![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 16, 9755-9760, April 17, 1998
§,
§,
¶, and
§
From the Cardiovascular Biology Laboratory, The mechanisms by which HMG-I proteins regulate
cell growth are unknown, and their effects on gene expression have only
been partially elucidated. We explored the potential interaction
between HMG-I proteins and serum-response factor (SRF), a member of the MADS-box family of transcription factors. In cotransfection
experiments, HMG-I(Y) potentiated SRF-dependent activation
(by more than 5-fold) of two distinct SRF-responsive promoters,
c-fos and the smooth muscle-specific gene SM22 Serum-response factor
(SRF),1 a member of the
MADS-box family of transcription factors, activates a variety of genes
through binding to the sequence CC(A/T)6GG (the CArG box).
SRF is also an important integrator of intracellular signal
transduction pathways through its interaction with accessory factors
(members of the ets, homeodomain, and zinc finger families)
(1, 2). SRF activates transcription in genes of two classes:
muscle-specific genes (3-5) and immediate-early genes expressed after
serum stimulation (2), of which c-fos is the prototype.
Architectural transcription factors of the HMG-I family are important
in gene expression and growth regulation (6). There are currently three
members: HMG-I, HMG-Y, and HMGI-C. HMG-I (107 amino acids) and HMG-Y
(96 amino acids) derive from alternatively spliced transcripts of the
same gene. Because their biological properties are indistinguishable,
they are referred to as HMG-I(Y). HMGI-C is related to them
structurally but derives from a distinct gene. The HMG-I transcription
factors bind broadly to AT-rich DNA in the minor groove through the
AT-hook peptide motif (7). Although HMG-I proteins have no intrinsic
ability to activate transcription, they regulate the affinity and
activity of other transcription factors by altering local chromatin
structure.
The best example of a regulatory region responsive to HMG-I(Y) is the
HMG-I proteins are thought to play critical roles in cell growth and
transformation. They are expressed at low or undetectable levels in
adult tissues but are expressed highly in embryonic and neoplastic
tissues (17, 18). There are many data in support of a causal role for
HMGI-C in cell growth and transformation. Overexpression of HMGI-C
antisense RNA prevents retrovirally induced transformation (19). Also,
the HMGI-C gene on human chromosome 12q15 is often rearranged in benign
mesenchymal tumors (20, 21). Analysis of some of the chimeric
transcripts resulting from these rearrangements shows that the AT-hook
DNA-binding motifs are fused with a LIM domain in one case and an
acidic transcriptional activator domain in another (20). These chimeric
transcripts probably contribute significantly to the pathobiology of
mesenchymal tumor formation. In addition, targeted disruption of the
HMGI-C gene in mice results in a pygmy phenotype (22). Although these animals develop normally, all their organs are small. Cultured embryonic fibroblasts from the pygmy mice grow much more slowly than
wild-type cells, perhaps because the disruption of the HMGI-C gene
leads to decreased cellular proliferation and premature
differentiation. Because the HMGI-C gene is homologous to the HMG-I(Y)
gene, which has been localized to another locus often rearranged in
benign tumors, human chromosome 6p21 (23), a similar role in growth regulation has been proposed for HMG-I(Y) (20, 21). The mechanism by
which the HMG-I proteins alter growth is not known but presumably involves activation and repression of specific genes.
We have found that the HMG-I proteins are induced dramatically in
proliferating vascular smooth
muscle.2 Because the role of
SRF in cell proliferation and expression of vascular smooth
muscle-specific genes is well established, and its DNA-binding element
(the CArG box) is rich in adenine and thymine residues, we hypothesized
that HMG-I proteins may bind to the CArG box and affect the ability of
SRF to bind to DNA and activate transcription.
