphatase family members are
characterized by an extended PTP active site signature sequence
localized to the C-terminal half of the molecule (41, 42), as well as
one or two short N-terminal CH2 domains displaying limited similarity
to noncatalytic regions of the Cdc25 phosphatase (43, 44). Despite low
homology within CH2 domains, the N-terminal halves of dual specificity
phosphatases are otherwise highly divergent (21, 36, 39) and the
functional role of this region has not been identified. We report here
experiments demonstrating that the N-terminal half of MKP-3 is
responsible for tight binding to its substrates ERK1 and ERK2 but not
JNK/SAPKs or p38. This interaction appears to be responsible for MKP-3
enzymatic selectivity for inactivation of ERK MAP kinases.
MKP-3 GST Fusion Proteins and Expression in Escherichia
coli--
To produce the full-length GST-MKP3 fusion protein, the
oligonucleotides GCCGGATCCATGATAGATACGCTCAGACC and
GCCCTCGAGTCACGTAGATT GCAGTTGCAGGGAGTC were used to PCR
amplify the complete MKP3 coding sequence from pMST-SM (36) and to
introduce BamHI and XhoI sites (underlined)
immediately flanking the start and stop codon. Upon restriction
digestion with BamHI and XhoI the amplified
cDNA was ligated to the corresponding sites in the pGEX4T3. To
generate an enzymatically inactive GST-MKP3 fusion protein, the
essential catalytic Cys293 was changed to Ser by
site-directed mutagenesis performed using the Transformer site-directed
mutagenesis kit (CLONTECH). To produce a GST fusion
protein consisting of the MKP-3 C-terminal catalytic core
(GST-MKP-3 Mammalian Expression Plasmids for MKP-3, MKP-3 Cell Culture, Transfection, Binding, and
Precipitation--
COS-7 cells were grown and transfected with 1 µg
of each plasmid as described previously (36, 39, 40). GST-MKP-3 fusion proteins were used to precipitate transfected p44-HA-ERK1,
p42-Myc-ERK2, p54-HA-JNK3/SAPK Full-length PYST1 has been shown previously to form stable
complexes with p42-ERK2 (38), although binding to p44-ERK1, JNK/SAPK, or p38 MAP kinases was not investigated. To test this, we transfected COS-7 cells with p44-HA-ERK1, p42-Myc-ERK2, p54-HA-JNK3/SAPK
The Mitogen-activated Protein Kinase Phosphatase-3 N-terminal
Noncatalytic Region Is Responsible for Tight Substrate Binding and
Enzymatic Specificity*
§,
,
,
,
,
,
,
**
Serono Pharmaceutical Research Institute
(formerly the Geneva Biomedical Research Institute, Glaxo Wellcome
Research and Development S.A.), CH-1228 Plan-les-Ouates, Geneva,
Switzerland, ¶ Cancer Research Campaign Centre for Cell and
Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer
Research, Fulham Road, London, SW3 6JB, United Kingdom, and
Genetics Laboratory, Department of Biochemistry, University of
Oxford, South Parks Road, Oxford OX1 3QU, United Kingdom
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References
C) binds both ERK1 and ERK2, while the C-terminal MKP-3 catalytic core (MKP-3
N) fails to precipitate either of these MAP kinases. A chimera consisting of the N-terminal half of MKP-3 with the C-terminal catalytic core of M3-6 also bound
tightly to ERK1 but not to JNK3/SAPK
. Consistent with a role for
N-terminal binding in determining MKP-3 specificity, at least 10-fold
higher concentrations of purified MKP-3
N than full-length MKP-3 is
required to inhibit ERK2 activity. In contrast, both MKP-3
N and
full-length MKP-3 inactivate JNK/SAPK and p38 MAP kinases at similarly
high concentrations. Also, a chimera of the M3-6 N terminus with the
MKP-3 catalytic core which fails to bind ERK elicits non selective
inactivation of ERK1 and JNK3/SAPK
. Together, these observations
suggest that the physiological specificity of MKP-3 for inactivation of
ERK family MAP kinases reflects tight substrate binding by its
N-terminal domain.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References
N; amino acids 153-381) the first 151 amino acid were
deleted by cutting full length pGEX4T3/MKP-3 (see above) with
XbaI and BamHI followed by religation. To
generate the MKP-3 N terminus as a GST fusion protein (GST-MKP-3
C;
amino acids 1-221), the plasmid pGEX4T3/MKP-3 was digested with
StyI and XhoI and ligated to a double-stranded
oligonucleotide obtained by annealing the two oligonucleotides
CAAGGAACTAAGAAGGGGTTCGCT and TCGAGCGAACCCCTTCTTAGTC. Fig.
