JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoffmeyer, A.
Right arrow Articles by Rapp, U. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoffmeyer, A.
Right arrow Articles by Rapp, U. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 17, 10112-10119, April 24, 1998

The GABP-responsive Element of the Interleukin-2 Enhancer Is Regulated by JNK/SAPK-activating Pathways in T Lymphocytes*

Angelika HoffmeyerDagger §, Andris Avots, Egbert FloryDagger , Christoph K. WeberDagger , Edgar Serfling, and Ulf R. RappDagger par

From Dagger  Institut für Medizinische Strahlenkunde und Zellforschung (MSZ), Universität Würzburg, Versbacher Strasse 5, D-97078 Würzburg, Germany and  Institut für Pathologie, Universität Würzburg, Joseph-Schneider-Strasse 2, D-97080 Würzburg, Germany

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

T cell activation leads via multiple intracellular signaling pathways to rapid induction of interleukin-2 (IL-2) expression, which can be mimicked by costimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA) and ionomycin. We have identified a distal IL-2 enhancer regulated by the Raf-MEK-ERK signaling pathway, which can be induced by TPA/ionomycin treatment. It contains a dyad symmetry element (DSE) controlled by the Ets-like transcription factor GA-binding protein (GABP), a target of activated ERK. TPA/ionomycin treatment of T cells stimulates both mitogen-activated ERK, as well as the stress-activated mitogen-activated protein kinase family members JNK/SAPK and p38. In this study, we investigated the contribution of the stress-activated pathways to the induction of the distal IL-2 enhancer. We show that JNK- but not p38-activating pathways regulate the DSE activity. Furthermore, the JNK/SAPK signaling pathway cooperates with the Raf-MEK-ERK cascade in TPA/ionomycin-induced DSE activity. In T cells, overexpression of SPRK/MLK3, an activator of JNK/SAPK, strongly induces DSE-dependent transcription and dominant negative kinases of SEK and SAPK impair TPA/ionomycin-induced DSE activity. Blocking both ERK and JNK/SAPK pathways abolishes the DSE induction. The inducibility of the DSE is strongly dependent on the Ets-core motifs, which are bound by GABP. Both subunits of GABP are phosphorylated upon JNK activation in vivo and three different isoforms of JNK/SAPK, but not p38, in vitro. Our data suggest that GABP is targeted by signaling events from both ERK and JNK/SAPK pathways. GABP therefore is a candidate for signal integration and regulation of IL-2 transcription in T lymphocytes.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

T cell activation requires at least two signals mediated by T cell receptor-CD3 complex and a costimulatory signal such as ligand binding to CD28 (reviewed by Cantrell (1)). This costimulation can be mimicked by phorbolester and calcium ionophore and results in rapid increase of free intracellular calcium ions, activation of mitogen-activated protein kinase (MAPK)1 cascades, and subsequent induction of IL-2 expression (1). Several lines of evidence support the hypothesis that activation of MAPK family members ERK (extracellular signal regulated kinase) and JNK (c-Jun-N-terminal kinase) play an important role in T cell activation and IL-2 expression (2-8).

The ERK-activating pathway also designated Raf-MEK-ERK cascade involves Raf activation at the plasma membrane, leading to subsequent phosphorylation and activation of the dual specificity kinase MEK (MAPK/ERK kinase), which in turn activates ERK (9, 10). JNK/SAPK (stress-activated protein kinase) (11, 12) is triggered by MKK7 (MAP kinase kinase 7) (13, 14) or SEK/MKK4 (SAPK-ERK kinase) (15, 16). Multiple upstream activators of SEK have been described, including SPRK/MLK3 (SH3-domain-containing proline-rich kinase/mixed-lineage kinase 3) (17). JNK activation in T cells presumably contributes to proliferation (2), whereas in other cell types it may be involved in differentiation (18) or proapoptotic processes (19). Another signaling cascade leads to activation of a third member of the MAPK family, p38 (20). MKK6 (MAP kinase kinase 6) has been identified as the physiological p38 activator (21). JNK- and p38-activating pathways are strongly triggered by inflammatory cytokines (TNF-alpha , IL-1), UV radiation, and chemical stress inducers such as arsenite and anisomycin, indicating a role in cellular stress response (22). However, a recent report describes an involvement of p38 in IL-2- and IL-7-induced T cell proliferation (23).

For each MAPK, many substrates have been identified including kinases such as MAPKAPK-2, -3pK, and diverse transcription factors (22) mediating signals of kinase cascades into changed gene expression. Several members of the Ets family of transcription factors have been characterized as targets for MAPKs, including Elk-1 (24-26), Sap-1a and Sap-2 (27, 28), PEA3 (29), ERM (30), ER81 (31), ERF (32), Ets1 (33), and Yan and Pointed-P2 (34). In addition, the Ets-related transcription factor, GA-binding protein (GABP), is phosphorylated by ERK controlling the Raf-responsive element of the HIV-1 promoter (35). GABP, consisting of two subunits, was originally identified as a protein complex that binds to a purine-rich hexanucleotide 5'-CGGAAR-3' within the ICP4 promoter of Herpes simplex virus 1 (36, 37).

Recently, we have identified another GABP response element within a distal IL-2 enhancer and observed increased IL-2 promoter/enhancer activity when GABP was overexpressed (38). The IL-2 gene transcription is tightly regulated and occurs only when T cells are activated via the TCR complex and a costimulatory signal (39). The IL-2 promoter/enhancer contains several binding sites for transcription factors regulated by multiple signaling events. The combined NFAT-AP1 sites in the 320-base pair minimal promoter/enhancer region play a crucial role in the integration of different signaling cascades (39). However, upstream DNA sequences from position -321 to approximately -600 of the IL-2 gene that are highly conserved between mouse and man are shown to enhance the promoter activity (40). We have identified an inducible enhancer element spanning the region from position -502 to -413 relative to the transcriptional start site. Within the distal enhancer, the GABP binding site consists of two palindromic Ets-related elements (EREs) and were designated dyad symmetry element (DSE) (38). We observed a potentiated transcriptional activity of the DSE after costimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA) and ionomycin (TPA/ionomycin) of T cells as well as by overexpression of Ras, c-Raf, and ERK in combination with TPA stimulation (38). As TPA/ionomycin is known to also activate stress-activated protein kinase JNK/SAPK in T cells (2), we investigated whether stress-activated MAPKs contribute to DSE activity in T cells.