We show in this report that HMG-I(Y) enhances SRF-dependent
activation of the c-fos and SM22 Plasmids--
Using rat genomic DNA as a template, we cloned the
rat SM22
Department of Medicine,
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
. This
effect was also observed with a heterologous promoter containing
multiple copies of the CC(A/T)6GG (CArG) box. HMG-I
proteins bound specifically to the CArG boxes of c-fos and
SM22
in gel mobility shift analysis and enhanced binding of SRF to
these CArG boxes. By chelating peptide-immobilized metal affinity
chromatography, we mapped the domain of HMG-I(Y) that interacts with
SRF to amino acids 50-81, a region that does not bind specifically to
DNA in electrophoretic mobility shift assays even though it includes
the third AT-hook DNA-binding domain. Surprisingly, HMG-I(Y) mutants
that failed to bind DNA still enhanced SRF binding to DNA and
SRF-dependent transcription. In contrast, deletion of the
HMG-I(Y) 50-81 domain that bound SRF prevented enhancement of
transcription. To our knowledge, this is the first report of an HMG-I
protein interacting with a MADS-box transcription factor. Our
observations suggest that members of the HMG-I family play an important
role in SRF-dependent transcription and that their effect
is mediated primarily by a protein-protein interaction.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-interferon promoter. HMG-I(Y) binds to the PRDII element of the
promoter and recruits the transcription factor NF-
B (8). HMG-I(Y)
also binds the PRDIV element of the promoter and recruits ATF-2/c-Jun,
producing synergy between the PRDII and PRDIV elements (9). In the
absence of HMG-I(Y) binding, neither NF-
B nor ATF-2 confers viral
inducibility on this promoter. HMG-I(Y) seems to enhance
-interferon
transcription by facilitating formation of a stereospecific complex
referred to as an enhanceosome (10, 11), which reverses an intrinsic
bend in the DNA (12). Other examples of HMG-I(Y)-responsive genes
include the endothelial cell adhesion molecule E-selectin (13), the
chemokine MGSA/GRO
(14), and the IgE locus (15). In the case of the
IgE promoter, HMG-I(Y) represses basal transcription until it is
phosphorylated by an interleukin 4-dependent pathway, which
decreases its affinity for DNA in vitro. Thus, HMG-I(Y) can
be a positive and a negative regulator of transcription. Recently,
HMG-I(Y) has been shown to repress the T cell-receptor gene enhancer by
influencing DNA topology (16).
promoters in eukaryotic
cells, an effect that is also observed for a heterologous promoter
containing a CArG box. HMG-I(Y) binds specifically to the CArG box and
enhances binding of SRF in vitro, and the SRF-interacting
domain maps to HMG-I(Y) amino acids 50-81. Surprisingly, mutations
that interfere with DNA binding by HMG-I(Y) but preserve its
interaction with SRF retain the ability to enhance binding of SRF to
DNA in vitro and augment SRF-dependent
transcription in vivo.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
promoter by amplifying nucleotides
1507 to +32 by the
polymerase chain reaction (PCR). The PCR fragment was then inserted
into the XhoI site of pGL2-Basic (Promega). Nucleotides
711 to +97 of the human c-fos promoter were amplified by
PCR from pF4 (24) and inserted into the XhoI and
HindIII sites of pGL2-Basic. A DNA fragment containing a
single copy of the proximal SM22
CArG box
(5'AATTCACTTGGTGTCTTTCCCCAAATATGGAGCCTGTGTGGAGTGGTCGA-3') was cloned into the EcoRI and SalI sites of
the yeast reporter vector pLacZi (CLONTECH). A
yeast reporter plasmid containing three copies of the CArG box
(pCArG3LacZi) was constructed from pCArGLacZi by cloning
two additional copies of a DNA fragment encoding the SM22
CArG box
(5'-AATTCACTTGGTGTCTTTCCCCAAATATGGAGCCTGTGTGGAGTAATT-3') into the
EcoRI site by standard methods (25).
Protein Expression and Purification--
The prokaryotic
expression plasmids pRSETHMG-I(Y),
pRSETHMGI-(Y)1-81, pRSETHMG-I(Y)1-45,
pRSETHMG-I(Y)50-96, pRSETHMG-I(Y)50-81,
and pRSETSRF, each encoding a vector-derived polyhistidine tag and an
enterokinase cleavage site in addition to the cloned insert protein,
were transferred into the protease-deficient E. coli strain
BL21(DE3)pLysS. Expression was induced in 500-ml cultures (mid-log
phase) by the addition of isopropyl
-D-thiogalactopyranoside to 1 mM. Three h
after induction, the bacterial cells were lysed and purified by cobalt
affinity chromatography under denaturing conditions according to the
instructions of the manufacturer (CLONTECH). Proteins were renatured by dialysis overnight against 20 mM
HEPES (pH 7.8), 20 mM KCl, and 0.2% Tween 20 at 4 °C.
The dialysate was stored in 50-µl aliquots at
80 °C.