1A illustrates schematically the MKP-3 amino acid sequences encoded within these fusion proteins. All MKP-3 and other GST-fusion proteins were expressed in E. coli by induction with 100 µM isopropyl-1-thio-
-D-galactopyranoside and growth overnight at 20 °C. Fusion proteins were purified with glutathione-Sepharose using standard techniques. ERK2 and MEK-1 EE were
further purified following cleavage of the GST-fusion as described (39,
45). MKP-3 phosphatase activity was measured in vitro using
p-nitrophenyl phosphate as described elsewhere (39).
C, M3-6, and
two MKP-3/M3-6 chimeras (CA8, CB16)--
Constructs encoding
Myc-epitope tagged MKP-3 and M3-6 subcloned into the eukaryotic
expression vector pMT-SM were as described previously (34, 36, 40). To
make chimeras of MKP-3 and M3-6 a truncated version of M3-6 (M3-6
C)
consisting of amino acids 1-321 (
97 to +964 base pairs) (34) was
first isolated by digesting M3-6 (in pcDNA II) with
Asp718 and Bsp120I. The Myc-epitope EQKLISEEDL was constructed using the oligonucleotides
GGCCCGAGCAGAAACTTATCTCCGAGGAAGATCTCTG and
AATTCAGAGATCTTCCTCGGAGATAAGTTTGTCCTCG and was used together with
pMT-SM vector (Asp718-EcoRI-digested) and the
M3-6 fragment in a triple ligation. To make MKP-3/M3-6 chimeras the
following oligonucleotides were then synthesized: M3-6(A),
CCTGGGATCCCAGAAAGATGTC; M3-6(B), CTGGGATCCCAGGTAGAGGTGAG;
MKP-3(A), CCTGGGATCCGCCAAGGACTCTAC; and MKP-3(B),
GGCGGATCCCAGGTAAAGGAAGG together with a T3 primer and the vector
primers pMT(A) TTGTTGTCAAGCTTGAGGTG and pMT(B) TCACGCTAGGATTGCCGTCA.
These oligonucleotides were used for polymerase chain reaction
amplification as follows. For a chimera consisting of the N-terminal
half of M3-6 and C-terminal half of MKP-3 (CA8), pMT(A) with M3-6(B)
using the M3-6
C/Myc fragment in pMT-SM as template and pMT(B) and
MKP-3(A) using MKP-3/Myc in pMT-SM as template. The polymerase chain
reaction products were digested using
Asp718-BamHI and
BamHI-EcoRI, respectively, and subcloned into
Asp718-EcoRI linearized pMT-SM in a three-way
ligation. For a chimera of the MKP-3 N-terminal and M3-6 C-terminal
catalytic core (CB16) polymerase chain reaction was performed with T3
and MKP-3(B) using MKP-3 in pBluescript SK
(36) as template, and M3-6(A) with pMT(B) using the M3-6
C/Myc fragment in pMT-SM as template. These polymerase chain reaction products were then digested using XhoI-BamHI or
BamHI-EcoRI, respectively, and subcloned into SalI-EcoRI linearized pMT-SM by triple ligation.
An epitope tagged version of the N-terminal portion MKP3, termed
MKP-3
C, was made using an oligonucleotide encoding the Myc epitope
sequence corresponding to the sequence EQKLISEEDLN ligated to the
BamHI site of the construct CB16. Fig. 6A
illustrates schematically the amino acid sequences encoded by
pMT-SM/MKP-3, pMT-SM/M3-6, pMT-SM/CA8, pMT-SM/CB16, and
pMT-SM/MKP-3
C.
, or HA-p38 using the lysis conditions
described by Keyse's laboratory (38). Where indicated, binding to 150 ng of purified ERK2 protein was performed under identical conditions. Co-immunoprecipitation of MAP kinases with Myc-tagged phosphatases was
performed using COS-7 cells co-expressing p44-HA-ERK1 or
p54-HA-JNK3/SAPK
with Myc-MKP-3, Myc-MKP-3 C293S, Myc-MKP-3
C,
Myc-M3-6, Myc-CA8, or Myc-CB16 using anti-Myc epitope monoclonal
antibody 9E10 prebound to protein G-Sepharose beads and identical
buffers. Immune complex and in vitro MAP kinase assays as
well as Western blotting were all performed exactly as described
previously (36, 39, 40).