Here, we report that overexpression of SPRK/MLK3, an activator of SEK-JNK/SAPK cascade, strongly induces DSE activity. The SEK-SAPK cascade partially mediates induced DSE-dependent transcription, and it cooperates with the Raf-MEK-ERK cascade in TPA/ionomycin-induced DSE activity. The DSE activity is strongly dependent on the Ets-core motifs, which are bound by GABP. Both subunits of GABP are phosphorylated upon JNK activation in vivo and three different isoforms of JNK/SAPK in vitro. These data suggest that JNK/SAPK and ERK activation converge on GABP to regulate DSE activity.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell Lines and Antibodies-- A3.01 human T lymphoma cells were grown in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS) to a density of 8 × 105 cells/ml. The human embryonic kidney cell line HEK293 and murine fibroblast cell line NIH-3T3 were cultured in DMEM medium supplemented with 10% FCS. Cells were incubated at 37 °C in humidified air with 7% CO2. Antibodies raised against ERK2 (sc-154), JNK1 (sc-474), p38 (sc-535), and Flag-tag (sc-807) were purchased from Santa Cruz Biotechnology, Inc. Antibodies against GABP-alpha , GABP-beta , and GST were obtained from rabbits immunized with corresponding bacterially expressed and purified proteins. The monoclonal antibodies against HA-tag (12CA5) were produced and purified according to standard protocol.

DNA Constructs and Cloning-- The Herpes simplex virus thymidine kinase minimal promoter (-105/+5) alone or downstream of four copies of DSE wild type or mutant (described previously in Avots et al. (38)) were cloned into pGL3 basic luciferase expression vector (Promega). The mutant DSE has both G nucleotides of both Ets-core motifs replaced by two C nucleotides: DSE (wild type), -462 TTCTGAAACAGGAAACCAATACACTTCCTGTTTAATCAA -424; and DSE (mutant), -462 TTCTGAAACACCAAACCAATACACTTGGTGTTTAATCAA -424.

Eukaryotic expression vector pEBG-SAPKbeta and pEBG-SEK1 as well as prokaryotic expression vectors pGEX-KG-SAPKalpha I and pGEX-KG-c-Jun(1-135) were gifts from J. Kyriakis and L. Zon. The pCDNA3-flag-p38 vector is described by Han et al. (41). The expression vectors pRSPA-GABP-alpha and pRSPA-GABP-beta were described earlier (35).

Raf-BXB-CX (containing the C-terminal, membrane-targeting 17 aa of ki-Ras fused to the kinase domain of c-Raf) was created by fusing the C-terminal part of BXB-CAAX to HA-BXB using the endogenous BglII restriction site. Creation of hemagglutinin-tagged BXB and BXB-CAAX was described previously (42, 43). The cDNA of Raf-BXB-CX as well as the cDNAs for SPRK/MLK3 (provided by K. Gallo and P. Godowski), MKK6 (A), MKK6 (EE) (21), SAPKbeta (K-R) (44), ERK2 mutants (ERK-C3 and ERK-B3) (45), and HA-ERK1 were subcloned into the multiple cloning site of pRSPA vector. pRSPA is an expression vector with the Rous sarcoma virus promoter and simian virus 40 polyadenylation signal in a Bluescript backbone (46). MKK6 (EE) is a constitutively active mutant of MKK6 of which two activating phosphorylation sites were replaced by glutamic acid (21). ERK-C3 mutant is inactivated by exchange of the tyrosine in the TEY motif to phenylalanine (45), whereas the other interfering mutants are ATP-binding site mutants generated by replacement of lysine to arginine (ERK-B3, SAPKbeta (K-R), SEK1 (K-R)) or to alanine (MKK6 (A)) (21, 44, 45). All mutants were tested in transient transfection assays and immune complex kinase assays for their inhibiting or activating effects.

Transient Transfections, Metabolic Labeling, and Reporter Gene Assays-- NIH-3T3 cells were seeded at 7 × 104 cells per well of a 6-well plate and grown for 24 h prior to transfection. HEK-293 cells were seeded at 7 × 105 cells per 10-cm-diameter dish and grown for 24 h prior to transfection. Transfections were performed by a calcium phosphate coprecipitation method using up to 15 µg of vector DNA according to a modified Stratagene transfection protocol. Cells were starved in DMEM containing 0.3% FCS 48 h before stimulation or metabolic labeling. For radiolabeling, cells were washed twice with phosphate-free DMEM and starved 2 h for phosphate. The concentration of [32P]phosphate added to the medium was 500 µCi/ml. At the end of the 2-h-labeling period, cells were washed twice with phosphate-buffered saline and then immediately lysed in RIPA buffer (25 mM Tris-HCl (pH 8), 137 mM NaCl, 10% glycerol, 0.1% SDS, 0.5% deoxycholate, 1% Nonidet P-40, 2 mM EDTA, 1 mM Pefabloc, 1 mM sodium orthovanadate, 5 mM benzamidine, 5 µg/ml aprotinin, 5 µg/ml leupeptin). Stimulation of HEK-293 cells was done with 10% FCS, 100 ng/ml TPA (Sigma), or 10 µg/ml anisomycin (Sigma) for indicated times.

A3.01 cells were split 4 × 105 cells/ml 1 day before transfection. A DMRIETM-C-based transfection protocol was used according to manufacturer's instructions (Life Technologies, Inc.). Cells were seeded in 6-well plates 7 × 105 cells/well in 1.5 ml of Opti-MEM (Life Technologies, Inc.) containing 3 µl of DMRIE and up to 3 µg of vector DNA. Transfections for luciferase assays were performed with 0.6 µg of reporter construct plus 2 µg of pRSPA containing diverse cDNAs. Unless otherwise indicated, 24 h after transfection, cells of each well were harvested in 100 µl lysis buffer (50 mM Na-MES, pH 7.8, 50 mM Tris-HCl, pH 7.8, 10 mM dithiothreitol, 2% Triton X-100). The crude cell lysates were cleared by centrifugation, and 50 µl of precleared cell extracts were added to 50 µl of luciferase assay buffer (125 mM Na-MES, pH 7.8, 125 mM Tris-HCl, pH 7.8, 25 mM Mg-acetate, 2 mg/ml ATP). Immediately after injection of 50 µl of 1 mM D-luciferin (AppliChem) into each sample, the luminescence was measured for 5 s in a luminometer (Berthold). The luciferase activities were normalized on the basis of beta -galactosidase activity of cotransfected RSV-beta -gal vector and protein content. The beta -galactosidase assay was performed with 20 µl of precleared cell lysate according to a standard protocol (47). Mean and standard deviations of at least three independent experiments each done in duplicates or triplicates are shown in the figures.