Electrophoretic Mobility Shift Assays--
Annealed
oligonucleotides for the SM22
CArG box (described above) and the
c-fos serum response element CArG box
(5'-GTACCGGATGTCCATATTAGGACATCT-3' and
5'-GTACAGATGTCCTAATATGGACATCCG-3') were end-labeled with T4 polynucleotide kinase. Approximately 35 fmol of labeled DNA was used in
each binding reaction. Binding reactions were performed in 10 mM Tris (pH 7.5), 50 mM KCl, 50 ng of
poly(dG-dC), 1 mM dithiothreitol, 5% glycerol, and 250 mg/ml acetylated bovine serum albumin for 20 min at room temperature in
a total volume of 20 µl. The DNA-protein complexes were then loaded
onto chilled 4% polyacrylamide gels. Gel electrophoresis (15 V/cm) was
performed in 0.25 × Tris borate-EDTA at 4 °C.
Cell Culture, Transfections, Yeast Strains, and Reporter
Assays--
Drosophila SL2 cells were cultured and transfected
essentially as described (10). In brief, SL2 cells were transfected by the calcium phosphate method on 6-well trays at approximately 50%
confluence with plasmids encoding proteins as outlined in Figs.
1A and 5. Plasmid phsp82LacZ (100 ng), which encodes
-galactosidase transcribed from a Drosophila heat shock promoter,
was cotransfected in all experiments to correct for differences in
transfection efficiency. The ratio of luciferase to
-galactosidase
from each plasmid was calculated and expressed as relative luciferase
activity, with the value for pPAC set arbitrarily at 1. The yeast
strain MCY-1, a derivative of EGY48 (29), was created by transforming EGY48 with the integrating vector pCArG3LacZi. The cells
were transformed by the lithium acetate procedure as described (30). Luciferase and
-galactosidase assays on transfected SL2 cell lysates
were performed as described (31). Yeast
-galactosidase assays were
also performed as described (32).
Chelating Peptide-immobilized Metal Affinity Chromatography (CP-IMAC)-- CP-IMAC was performed as described (33), with some modification. In brief, [35S]methionine-labeled SRF was prepared from pcDNA3SRF with an in vitro transcription/translation kit according to the instructions of the manufacturer (Promega). A 20-µl bed volume of cobalt affinity resin (CLONTECH) was equilibrated in a 1.7 ml microcentrifuge tube with 500 µl of ice-cold binding buffer (10 mM Tris-HCl (pH 8.0), 50 mM NaPO4 (pH 8.0), and 100 mM NaCl). The resin was collected by centrifugation (14000 × g, 1 min) and washed with an additional 500 µl of binding buffer. After a second centrifugation, the resin was resuspended in 100 µl of binding buffer with 1 µg of recombinant histidine-tagged protein and 1 µl of [35S]methionine-labeled SRF. The mixture was incubated at 4 °C for 2 h with rotary shaking. The resin was then washed three times with 1 ml of ice-cold binding buffer and collected by centrifugation as above. Bound protein was eluted with 20 µl of 100 mM EDTA and analyzed on 10% Tricine-SDS gels as described (34).
| |
RESULTS |
|---|
|
|
|---|
HMG-I(Y) Enhances SRF-dependent Transcriptional
Activation in Eukaryotic Cells--
Given that the HMG-I proteins bind
to AT-rich sequences and enhance transcription by recruiting other
factors, we tested the hypothesis that HMG-I(Y) might bind CArG boxes
and enhance SRF-dependent transcription. Transient
transfection assays were performed in Drosophila SL2 cells
because they do not express high levels of SRF or HMG-I(Y) and are thus
ideally suited for studying the effects of these proteins on
transcription (10, 26). Transfection of the pPAC, HMG-I(Y), or SRF
expression plasmid alone had little effect on the activity of the
SM22
promoter (Fig. 1A).
Transfection of the SRF and the HMG-I(Y) expression plasmids together,
however, increased SM22
promoter activity by ~20-fold. HMG-I(Y)
and SRF had a similar synergistic effect on the c-fos
promoter (Fig. 1A).
|
CArG box into a yeast
-galactosidase expression vector and created a stable yeast strain
with this construct integrated into the genome. This approach would
also reveal whether the HMG-I proteins affected genetic signals
incorporated into genomic chromatin. Neither HMG-I(Y) nor HMGI-C had
any effect on
-galactosidase expression (Fig. 1B). SRF
alone also had no significant effect in yeast (Fig. 1B), consistent with data published elsewhere (35). When HMG-I(Y) or HMGI-C
was coexpressed with SRF,
-galactosidase expression increased by
~15-fold (Fig. 1B). These results indicate that HMG-I proteins activate transcription by interacting with SRF through the
CArG box.