![]()
RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
, or
HA-p38 and compared the ability of a range of GST-MKP-3 fusion proteins
immobilized on glutathione beads to precipitate these MAP kinases from
cell extracts. To perform these experiments the following fusion
proteins were purified following expression in E. coli:
full-length GST-MKP-3, the inactive mutant GST-MKP-3 C293S, the MKP-3
N-terminal GST-MKP-3
C (amino acids 1-221), and the MKP-3 C-terminal
GST-MKP-3
N (amino acids 153-381) (Fig.
1). When incubated with lysates from
transfected COS-7 cells, GST-MKP-3 is able to precipitate both
p44-HA-ERK1 and p42-Myc-ERK2 (Fig. 2). In
contrast, no precipitation of p54-HA-JNK3/SAPK
or HA-p38 MAP kinases
by GST-MKP-3 was detected under identical conditions (Fig. 2). In a
similar manner, the inactive mutant GST-MKP-3 C293S binds tightly and
precipitates both p44-HA-ERK1 and p42-Myc-ERK2 while binding only
weakly to HA-p38 MAP kinase. No precipitation of p54-HA-JNK3/SAPK
was observed under identical conditions (Fig. 2).

View larger version (38K):
[in a new window]
Fig. 1.
GST-MKP-3 fusion proteins. A,
schematic representation of GST-MKP-3 fusion proteins expressed in
E. coli. Indicated are the first and last amino acids
encompassed within each fusion protein numbered according to the 381 residues within the full-length MKP-3 protein (36). Cys293
is essential for MKP-3 catalytic activity, and its substitution by Ser
(C293S) generates an inactive enzyme. Two conserved CH2 domains are
included within the N-terminal MKP-3
C construct while the catalytic
core resides within the C-terminal MKP-3
N. B, Coomassie
Blue-stained GST-MKP-3 fusion proteins as described in A
following their purification with glutathione-Sepharose beads and
separation with SDS-polyacrylamide gel electrophoresis, 12% gel.

View larger version (35K):
[in a new window]
Fig. 2.
Selective binding of ERK1 and ERK2 MAP
kinases to GST-MKP-3 fusion proteins. COS-7 cells transfected with
p44-HA-ERK1, p42-Myc-ERK2, p54-HA-JNK3/SAPK
or HA-p38 MAP kinases
were lysed and incubated with glutathione-Sepharose beads prebound
either to GST alone or each of the GST-MKP-3 fusion proteins as
indicated above each lane. Western analysis of washed beads was
performed using anti-HA or anti-Myc epitope monoclonal antibodies with
goat anti-mouse monoclonal antibody horseradish peroxidase conjugate
and chemiluminescence. Crude lysates from the transfected cells were
used as positive controls for each MAP kinase. Data shown is indicative
of three identical experiments.
To test whether MKP-3 binding to ERK MAP kinases reflects interaction
through N- and/or C-terminal regions, we next performed precipitations
using either GST-MKP-3
C or GST-MKP-3
N (Fig. 1). Unlike the full-
length MKP-3 molecule, GST-MKP-3
N containing the C-terminal
catalytic core is unable to precipitate detectable levels of either
p44-HA-ERK1 or p42-Myc-ERK2 (Fig. 2). GST-MKP-3
N was also unable to
bind detectably to either p54-HA-JNK3/SAPK
or HA-p38 MAP kinases
(Fig. 2). The inability of GST-MKP-3
N to bind ERK MAP kinases is
unlikely to reflect misfolding as this fusion protein displayed similar
enzymatic activity as full-length GST-MKP-3 when using the artificial
substrate p-nitrophenyl phosphate (Fig.
3). Somewhat surprisingly, and in
contrast to the C-terminal catalytic core of MKP-3, the N-terminal
GST-MKP-3
C was found to bind tightly and precipitate both
p44-HA-ERK1 and p42-Myc-ERK2 at least as well as the full length
GST-MKP-3 molecule (Fig. 2). GST-MKP-3
C was also able to bind weakly
to HA-p38 MAP kinase while this fusion was completely ineffective at
binding p54-HA-JNK3/SAPK
(Fig. 2). Overall, the rank-order for MKP-3
N-terminal binding and precipitation of MAP kinases is p44-ERK1 = p42-ERK2
p38 > p54SAPK
. Together, these observations
indicate that the N-terminal half of MKP-3 is alone able to bind
tightly to ERK family MAP kinases and probably accounts, at least
in part, for the precipitation observed with the full-length
molecule.