A3.01 cells were stimulated with 10 ng/ml TPA or 0.5 µM ionomycin (Sigma) for 24 h unless otherwise indicated. The MEK specific inhibitor, PD098059 (Calbiochem), was used in a 30 µM concentration of a 15 mM stock solution in Me2SO. The p38-specific inhibitor, SB203580 (Calbiochem), was used at a concentration of 2 µM of a 20 mM stock solution in Me2SO. Cells were preincubated with either inhibitor 20 min before stimulation.

Immunoprecipitation, Kinase Assay, and Immunoblotting-- Cells were lysed in RIPA buffer (described above), and cell debris was removed by centrifugation. Supernatants were incubated with different antisera for 2 h at 4 °C. The immune complexes were precipitated with protein-A agarose (Boehringer) and washed twice with high-salt RIPA buffer containing 500 mM NaCl. Immune complexes were either resuspended in electrophoresis sample buffer or used for in vitro kinase assays as described previously by Ludwig et al. (44). Proteins were separated by SDS-polyacrylamide gel electrophoresis, blotted onto polyvinylidene difluoride membranes, and detected with a BAS 2000 BioImaging Analyzer (Fuji) and by autoradiography. For detection of the proteins in immunoblots, appropriate primary antibodies together with peroxidase-coupled protein A were used followed by a standard enhanced chemiluminescence reaction (Amersham, Little Chalfont, United Kingdom).

Purification of Bacterially Expressed Proteins-- Bacterially expressed proteins GABP-alpha , GABP-beta , 3pK(K-M), GST-c-Jun(1-135), and GST-SAPKalpha I were purified as described earlier (35, 44).

Electromobility Shift Assays (EMSAs)-- Crude nuclear extracts of A3.01 cells were prepared as described previously (38). 2 µg of nuclear proteins or various amounts of recombinant GABP proteins were preincubated on ice with 2 µg of poly(dI-dC) (Boehringer) and 1 µg of bovine serum albumin in bandshift buffer (60 mM Hepes, pH 7.9, 3 mM dithiothreitol, 3 mM EDTA, 150 mM KCl, 12% Ficoll). After 10 min, 12.5 fmol of a 32P-labeled oligonucleotide (equivalent to approximately 50,000 cpm) was added in a total volume of 10 µl, incubated at room temperature for 15 min, and loaded onto 5% native polyacrylamide gels in 0.4 × Tris borate-EDTA buffer. Upon fractionation, gels were dried and exposed for autoradiography. The following oligonucleotides were used as labeled probes and unlabeled competitors, which were optionally added to the DNA-protein-binding reaction: DSE (wild type), 5'-TCTGAAACAGGAAACCAATACACTTCCTGTTTAATC-3'; DSE-Am, 5'-TCTGAAACAGGAAACCAATACACTTGGTGTTTAATC-3'; ERE-A (wild type), 5'-AATACACTTCCTGTTTAATC-3'; ERE-Am, 5'-AATACACTTGGTGTTTAATC-3'; ERE-Bm, 5'-TCTGAAACACCAAACCAATA-3'; ICP4 (GABP site), 5'-AGCTTGCGGAACGGAAGCGGAAACCGCCGGATCG-3'.

For supershift EMSAs, 2 µg of purified preimmune serum or antiserum against GABP-alpha or GABP-beta were incubated on ice with 2 µg of nuclear extracts for 20 min before adding the labeled DSE oligonucleotides. The DNA-protein complexes were separated on 4% native polyacrylamide gels.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

SPRK/MLK3 Strongly Induces the Activity of the DSE of the Distal IL-2 Enhancer-- Overexpression of SPRK/MLK3 activates JNK/SAPK and p38 via SEK and MKK6, respectively, in COS1 and HEK-293 cells (17). We investigated the effects of these stress pathways on the DSE activity in the CD4 positive T cell line A3.01 using a four-copy DSE cloned in front of a minimal thymidine kinase (tk) promoter construct in transient transfection assays. Compared with vector control, the DSE activity increased 28-fold when SPRK/MLK3 was cotransfected (Fig. 1A). As a positive control, we stimulated A3.01 cells with TPA/ionomycin, which lead to IL-2 secretion (data not shown) and resulted in a 16-fold induction of the DSE activity (Fig. 1A). Mutations of the GGAA-Ets-core motifs of the DSE abolished both the SPRK/MLK3 as well as TPA/ionomycin-induced DSE activity (Fig. 1). These data demonstrate that overexpression of SPRK/MLK3 can induce DSE transactivation via the Ets-core binding motifs. We next investigated the effects of stress kinase cascades on the DSE activity in more detail.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   SPRK/MLK3 strongly induces DSE-dependent transcription in A3.01 T cells. A, A3.01 cells were transiently transfected with different luciferase reporter constructs (indicated in the figure and described under "Materials and Methods") and RSV-beta -galactosidase expression vector. As indicated in the figure, either SPRK/MLK3 expression vector or corresponding empty expression vector (vector) was cotransfected. As a positive control, cells were stimulated for 24 h with TPA/ionomycin (T+I); as a negative control, cells were left untreated (w/o). Finally, cells were harvested, and luciferase and beta -galactosidase assays were performed. The luciferase activities were normalized on the basis of beta -galactosidase activity. Standardized luciferase activities are related to the activity of 4xDSE-tk-promoter without stimulation (w/o). Panel B shows the sequence of wild type (wt) as well as mutant (mut) DSE spanning the region of -462 to -429 relative to the transcriptional start site of the IL-2 promoter/enhancer. The Ets-related elements A and B are indicated by brackets.