HMG-I(Y) Binds Specifically to the CArG Boxes of SM22
and
c-fos--
As a preliminary exploration of how HMG-I proteins enhance
SRF-dependent transcription, we determined whether HMG-I
proteins bound specifically to SRF-binding sites through their AT-rich consensus sequence. Recombinant polyhistidine-tagged HMG-I(Y) and
HMGI-C were expressed in E. coli, purified by cobalt
affinity chromatography, and used in electrophoretic mobility shift
assays. A DNA-protein complex formed when HMG-I(Y) was incubated with a
labeled, SM22
CArG box probe (Fig. 2,
left panel, arrow). The binding was specific because a
500-fold molar excess of unlabeled oligonucleotide probe encoding the
SM22
CArG box or the c-fos CArG box, but not one encoding
an unrelated sequence, competed for HMG-I(Y) binding. Results from a
similar analysis with a labeled c-fos CArG box probe were
identical (Fig. 2, right panel). Results obtained with
recombinant HMGI-C were similar (data not shown).
|
HMG-I(Y) Enhances Binding of SRF to the CArG Box--
To explore
the functional significance of HMG-I(Y) binding to the CArG box, we
investigated the effect of HMG-I(Y) on the binding of SRF.
Electrophoretic mobility shift assays were performed with increasing
amounts of purified, recombinant polyhistidine-tagged SRF in the
presence or absence of HMG-I(Y). SRF binding to the c-fos
CArG box probe resulted in a slowly migrating DNA-protein complex (Fig.
3), whereas HMG-I(Y) binding produced a
more rapidly migrating complex. In the presence of HMG-I(Y), SRF
binding increased markedly. The presence of SRF in the slowly migrating
complex was verified by its supershifting in the presence of anti-SRF antibody (Fig. 3, last lane). Similar results were obtained
with an SM22
CArG box probe and with recombinant HMGI-C (data not shown). These results suggest an important role for HMG-I proteins in
enhancing the binding of SRF to DNA and promoting the assembly of
DNA-protein complexes.
|
HMG-I(Y) Interacts with SRF in the Absence of DNA through HMG-I(Y) Amino Acids 50-81-- We determined whether HMG-I(Y) interacted with SRF in the absence of DNA and identified the HMG-I(Y) domain required for this interaction by a CP-IMAC method (33). In this experiment (summarized in Fig. 4A), recombinant polyhistidine-tagged mutant and wild-type HMG-I(Y) proteins were incubated in the presence of a cobalt-Sepharose resin with radiolabeled, in vitro translated SRF. Because proteins that interacted with labeled SRF would retain SRF on the resin, labeled SRF would appear on the protein gel after elution from the resin. Deletion of HMG-I(Y) C-terminal amino acids 82-96 (containing the acidic domain) had no effect on its interaction with SRF (Fig. 4B, lane 1-96 versus lane 1-81). Further deletion to amino acid 45, however, abolished the ability of HMG-I(Y) to retain SRF on the resin (Fig. 4B, lane 1-81 versus lane 1-45). Because deletion of amino-terminal residues 1-50 also had no effect on the interaction with SRF (Fig. 4B, lane 50-96), the region of HMG-I(Y) required for SRF binding appeared to map to amino acids 50-81. Indeed, this position was confirmed by lane 50-81 of Fig. 4B, which shows that this domain of HMG-I(Y) interacts directly with SRF.
|
Enhancement of SRF Binding Does Not Require HMG-I(Y) Binding to
DNA--
To see if HMG-I(Y) had to bind to DNA to augment SRF binding,
we used the mutant HMG-I(Y) proteins shown in Fig. 4A in
electrophoretic mobility shift assays with the c-fos CArG
box probe. Consistent with our data shown in Fig. 3, wild-type HMG-I(Y)
bound to DNA and augmented SRF binding (Fig. 4C, lane
1-96). Similar results were obtained for
HMG-I(Y)1-81 (data not shown).