|
Studies in yeast and mammalian cells have demonstrated that elements
within MAP kinase cascades as well as other signal transduction pathways form multicomponent complexes through tight association with
various anchoring proteins. For instance, the yeast pheromone mating
response MAP kinases FUS3 or KSS1, as well as the upstream kinases STE7
and STE11 and G protein
-subunit STE4 all bind simultaneously to the
scaffold protein STE5, while the mammalian cell protein AKAP79
maintains protein kinase A and C, as well as the serine threonine
protein phosphatase calcineurin in close proximity to their target
substrates (46, 47). To test whether MKP-3 is able to bind to ERK MAP
kinases directly and independently of additional cellular proteins, we
next tested binding to p42 ERK2 protein purified following its
expression in E. coli and cleavage from its GST fusion. Fig.
4 shows that, as observed with cell lysates, GST-MKP-3, GST-MKP-3 C293S, and GST-MKP-3
C immobilized on
glutathione-Sepharose beads are all able to bind and precipitate purified p42 ERK2 from lysis buffer, while GST-MKP-3
N binds only
very weakly to this MAP kinase. This result indicates that binding
between the MKP-3 N-terminal and ERK MAP kinases is direct and
independent of additional cellular proteins.
|
To investigate the relationship between MKP-3 binding and MAP kinase
inactivation we next incubated purified ERK2 activated by the
constitutively active MAP kinase kinase MEK-1 mutant S218E S222E (39,
45) together with increasing concentrations of either full-length
GST-MKP-3 or GST-MKP-3
N. While 0.5 µg of MKP-3 completely blocked
MEK-1-dependent ERK2 activation, 10-fold higher concentrations of MKP-3
N were required to elicit similar inhibition of this MAP kinase (Fig. 5). In contrast
to potent and selective inactivation of ERK2 by MKP-3, similarly high
concentrations of MKP-3 and MKP-3
N were required to inhibit either
JNK2/SAPK
or JNK3/SAPK
activated in vitro by purified
SEK1 or to reverse p38 MAP kinase activation by MKK6 (Fig. 5). This
suggests that, in contrast to full-length MKP-3, MKP-3
N displays
little selectivity for inactivating different MAP kinase isoforms.
These experiments demonstrate a clear correlation between ERK binding
to full-length MKP-3 and specificity for ERK MAP kinase
inactivation.
|
We next co-expressed in COS-7 cells either p44-HA-ERK1 or
p54-HA-JNK3/SAPK
together with Myc epitope-tagged versions of MKP-3, MKP-3 C293S, MKP-3
C (amino acids 1-217), M3-6, CB16 (chimera consisting of N-terminal 217 residues of MKP-3 and amino acids 172-321
M3-6), or CA8 (chimera of M3-6 N-terminal 171 residues with amino acids
218-381 of MKP-3) (Fig. 6). In agreement
with observations using the GST fusion proteins, when cell extracts were subject to immunoprecipitation using the Myc epitope-specific monoclonal antibody 9E10, p44-HA-ERK1 can be seen clearly to bind tightly to MKP-3, MKP-3 C293S, and MKP-3
C, while p54-HA-JNK3/SAPK
failed to immunoprecipitate detectably with any of these MKP-3 constructs (Fig. 7). Also consistent with
our previous observations, p44-HA-ERK1 binds tightly and
co-immunoprecipitates with the chimera CB16 (with the MKP-3 N terminus)
despite consistently lower levels of expression with this construct
(Fig. 7). In contrast, p44-HA-ERK1 failed to co-immunoprecipitate
detectably with either M3-6 or the chimera CA8 comprising the M3-6 N
terminus (Fig. 7). Neither M3-6, CB16, or CA8 bind detectably to
p54-SAPK
under identical conditions (Fig. 7).
|
|
To confirm that tight binding between the MKP-3 N terminus and ERK also
parallels specific inactivation of this class of MAP kinase within
intact cells, immune complex assays were performed on p44-HA-ERK1 and
p54-HA-JNK3/SAPK
co-expressed with the same MKP-3 and M3-6
constructs. As we have reported previously (40) MKP-3 co-expression
abolishes EGF-stimulated activation of p44-HA-ERK1 (Fig.
8). In contrast, the catalytically
inactive mutants MKP-3 (C293S) and MKP-3
C fail to inhibit, and
rather augment by 2-3-fold the activation state of p44-HA-ERK1 (Fig.