Specific Activation of either ERK or JNK/SAPK, but Not p38, Is Sufficient to Transactivate DSE-dependent Transcription in A3.01 Cells-- Because TPA/ionomycin triggers JNK/SAPK activity in Jurkat cells and thymocytes (2) and strongly induces DSE activity in A3.01 T cells, we measured the stimulation of the different MAPKs in A3.01 cells. Immune complex kinase assays were performed with endogenous ERK, JNK1, and p38 of unstimulated or stimulated A3.01 cells. TPA led to a strong activation of ERK, which could not be further enhanced by ionomycin (Fig. 2A, upper panel). JNK1 was only 5-fold activated by TPA; ionomycin alone had no activating effect. Costimulation with TPA/ionomycin led to a strong synergistic activation (Fig. 2A, middle panel). Interestingly, p38 showed a similar pattern of regulation as JNK, as it was only modestly activated by TPA and synergistically by TPA plus ionomycin (Fig. 2A, lower panel). Thus, all three MAPKs are strongly activated under TPA/ionomycin costimulation.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   A, activation profile of MAPKs ERK2 (upper panel), JNK1 (middle panel), and p38 (lower panel) in A3.01 T cells. T cells were split to 4 × 105/ml 1 day before stimulation for 20 min with TPA (T), ionomycin (I), TPA/ionomycin (T+I), or left untreated (w/o). Subsequently, cells were lysed in RIPA buffer, MAPKs were immunopurified with anti-ERK2, anti-JNK1, or anti-p38 antiserum, and kinase activities were evaluated in in vitro kinase assays by radiolabeled phosphate incorporation into the substrates MBP, GST-c-Jun(1-135), and 3pK(K-M) for ERK, JNK, or p38, respectively. Lanes 1-4 show autoradiographies, and lanes 5-8 show corresponding immunoblots using same antiserum as used for immunoprecipitation to demonstrate equal protein kinase amounts. B, in A3.01 cells, Raf-BXB-CX, SPRK/MLK3, and MKK6(EE) expression results in specific ERK (upper panel), SAPK (middle panel), and p38 (lower panel) activation, respectively. To measure MAPK activity of the transfected cells, cells were transiently transfected with expression vectors for HA-tagged ERK1 (upper panel), HA-tagged SAPKbeta (middle panel), or Flag-tagged p38 (lower panel) in combination with Raf-BXB-CX (lane 3), SPRK (lane 4), MKK6(EE) (lane 5), or empty expression vector (lanes 1 and 2) and stimulated 48 h post-transfection with TPA/ionomycin (T+I) for 20 min (lane 2) or left untreated (lanes 1 and 3-5). Ectopically expressed HA-ERK or GST-SAPKbeta of transfected cells were immunoprecipitated with specific antibodies against the tag and assayed for activity as described above. Lanes 1-5 show autoradiographies; lanes 6-10 show corresponding immunoblots with anti-HA antibody detecting HA-ERK1 (upper panel) and HA-SAPKbeta (middle panel) or anti-Flag antibody detecting Flag-p38 (lower panel).

To dissect the contribution of each MAPK pathway to the regulation of the DSE, we tested constitutively active kinases to activate ERK, JNK/SAPK, and p38 in A3.01 cells. MKK6 (EE), which has the two activating phosphorylation sites replaced by glutamic acid residues rendering it to a constitutively active kinase (21), stimulates p38 activity in A3.01 T cells (Fig. 2B, lane 5). In contrast to the data of Tibbles et al. (17) observed in COS1 and HEK-293 cells, overexpression of SPRK/MLK3 in A3.01 cells only activates JNK/SAPK and has no effect on p38 or ERK activity (Fig. 2B, lane 4). The kinase domain of Raf (Raf-BXB) has been shown to be constitutively active in diverse cell lines such as NIH-3T3, HEK-293, and COS cells. However, it is only slightly active in T cells but can be strongly activated upon TPA stimulation (3, 43).2 We showed previously that Raf-BXB in combination with TPA induces DSE activity (38). In this study, we used a membrane-targeted version of Raf-BXB by fusing it to the CAAX motif of Ki-Ras (Raf-BXB-CX). Raf-BXB-CX expression was sufficient to induce ERK activity to an extent comparable with that induced by TPA/ionomycin without affecting JNK/SAPK or p38 activity (Fig. 2B, lane 3).