HMG-I(Y)50-96, HMG-I(Y)50-81, and
HMG-I(Y)1-45 did not bind DNA (Fig. 4C,
SRF
lanes), consistent with results published by others
(36). Surprisingly, HMG-I(Y)50-96 and
HMG-I(Y)50-81 were able to enhance binding of SRF to the
CArG box despite their inability to bind DNA (Fig. 4C,
SRF+ lanes). Because the effect of HMG-I(Y) on SRF was
independent of DNA binding, it probably involved protein-protein interactions.
HMG-I(Y) Binding to DNA Is Not Required for Enhancement of SRF-dependent Transcription-- Because HMG-I(Y)50-96 augmented SRF binding in the absence of DNA binding, we studied its effect on SRF-dependent transcription. HMG-I(Y)50-96, HMG-I(Y)1-81, and HMG-I(Y)1-45 were cloned into the Drosophila expression vector pPAC (27). The activity of HMG-I(Y)1-81 was similar to that of the wild-type protein (Fig. 5), a result consistent with the ability of HMG-I(Y)1-81 to bind SRF and enhance SRF binding to DNA in vitro (Figs. 3 and 4, B and C, and data not shown). HMG-I(Y)1-45, a protein unable to interact with SRF or enhance SRF binding to DNA in vitro, had no significant activity. In contrast, HMG-I(Y)50-96, which does not bind DNA but clearly enhances SRF binding to DNA in vitro, was able to stimulate SRF-dependent transcription to a level 10-fold above base line (Fig. 5). These data indicate that the effect of HMG-I(Y) on SRF-dependent transcription is independent of the ability of HMG-I(Y) to bind DNA.
|
| |
DISCUSSION |
|---|
|
|
|---|
Little is known about the mechanisms by which HMG-I proteins affect cell growth and differentiation. In contrast, SRF is known to regulate a number of immediate-early genes, such as c-fos, thought to be important in cell proliferation. The presence of an AT-rich core within the SRF-binding site (a CArG box) led us to hypothesize that the HMG-I proteins and SRF may interact at this element.
We found that HMG-I(Y) facilitates activation of the c-fos promoter by SRF (Fig. 1A) and that transcriptional activation by HMG-I(Y) could be mediated by the CArG box alone when it was linked to a heterologous promoter in the context of genomic chromatin (Fig. 1B). Our findings are consistent with previous reports that HMG-I(Y) itself does not have an intrinsic ability to activate promoters but that it can alter chromatin structure and regulate the activity of other transcription factors (12). Our findings suggest that HMG-I proteins may be involved in the regulation of a variety of SRF-responsive genes. The recent observation that expression of junB, an SRF-responsive gene, is essential for neoplastic transformation in rat thyroid cells, and that it requires concurrent expression of HMGI-C (37), is consistent with our data. Our findings also suggest a potential mechanism by which HMG-I proteins interact with SRF and participate in the regulation of growth-related genes. To our knowledge, this is the first description of an interaction between a MADS-box transcription factor such as SRF and the HMG-I proteins. Given that the MADS-box protein MEF2 also has AT-rich recognition sequences, our results raise the possibility that HMG-I proteins may interact with other members of the MADS-box transcription factor family to regulate their function.
SRF and the CArG box have also been implicated in the regulation of
muscle-specific gene expression (4, 38-41). Therefore, by interacting
with SRF, HMG-I proteins may play a role in muscle-specific gene
regulation as well. This speculation is supported by our finding that
HMG-I(Y) markedly enhances the SRF-induced promoter activity of
SM22
, a smooth muscle-specific gene (Fig. 1A). The biological significance of this effect remains to be elucidated. One
possibility, currently being explored, is that the effect of HMG-I(Y)
proteins on smooth muscle may be important after hypertrophic stimuli.
To understand the mechanism by which HMG-I proteins enhance SRF-dependent transcription, we analyzed the binding of HMG-I proteins to the CArG box and assessed their effect on SRF binding to DNA. As expected, given its preference for AT-rich DNA, HMG-I(Y) binds to CArG boxes specifically (Fig. 2). Also, SRF binding to the CArG box is enhanced dramatically in the presence of HMG-I(Y) (Fig. 3). Although little change was seen in the mobility of the SRF-containing complex generated in the presence of HMG-I(Y), this was probably due to the low molecular weight of HMG-I(Y) relative to SRF and to the marked change in DNA conformation already induced in the presence of SRF (42). The sharp bend in the DNA induced by SRF binding alters electrophoretic mobility markedly so that an additional effect of HMG-I(Y) may not be apparent.