8). Also as seen before (40), co-expression of M3-6 is completely
unable to suppress EGF-stimulated p44-HA-ERK1, while
anisomycin-dependent stimulation of p54-HA-JNK3/SAPK
is
inhibited by >90% (Fig. 8). It is of note that a truncated version of
this dual specificity phosphatase, M3-6
C (Fig. 6A),
elicits indistinguishable selective inhibition of p54-HA-JNK3/SAPK
(not shown). Dramatically, and in contrast to tight binding of CB16 to
p44-HA-ERK1 (Fig. 7), CB16 is totally ineffective in its ability to
inhibit EGF-stimulated activation of this MAP kinase (Fig. 8). Rather,
as observed with the enzymatically inactive mutants MKP-3 C293S and
MKP-3
C, co-expression of CB16 facilitates p44-HA-ERK1 activation
state by approximately 2-fold (Fig. 8). Importantly, CB16 appears to be
an active enzyme as its co-expression with p54-HA-JNK3/SAPK
results
in an ~80% inhibition of anisomycin-stimulated activity (Fig. 8).
The chimera CB16 therefore retains the enzymatic specificity of its
M3-6 catalytic core despite tight interaction with p44-HA-ERK1. In
contrast to these observations, the chimera CA8 possessing the
catalytic core of MKP-3 and which fails to bind to p44-HA-ERK1 (Fig.
7), mediates complete inactivation of EGF-stimulated activation of this
MAP kinase (Fig. 8). Notably however, and as observed in
vitro using GST-MKP-3
N (Fig. 5), CA8 differs from MKP-3 insofar
that it displays no selectivity for inactivation of p44-HA-ERK1 when
compared with p54-HA-JNK3/SAPK
(Fig.
9). This indicates that binding of the
MKP-3 N terminus to ERK isoforms within intact cells also plays a
critical role in determining specificity for inactivation of this class
of MAP kinase.
|
|
The crystal structure of several PTP family members
(Yersinina PTPase, PTP1B, PTP
) including the
dual-specificity phosphatase VHR have now been solved and, despite
limited primary amino acid sequence homology, all have been shown to
possess a very similar three-dimensional structure within their
catalytic domains (42, 48-52). Based on the crystal structure of VHR,
reliable secondary structure prediction of rVH6 (identical to MKP-3) is
possible and demonstrates that the C-terminal domain (amino acids
134-381) is alone able to form the catalytic core of this dual
specificity phosphatase (41). We have obtained essentially identical
results modeling the primary amino acids 209-348 of MKP-3 on the
crystal structure of VHR using the SWISS MODEL program (53) (not
shown). These secondary structure predictions are also consistent with experimental observations that the MKP-3 C-terminal half displays indistinguishable enzymatic activity to the full-length molecule when
using the artificial substrate p-nitrophenyl phosphate (Fig. 3). What then is the function of the N-terminal noncatalytic halves of
this gene family? Experiments described in this report demonstrate that
one role for the N terminus of MKP-3 is likely to be tight binding to
its substrate MAP kinases p44-ERK1 and p42-ERK2. Tight substrate
binding may ensure highly restricted enzyme action within the
environment of an intact cell. One untested hypothesis is that the
highly divergent N termini of dual specificity phosphatase family
members (39) bind tightly to a distinct set of target substrates.
Interestingly, examination of the gene structures of CL100 and PAC1
indicates that their N termini are encoded by exons 1 and 2 and may
have distinct evolutionary origins to the C-terminal catalytic core
(44, 54, 55). Diverse substrate binding capabilities for this gene
family may therefore have arisen through convergence of gene structures
encoding a limited set of catalytic cores with a more varied range of
N-teminal targeting sequences. The emergence of gene structures for
other dual specificity phosphatase family members will help clarify
this issue.
In summary, these observations demonstrate that MKP-3 binds directly
the MAP kinases ERK1 and ERK2 through its non-catalytic N terminus.