After establishing selective MAPK activation in A3.01 cells, we performed transient transfection assays using the 4xDSE-tk luciferase construct to test individual effects on DSE activity. Transfection of increasing amounts of either Raf-BXB-CX or SPRK/MLK3 expression vectors led to dose-dependent strong induction of DSE activity of up to 16- and 30-fold, respectively (Fig. 3A). Surprisingly, overexpression of constitutively active MKK6 (MKK6 (EE)) resulted in only marginal effects on DSE activity (Fig. 3A), whereas it significantly activated p38 (Fig. 2B). The tk-minimal promoter alone was not significantly responsive to any of the activating kinases (Fig. 3A). Moreover, point mutations in the Ets-core consensus sequences abolished Raf-BXB-CX and SPRK/MLK3 responsiveness of the DSE in transient transfection experiments (Fig. 3A).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Overexpression of constitutively active c-Raf (Raf-BXB-CX) or SPRK/MLK3, but not constitutively active MKK6 (MKK6 (EE)), is sufficient to activate DSE-dependent transcription, for which the GABP binding sites are required. A, A3.01 cells were cotransfected with 4xDSE-tk luciferase construct (4xDSE-tk) together with either increasing amounts (0.5, 1.0, or 2.0 µg of vector DNA per transfection) of Raf-BXB-CX, SPRK/MLK3, or MKK6 (EE) expression vector or corresponding empty expression vector pRSPA (vector). As a control, 2.0 µg of background vector (vector) or either expression vector together with tk-luciferase construct (tk) were cotransfected. To test requirement of the Ets-consensus sequence, the 4xDSE(mut)-tk luciferase construct with mutations in both Ets-core motifs were cotransfected with 2.0 µg of background vector (vector) or either expression vector. 24-h post-transfection cells were harvested, and luciferase assays were performed (see above). Relative luciferase activities of cells transfected with each cDNA expression vector are based on activities of cells transfected with the same amount of empty expression vector (pRSPA). Efficiency of MKK6 (EE) expression in terms of activating transcriptional activity was determined on an HIV-1 long terminal repeat-driven reporter construct (data not shown). B, kinase-inactive versions of ERK2, SEK1, SAPKbeta , and MKK6 impair TPA/ionomycin-induced DSE-driven reporter expression. A3.01 cells were cotransfected with 4xDSE-tk luciferase construct together with diverse kinase inactive mutants of ERK2 (B3 and C3), SEK1 (KR), SAPKbeta (KR), MKK6 (A), or corresponding background vector (vector) as indicated. 18-h post-transfection cells were left untreated or stimulated with TPA/ionomycin for 24 h before harvest. PD098059 (PD) or SB203580 (SB) were added 20 min before stimulation. Both inhibitors had no effect on DSE activity or kinase activity in unstimulated cells (data not shown). PD098059 was used at a concentration of 30 µM, which blocked ERK activation to 95% without affecting JNK or p38 activity, and SB203580 at a concentration of 2 µM, which inhibited p38 activity to 85% without any influence on ERK or JNK activity (data not shown). Efficient inhibition of p38 activity by MKK6 (A) was determined by p38-specific immune complex kinase assay described above (data not shown). No unspecific transcriptional inhibition by dominant negative kinase mutants was observed as judged by cotransfection with an RSV-driven reporter construct (RSV-beta -gal) and subsequent beta -galactosidase assay (data not shown). Luciferase assays were performed as described under "Materials and Methods." Relative luciferase activity of stimulated cells is based on unstimulated cells equally transfected.

Taken together, both active Raf and SPRK/MLK3 up-regulate DSE activity, whereas active MKK6 is not sufficient to trigger DSE-dependent transcription.

Block of the ERK and JNK/SAPK Pathway Abolishes the TPA/Ionomycin-induced DSE Activity-- Because TPA/ionomycin-induced activation of ERK, JNK, and p38 correlated with strong DSE activity, we addressed the question whether these MAPKs play a role in the induction of DSE activity. Therefore, cotransfections were performed using the 4xDSE-tk luciferase construct together with interfering kinase mutants of MKK6, SEK, JNK/SAPK, and ERK. Kinase-inactive MKK6 (MKK6 (A)) showed no inhibitory effect on TPA/ionomycin-induced DSE activity (Fig. 3B). Also, pretreatment with the p38-specific inhibitor, SB203580 (49), had no effect on TPA/ionomycin DSE induction. The concentration used was sufficient to almost abolish p38 activity without affecting ERK or JNK activities (data not shown).

Interfering mutants of both, SEK (SEK(K-R)) and SAPK (SAPKbeta (K-R)) partially inhibited the TPA/ionomycin effect on DSE (Fig. 3B). Moreover, two different interfering mutants of ERK2 (ERK2 C3 and B3) only partially inhibited the DSE induction (Fig. 3B). Using the MEK-specific inhibitor, PD098059 (50), an inhibition of 65% of the TPA/ionomycin-induced DSE activity is demonstrated (Fig. 3B). The concentration of the inhibitor used was sufficient to abolish catalytic activity of ERK without affecting JNK or p38 activity (data not shown). In T cells transfected with interfering SAPKbeta (K-R) preincubated with MEK inhibitor, PD098059, the TPA/ionomycin-induced DSE activity was almost abolished (Fig. 3B).

These data show that both Raf-MEK-ERK and SEK-JNK/SAPK pathways mediate TPA/ionomycin-induced DSE activity in a cooperative fashion. However, the MKK6-p38 pathway seems to have no effect.

GABP Is the Predominant Binding Factor of the DSE in A3.01 T Cells-- The involvement of different pathways on DSE activity suggests a complex regulation of this element. Previously, we have described GABP as one DSE binding factor in Jurkat nuclear extracts (38). To elucidate the effects of T cell stimulation on DSE binding factors, we characterized the binding factors of A3.01 T cells. We performed EMSAs using labeled DSE oligonucleotides in reconstitution experiments with recombinant GABP proteins (Fig. 4A), competition assays (Fig. 4B), and supershift analysis (Fig. 4C).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4.   GABP-alpha /beta are the predominant DSE binding factors of A3.01 nuclear extracts. A, either 2 µg of nuclear extracts of 4-h stimulated A3.01 T cells (w/o, without stimuli, lane 15; T, TPA, lane 16; I, ionomycin, lane 17; and T+I, TPA/ionomycin, lane 18) or recombinant GABP proteins (lanes 1-14) were incubated with radiolabeled wild type DSE (lanes 10-18) or ERE-A mutated DSE (DSE-Am) (lanes 1-9) oligonucleotides. Whereas wild type DSE contains 2 EREs, one of both is mutated in ERE-A mutated DSE. Different amounts indicated in the figure in nanograms of recombinant GABP-alpha (alpha ) and GABP-beta (beta ) alone or in combinations were used for EMSA (lanes 1-14). B, for competition assays, 10-, 50-, or 250-fold molar excess of unlabeled ERE-A (lanes 2-4), mutant ERE-A (ERE-Am, lanes 5-7), mutant ERE-B (ERE-Bm, lanes 8-10), or ICP4 oligonucleotide containing GABP binding sites (ICP4, lanes 11-13) were added to the binding reaction of 2 µg of A3.01 nuclear extracts and labeled DSE oligonucleotide. Panel C shows supershift experiments with anti-GABP-specific antiserum. 2 µg of nuclear A3.01 extracts were incubated with preimmune serum (PI, lane 2), anti-GABP-alpha serum (alpha , lane 3), anti-GABP-beta serum (beta , lane 4), or without antibodies (-, lane 1) for 15 min before radiolabeled DSE oligonucleotides were added. To separate supershifted complexes, a 4% polyacrylamide gel was used. EMSAs were performed as described under "Materials and Methods." The autoradiographies display three major complexes (I, II, III), supershifted complexes (ss), and unbound oligonucleotides (free probe, fp).