By a CP-IMAC assay, we found that HMG-I(Y) and SRF interact in the absence of DNA (Fig. 4B). Mutational analysis indicated that the region of interaction comprises amino acids 50-81, an area surrounding the third AT-hook domain. It has been shown that HMG-I(Y) amino acids 46-56 contain the domain that binds Oct-6, a POU-domain transcription factor (43). We do not know whether the Oct-6 and SRF interaction domains are distinct, and we know little about the region of HMG-I(Y) required for binding to other transcription factors. Computer data base searching with the BLAST algorithm (44) revealed no significant homology between this peptide interaction domain and a domain in any protein other than HMG-I(Y). Fig. 1B shows that the effect of wild-type HMGI-C on SRF is similar to that of HMG-I(Y). Other than the AT hooks in this region, however, these two proteins share little homology. This lack of homology raises the possibility that the effect of HMGI-C involves a different domain.
Our results from in vitro binding studies of wild-type
HMG-I(Y) and SRF are consistent with results from transfection assays; however, the results from the former are somewhat surprising given that
each protein is expected to bind in the minor groove (7, 42). We found
that mutations that removed the first and second or second and third
AT-hook domains block DNA binding (Fig. 4), consistent with published
findings that the second AT-hook domain is important for
sequence-specific binding (36). HMG-I(Y)50-96 and
HMG-I(Y)50-81 are not able to bind DNA in electrophoretic mobility shift assays, although they are able to enhance the binding of
SRF to DNA, at a level similar to that obtained with wild-type HMG-I(Y). This observation is in contrast to those obtained in other
studies which show that DNA binding by HMG-I(Y) is critical to
enhancement of Oct-6 binding to the JC virus promoter (43) and
activation of the
-interferon promoter by NF-
B (36). One explanation for our observations is that the interaction of HMG-I(Y) with SRF induces a conformational change in SRF that enhances its
ability to bind to DNA. Further studies will be necessary to test this
hypothesis.
Although our data (Fig. 4) and data reported by Yie et al. (36) indicate that the third AT hook does not bind specifically to DNA in gel mobility shift assays, it remains possible that the third AT-hook domain present in their and our HMG-I(Y) mutants may bind DNA in vivo. In a recent NMR study, Huth et al. (45) show that the third AT hook makes specific contacts with DNA when bound as part of a molecule containing the second AT hook. A previous NMR study also showed that a peptide containing the core AT-hook motif PRGRP binds specifically to the minor groove of AT-rich DNA, but with low affinity (46).
In the transient transfection analysis (Fig. 5), all mutations that
preserve the interaction with SRF in vitro enhance
SRF-dependent transcription in vivo.
HMG-I(Y)50-96, which does not bind DNA, still augments
transcription though to a lesser degree than does wild-type HMG-I(Y).
The reasons for the slight disparity between these in vivo
data and the in vitro electrophoretic mobility shift assay
data are not clear. It is worthy of note that deletion of the
C-terminal acidic tail (Figs. 4A and 5) does not affect the
ability of HMG-I(Y) to enhance SRF-dependent transcription. Our results are in contrast with results from studies by others on the
-interferon gene, in which the acidic tail of HMG-I(Y) was shown to
be necessary for NF-
B coactivation (36). These divergent findings
underscore the distinct mechanisms by which HMG-I(Y) potentiates SRF
versus NF-kB activity.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Edgar Haber for support of this work. We thank Matthew Layne and Chung-Ming Hsieh for many useful comments and suggestions, Thomas McVarish for editorial support, and Bonna Ith for expert technical assistance. We thank Raymond Reeves for the mouse HMG-Y cDNA, Alfredo Fusco for the mouse HMGI-C cDNA, Tom Maniatis for the Drosophila expression plasmids pPACHMGI, pPAC, and phsp82LacZ, and Michael Gilman for the human SRF cDNA. We also thank Cheeptip Benyajati for the Drosophila SL2 cells.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grants HL03745 (to M. T. C.), HL03194 (to M. A. P.), and GM53249 and HL57977 (to M.-E. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Cardiovascular
Biology Laboratory, Harvard School of Public Health, 677 Huntington Ave., Boston, MA 02115. Tel.: 617-432-4994; Fax: 617-432-0031.