MKP-3 binding displays the rank order p44-ERK1 = p42-ERK2
p38 > p54SAPK
which parallels its enzymatic specificity for MAP kinase inactivation (38, 40). Experiments described in this report
using the MKP-3
N catalytic core as well as with chimeras of MKP-3
and M3-6 indicate that this binding may underlie MKP-3 selectivity for
ERK family MAP kinases. Restricted substrate binding by the
structurally diverse N termini of different dual-specificity phosphatases may provide a general mechanism ensuring enzymatic selectivity for this gene family.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to the following for generous
gifts. J. Pouysségur (CNRS, Nice, France) for pcDNA1-HA-p44
ERK1, J. R. Woodgett (Ontario Cancer Institute, Canada) for
pMT2T-HA-p54-SAPK
, pGEX-SAPK
2 and pGEX-c-Jun-(5-89), J. S. Gutkind (NIDR, National Institutes of Health) for pcDNA3-HA-p38, E. Bettini (Glaxo Wellcome, Verona, Italy) for pGEX-c-Jun-(1-79), L. I. Zon (Harvard Medical School, Boston, MA) for pEBG-SEK1, S. Stimpson (Glaxo Wellcome, Research Triangle Park, NC) for
purified p38 and MKK6 protein, and C. J. Marshall (Chester Beatty
Labs, ICR, London, UK) for pGEX-2T-ERK2, pGEX-3X-MEK-1 (S218E S222E),
pEXV3-Myc-ERK2, and rabbit antibody 122 specific for ERK2. We
also thank Bruno Antonsson for purification of mouse ERK2 and
rabbit MEK-1 EE protein and Chris Hebert for photographic work.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Present address: Dept. of Biological Chemistry, University of Michigan, Ann Arbor, MI 48109.
** To whom correspondence should be addressed: Serono Pharmaceutical Research Institute, CH-1228 Plan-les-Ouates, Geneva, Switzerland, Tel.: 00 41 22 706 98 42; Fax: 00 41 22 794 69 65; E-mail: steve.arkinstall.ch_gva03{at}serono.com
1 The abbreviations used are: ERK, extracellular signal-regulated kinase: MAP kinase, mitogen-activated protein kinase; JNK/SAPK, c-Jun N-terminal kinase/stress-activated protein kinase; MKP, MAP kinase phosphatase; PTP, protein tyrosine phosphatase; GST, glutathione S-transferase; MBP, myelin basic protein; HA, hemagglutinin; EGF, epidermal growth factor.
2 A. Smith and A. Ashworth, manuscript in preparation.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. W. Chan, V. W.S. Liu, G. S.W. Tsao, K.-M. Yao, T. Furukawa, K. K.L. Chan, and H. Y.S. Ngan Loss of MKP3 mediated by oxidative stress enhances tumorigenicity and chemoresistance of ovarian cancer cells Carcinogenesis, September 1, 2008; 29(9): 1742 - 1750. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhao and S. Ding A high-throughput siRNA library screen identifies osteogenic suppressors in human mesenchymal stem cells PNAS, June 5, 2007; 104(23): 9673 - 9678. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Jayakumar, K. S. Panickar, Ch. R. K. Murthy, and M. D. Norenberg Oxidative stress and mitogen-activated protein kinase phosphorylation mediate ammonia-induced cell swelling and glutamate uptake inhibition in cultured astrocytes. J. Neurosci., May 3, 2006; 26(18): 4774 - 4784. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tarrega, P. Rios, R. Cejudo-Marin, C. Blanco-Aparicio, L. van den Berk, J. Schepens, W. Hendriks, L. Tabernero, and R. Pulido ERK2 Shows a Restrictive and Locally Selective Mechanism of Recognition by Its Tyrosine Phosphatase Inactivators Not Shared by Its Activator MEK1 J. Biol. Chem., November 11, 2005; 280(45): 37885 - 37894. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Christie, D. J. Williams, F. MacIsaac, R. J. Dickinson, I. Rosewell, and S. M. Keyse The Dual-Specificity Protein Phosphatase DUSP9/MKP-4 Is Essential for Placental Function but Is Not Required for Normal Embryonic Development Mol. Cell. Biol., September 15, 2005; 25(18): 8323 - 8333. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nazarian, K. Bouri, and E. P. Hoffman Intracellular expression profiling by laser capture microdissection: three novel components of the neuromuscular junction Physiol Genomics, March 21, 2005; 21(1): 70 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. G. Smith, D. Sweetman, M. Patterson, S. M. Keyse, and A. Munsterberg Feedback interactions between MKP3 and ERK MAP kinase control scleraxis expression and the specification of rib progenitors in the developing chick somite Development, March 15, 2005; 132(6): 1305 - 1314. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Marchetti, C. Gimond, J.-C. Chambard, T. Touboul, D. Roux, J. Pouyssegur, and G. Pages Extracellular Signal-Regulated Kinases Phosphorylate Mitogen-Activated Protein Kinase Phosphatase 3/DUSP6 at Serines 159 and 197, Two Sites Critical for Its Proteasomal Degradation Mol. Cell. Biol., January 15, 2005; 25(2): 854 - 864. [Abstract] [Full Text] [PDF] |