Nuclear extracts of stimulated A3.01 cells were incubated with radiolabeled DSE oligonucleotides and then separated on a native polyacrylamide gel. Independent of stimulation, three major complexes were observed, referred to as complexes I, II, and III (Fig. 4A, lanes 15-18), whereby complex II appeared in high resolution as two bands (IIa and b). Recombinant, purified GABP-alpha and GABP-beta showed a very similar migratory behavior when incubated with DSE oligonucleotides compared with crude nuclear extracts (Fig. 4A, lanes 14-18). To elucidate the composition of the complexes, we used GABP-alpha and -beta subunits alone or in combination with either wild type DSE or DSE oligonucleotides containing a mutation in one of the two Ets-related elements (DSE-Am). Recombinant GABP-alpha , which contains the Ets domain required for DNA contact (37), binds to DSE-Am as a single shifted complex, corresponding to complex III (Fig. 4A, lanes 1-4). GABP-beta alone does not bind (lane 5), but addition of GABP-alpha resulted in a slower migrating complex. This heterodimeric formation of both GABP subunits corresponds to complex II (Fig. 4A, lanes 6-9). Binding assays using wild type DSE oligonucleotides with GABP-beta together with increasing amounts of GABP-alpha resulted in a heterodimeric GABP formation at lower concentrations of alpha -subunit (corresponding to complex II, lanes 10 and 11). The two complexes IIa and IIb of nuclear extracts might be explained by the existence of different GABP-beta isoforms (51, 52).

At higher concentrations of GABP-alpha , another slower migrating complex was observed, most likely a tetrameric association of two heterodimeric GABP proteins bound to DSE (lanes 12-14), which is also observed with other promoter elements and seems to be critical for strong transcriptional activation (37, 53, 54). This complex of purified GABP proteins shows the same migratory behavior as complex I of nuclear extracts, indicating that complex I consists only of tetrameric GABP complex. Using mutant DSE-Am oligonucleotides, which allows GABP binding only at one Ets-binding motif, the tetrameric formation of GABP on the DSE can be prohibited. When crude nuclear extracts were incubated with these oligonucleotides, no complex I was detected (data not shown).

To confirm that the complexes contain GABP, we used an oligonucleotide as competitor containing the GABP-specific binding sites of the ICP-4 promoter (Fig. 4B, lanes 11-13), which was used for the identification of GABP (36). This oligonucleotide competed as efficiently as wild type Ets-related element A (ERE-A) for DSE-bound protein complexes (Fig. 4B, lanes 2-4), whereas mutations in the Ets-core motif in either ERE-A or ERE-B oligonucleotides abolished their ability to compete with labeled DSE (Fig. 4B, lanes 5-10). Finally, incubation of A3.01 nuclear extracts with specific anti-GABP-alpha or anti-GABP-beta antibodies supershifted the complexes of A3.01 nuclear extracts (Fig. 4C, lanes 3 and 4, indicated by ss).

These results suggest that GABP is the predominant DSE binding factor, and complex I, which seemed to be responsible for the transcriptional activity (38), was characterized as the tetrameric GABP complex. Interestingly, the DNA binding activity of GABP seems not to be regulated by stimulation with TPA, ionomycin, or their combination, as no significant changes in DNA binding activity were observed when nuclear extracts of unstimulated or stimulated A3.01 cells were used for EMSA (Fig. 4A, lanes 15-18).

GABP Is Phosphorylated upon JNK/SAPK Stimulation in Vivo and by JNK/SAPK in Vitro-- Because GABP is the predominant DSE-binding factor and GABP binding sites are necessary for transactivation by Raf and SPRK/MLK3, we tested whether GABP is a direct substrate not only for mitogen-stimulated ERK (35, 55) but also for other MAPK family members. We have shown that GABP factors are also phosphorylated in vivo upon stimulation of HEK-293 cells with TPA and serum (35). To study the effects of SAPK on phosphorylation of GABP in vivo, this cell line was transfected with GABP-alpha and -beta expression vectors alone or in combination with SAPKbeta expression vector and metabolically labeled with [32P]orthophosphate. Cells were treated with anisomycin to strongly activate SAPK without affecting ERK activity. Fig. 5 shows the autoradiography (Fig. 5A) and corresponding immunoblot (Fig. 5B) of immune precipitated GABP subunits. We observed an increased phosphorylation of both GABP subunits upon anisomycin stimulation, which was further increased when SAPKbeta was overexpressed, implicating a function in GABP phosphorylation. Treatment of HEK-293 cells with anisomycin leads to SEK, JNK/SAPK, and 3pK activation as well as to p38 stimulation (44).


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 5.   Both GABP subunits are phosphorylated in vivo. GABP-alpha and -beta expression vectors alone (lanes 1, 2, 5, and 6) or in combination with pEBG-SAPKbeta (lanes 3, 4, 7, and 8) were transiently transfected in HEK-293 cells. 48 h later, cells were subjected to phosphate-free DMEM 2 h before addition of [32P]orthophosphate. 1 h later, cells were stimulated with anisomycin for 1 h or left untreated as indicated in the figure. Cells were lysed in Ripa buffer. Lysates were split into 2 halves, one of which was incubated with anti-GABP-alpha (lanes 1-4), the other half with anti-GABP-beta antiserum (lanes 5-8). Immune complexes were precipitated with protein-A agarose, washed, subjected to SDS-polyacrylamide gel electrophoresis, and electroblotted on polyvinylidene difluoride membrane. Panel A shows autoradiography; panel B shows corresponding immunoblot using anti-GABP-alpha and -beta antisera. It is worth noting that GABP-alpha protein load in lane 4 is four times less then in lanes 1-3.