1 The abbreviations used are: SRF, serum-response factor; CArG box, the sequence CC(A/T)6GG; PCR, polymerase chain reaction; CP-IMAC, chelating peptide-immobilized metal affinity chromatography; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.
2 M. T. Chin and M.-E. Lee, manuscript in preparation.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. L. Kopp, P. J. Wilder, M. Desler, L. Kinarsky, and A. Rizzino Different Domains of the Transcription Factor ELF3 Are Required in a Promoter-specific Manner and Multiple Domains Control Its Binding to DNA J. Biol. Chem., February 2, 2007; 282(5): 3027 - 3041. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Herring, O. El-Mounayri, P. J. Gallagher, F. Yin, and J. Zhou Regulation of myosin light chain kinase and telokin expression in smooth muscle tissues Am J Physiol Cell Physiol, November 1, 2006; 291(5): C817 - C827. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Komura and T. Ono Disappearance of Nucleosome Positioning in Mitotic Chromatin in Vivo J. Biol. Chem., April 15, 2005; 280(15): 14530 - 14535. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. P. Mohammad, D. D. Seachrist, C. C. Quirk, and J. H. Nilson Reexpression of p8 Contributes to Tumorigenic Properties of Pituitary Cells and Appears in a Subset of Prolactinomas in Transgenic Mice that Hypersecrete Luteinizing Hormone Mol. Endocrinol., October 1, 2004; 18(10): 2583 - 2593. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Torrungruang, M. Alvarez, R. Shah, J. E. Onyia, S. J. Rhodes, and J. P. Bidwell DNA Binding and Gene Activation Properties of the Nmp4 Nuclear Matrix Transcription Factors J. Biol. Chem., May 3, 2002; 277(18): 16153 - 16159. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Reeves, D. D. Edberg, and Y. Li Architectural Transcription Factor HMGI(Y) Promotes Tumor Progression and Mesenchymal Transition of Human Epithelial Cells Mol. Cell. Biol., January 15, 2001; 21(2): 575 - 594. [Abstract] [Full Text] |
||||
![]() |
A. Henderson, M. Bunce, N. Siddon, R. Reeves, and D. J. Tremethick High-Mobility-Group Protein I Can Modulate Binding of Transcription Factors to the U5 Region of the Human Immunodeficiency Virus Type 1 Proviral Promoter J. Virol., November 15, 2000; 74(22): 10523 - 10534. [Abstract] [Full Text] |
||||
![]() |
A. M. Mikheev, S. A. Mikheev, Y. Zhang, R. Aebersold, and H. Zarbl CArG binding factor A (CBF-A) is involved in transcriptional regulation of the rat Ha-ras promoter Nucleic Acids Res., October 1, 2000; 28(19): 3762 - 3770. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Reeves, W. J. Leonard, and M. S. Nissen Binding of HMG-I(Y) Imparts Architectural Specificity to a Positioned Nucleosome on the Promoter of the Human Interleukin-2 Receptor alpha Gene Mol. Cell. Biol., July 1, 2000; 20(13): 4666 - 4679. [Abstract] [Full Text] |
||||
![]() |
R. Bagga, S. Michalowski, R. Sabnis, J. D. Griffith, and B. M. Emerson HMG I/Y regulates long-range enhancer-dependent transcription on DNA and chromatin by changes in DNA topology Nucleic Acids Res., July 1, 2000; 28(13): 2541 - 2550. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Chin, K. Maemura, S. Fukumoto, M. K. Jain, M. D. Layne, M. Watanabe, C.-M. Hsieh, and M.-E. Lee Cardiovascular Basic Helix Loop Helix Factor 1, a Novel Transcriptional Repressor Expressed Preferentially in the Developing and Adult Cardiovascular System J. Biol. Chem., February 25, 2000; 275(9): 6381 - 6387. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. FOSTER, P. WIESEL, G. S. HUGGINS, R. PAÑARES, M. T. CHIN, A. PELLACANI, and M. A. PERRELLA Role of activating protein-1 and high mobility group-I(Y) protein in the induction of CD44 gene expression by interleukin-1{beta} in vascular smooth muscle cells FASEB J, February 1, 2000; 14(2): 368 - 378. [Abstract] [Full Text] |
||||
|
|