We next tested the ability of these kinases to phosphorylate GABP in vitro, using ERK as a positive control. In vivo activated and immunopurified GST-tagged SAPKbeta but not Flag-tagged p38 phosphorylated both subunits of GABP (Fig. 6B). Bacterially expressed, purified, and preactivated GST-SAPKalpha I also was able to phosphorylate both GABP subunits in vitro like GST-c-Jun (Fig. 6C). Both activated SEK and 3pK did not phosphorylate GABP (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6.   Both GABP subunits are phosphorylated in vitro by ERKs and three different JNK/SAPK isoforms but not by p38. A, ERK2, JNK1, or p38 were immunopurified of unstimulated A3.01 cells (-) or cells stimulated for 20 min with TPA/ionomycin (+) using specific antisera as described in Fig. 2A. B, HEK-293 cells were transiently transfected with expression vectors coding for HA-tagged ERK1, GST-tagged SAPKbeta , or Flag-tagged p38 and stimulated 48 h later with TPA (+, lane 2) or anisomycin (+, lanes 4 and 6) for 30 min or left untreated (-, lanes 1, 3, and 5). MAPKs were immunoprecipitated using tag-specific antibodies. C, bacterially expressed and purified GST-SAPKalpha I was preincubated with unlabeled ATP and anti-GST-immunoprecipitates of either pEBG-SEK1 (lanes 1 and 2) or pEBG empty expression vector (c, lane 3) transfected HEK-293 cells, which were left untreated (-, lane 1 and c, lane 3) or were treated with anisomycin for 30 min (+, lane 2). SAPKalpha I was recovered from the supernatant by centrifugation before it was exposed to GABP or GST-c-Jun in in vitro kinase assays. Immunopurified kinases (A) and (B) or preactivated recombinant SAPKalpha I (C) were incubated with 1 µg of recombinant GABP-alpha (upper panel), 1 µg of recombinant GABP-beta (middle panel), 2 µg of 3pK(K-M), which is phosphorylated by the three MAPK family members but cannot autophosphorylate (44) (B, lower panel), or 2 µg of GST-c-Jun(1-135), the known substrate of JNK/SAPK (11) (C, lower panel) together with radiolabeled ATP. Kinase reaction was stopped after 30 min by adding SDS-loading buffer. Proteins were separated by SDS-polyacrylamide gel electrophoresis, and phosphorylated proteins were visualized by autoradiography. Equal substrate content was determined in immunoblots (not shown).

To extend the phosphorylation studies to another JNK/SAPK isozyme, JNK1/SAPKgamma , in addition to p38 and ERK of untreated or TPA/ionomycin-stimulated A3.01 cells, was tested for their ability to phosphorylate GABP factors in vitro (Fig. 6A). Consistent with the above described data of the in vitro kinase assays and with our transactivation data, ERK and JNK1 but not p38 functioned as a GABP kinase (Fig. 6A).

The ability of three different isoforms of JNK/SAPK (SAPKalpha , -beta , and JNK1) to phosphorylate GABP in vitro, in combination with the in vivo phosphorylation of GABP upon SAPK activation by anisomycin, suggests that GABP is targeted by JNK/SAPK-activating pathways.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We characterized the Ets-core motifs of a distal IL-2 enhancer as a SPRK/MLK3-SEK-JNK/SAPK responsive element. In the TPA/ionomycin induction of the DSE activity, the JNK/SAPK activating pathway cooperates with the Raf-MEK-ERK signaling pathway. Block of both cascades almost abolished the induction, whereas activation of either of these signaling cascades is sufficient to induce DSE activity independently. Despite being activated, we observed no critical contribution of the MKK6-p38 pathway in DSE regulation. The DSE activity is strongly dependent on the Ets-core motifs, which are bound by GABP. Both subunits of GABP are phosphorylated upon JNK activation in vivo and three different isoforms of JNK/SAPK, but not p38, in vitro. These data suggest that ERK and JNK activation converge on GABP to regulate DSE activity, which enhances IL-2 induction (Fig. 7).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   Model for regulation of the GABP-responsive element of the distal IL-2 enhancer. T cell activation leads to rapid induction of ERK, JNK, and p38 signaling pathways. ERK and JNK activation cooperates in the induction of transcriptional activity via the GABP-responsive region of the distal IL-2 enhancer. GABP-alpha /beta is a target for ERK and JNK and transmits the signal into potentiated transcriptional activation.

In our experimental study, we used SPRK/MLK3 as a JNK/SAPK activator. SPRK/MLK3 overexpression induced the IL-2 promoter/enhancer activity in A3.01 T cells (data not shown) and is a strong transactivator of the DSE. Interestingly, the SPRK/MLK3-induced DSE activity exceeded the induction by TPA/ionomycin (Fig. 1). Because SPRK/MLK3 activates SAPK to the same extent as TPA/ionomycin after 20 min of stimulation (Fig. 2), the difference might be explained by the duration of the signal. JNK/SAPK activity is triggered by TPA/ionomycin maximally after 20 min and returns to baseline activity after 2 h (data not shown). In contrast, SPRK/MLK3 overexpression leads to sustained high JNK activity (Fig. 2).

Employing a constitutively active kinase version of MKK6, we were not able to measure significant induction of DSE activity. In addition, neither an interfering kinase mutant of MKK6 nor the specific p38 inhibitor, SB203580, impaired the TPA/ionomycin-induced DSE activity. Although both JNK and p38 are stimulated by an overlapping spectrum of stimuli, activation of these kinases shows specific cellular responses. The specificity might be a consequence of the selective choice of the transcription factor mediating the kinase activity. We identified GABP as a target of JNK/SAPK, but not p38. C-Jun is another factor that is activated by JNK, which also has not yet been demonstrated to be phosphorylated by p38. Even though both JNK and p38 phosphorylate Elk, both kinases show different preferences for the phospho-acceptor sites (28). The elucidation of effectors, which are either targeted by JNK or p38, will provide further insights into the specificities of both pathways.

Interestingly, triggering of the ERK or JNK signal transduction pathway by overexpression of either constitutively active Raf or SPRK/MLK3, respectively, is sufficient to induce DSE activity (Fig. 3A). Two observations point to a cooperative mechanism of both pathways in TPA/ionomycin-induced DSE-dependent transcription. First, TPA/ionomycin-induced DSE activity is impaired by inhibition of JNK or ERK activation (Fig. 3B). Second, costimulation by TPA/ionomycin, which synergistically activate JNK but not ERK, significantly enhanced the DSE-driven transcription compared with the induction by TPA alone when only ERK is highly active (data not shown). Another example for a cooperation of diverse MAPKs has been elucidated for TCF activation by ERK and p38 in response to stress stimuli; however, the mechanism of cooperation is still unclear (28). In case of the GABP-responsive element, cooperation of ERK and JNK can occur via phosphorylation of diverse phospho-acceptor sites differentially contributing to the activity of GABP. Phosphorylation site mapping and mutational analysis will help to answer this question. However, the phospho-modification of GABP seems to be a complex mechanism, as both subunits of GABP contain multiple potential MAPK phosphorylation sites and are phosphorylated by ERK and JNK/SAPK on serine as well as on threonine residues (data not shown). On the other hand, cooperation may also occur at the level of the strength and duration of the MAPK activity. TPA/ionomycin costimulation might not activate ERK and JNK sufficiently for full induction of DSE activity. This also explains why either SPRK/MLK3 or membrane-targeted Raf-BXB is sufficient for strong DSE induction. The strong and constitutive activation of JNK by SPRK/MLK3 or ERK by Raf-BXB-CX might compensate for the missing activation of the unresponsive MAPK.

The most prominent candidate for linking phosphorylation cascades to transcriptional activity is the transcription factor GABP, as the DSE binding complexes of A3.01 nuclear extracts have been identified as monomeric, dimeric, and tetrameric GABP complexes (Fig. 4). Interestingly, the transcription factor is a target of two diverse MAPKs. However, other Ets family members such as Sap-1a (27) and PEA3 (29) have been described as substrates for mitogenic-induced ERK and stress-activated JNK/SAPKs. This implicates that signal convergence is an important mechanism in regulation of these transcription factors. The regulation of GABP by these kinase cascades is based on an as yet unidentified mechanism, as T cell stimulation neither modifies the subcellular localization of GABP subunits (not shown) nor dramatically changes the DSE binding complexes (Fig. 4). The regulation might involve changes in the intra- and intermolecular protein folding of the GABP complex, which might result in enhanced recruitment of RNA polymerase II transcriptional coactivators. A similar example is ERF, an Ets-family member with repressor functions. It has been identified as a target for ERK, in which ERK phosphorylation regulates its activity without affecting the DNA binding affinity (32).

Because GABP is ubiquitously expressed, we tested whether the regulation of DSE activity occurs also in non-T cell lines. Indeed, in the human embryonic kidney cell line HEK-293, the DSE activity also is up-regulated by constitutively active Raf and SPRK/MLK3 overexpression (data not shown), and GABP phosphorylation is induced upon TPA treatment in vivo (35), which activates ERK but not JNK/SAPK or p38 (44). In this study, we addressed the question whether GABP phosphorylation occurs in vivo, when JNK is active. To exclude the phosphorylation by ERK, we treated HEK-293 cells with the stress inducer anisomycin, which strongly up-regulates JNK/SAPK but does not affect ERK activity (44). Under these conditions, both subunits of GABP are induced phosphorylated and even more when SAPK was overexpressed. Also in NIH-3T3 fibroblasts (35) and pituitary GH4 cells (55), an induction of GABP-responsive elements occurs via extracellular stimuli. In this context, it might be interesting to test whether GABP-responsive promoters of house-keeping genes (54, 56) can be activated beyond the level of constitutive activity by triggering intracellular signaling events. In particular, GABP has been shown to regulate the expression of nuclear-encoded mitochondrial proteins, cytochrome oxidase subunits IV and Vb, and the mitochondrial transcription factor mtTF-1, which is constitutively expressed but can also be regulated in response to changes in the redox state of the cell (for example, by hypoxia). Hypoxia induces ERK, JNK, and p38 (57). This observation, combined with our finding that the GABP-responsive element is regulated by ERK and JNK, allows us to speculate that phosphoregulation of GABP mediates hypoxia-regulated expression of mitochondrial proteins involved in cellular respiration. Furthermore, several viruses such as herpes simplex virus 1 (36, 58), adenovirus (53), and Moloney murine leukemia virus (48) as well as human immunodeficiency virus 1 (35) recruit GABP for viral gene expression. Indeed, we observed an induced HIV-1 long terminal repeat activity when we overexpressed SPRK/MLK3 in A3.01 T cells.3 In the light of our observations that GABP is a shared target of ERK and JNK/SAPK, one might speculate that GABP converts diverse signals mediated by ERK and JNK/SAPK into induced gene expression.

    ACKNOWLEDGEMENTS

We are very grateful to S. Ludwig for dominant negative kinase versions of SAPK(K-R) and SEK(K-R), numerous discussions, and reading the manuscript. We thank A. Grobeta e-Wilde for the support of subcloning of cDNAs in pRSPA vectors. The expression vectors for RSV-beta -gal, GST-SEK, GST-SAPKbeta , GST-SAPKalpha I, GST-cJun(1-135), MKK6, SPRK/MLK3, Flag-p38, and ERK constructs were kind gifts of T. Wirth, J. Kyriakis, J. Woodgett, R. Davis, J. Han, and M. Cobb. Bacterially expressed and purified proteins of GABP-alpha and -beta , GST-c-Jun(1-135), and 3pK(K-M) were kindly provided by J. Bruder, K. Kilian, and H. Häfner. We greatly appreciate helpful discussions with B. Baumann, B. Jordan, B. Neufeld, R. Schreck, and T. Wirth.

    FOOTNOTES

* This work was supported by the Deutsche Forschungsgemeinschaft Sonderforschungsbereich 165 and DFG Grant We 2023/2-1.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by EC Grant (ERB-CIPA-CT-92-0108) for Cooperation in Science and Technology with Central and Eastern European Countries.

par To whom correspondence should be addressed. Tel.: 49-931-201-5140; Fax: 49-931-201-3835; E-mail: rappur{at}rzbox.uni-wuerzburg.de.

1 The abbreviations used are: MAPK, mitogen-activated protein kinase; GABP, GA-binding protein; IL-2, interleukin-2; DSE, dyad symmetry element; ERK, extracellular signal-regulated kinase; SAPK, stress-activated protein kinase; JNK, c-Jun N-terminal kinase; SEK, SAPK/ERK-kinase; MEK, MAPK/ERK kinase; MKK6, MAPK kinase 6; SPRK, SH3-domain-containing proline-rich kinase; MLK-3, mixed lineage kinase 3; FCS, fetal calf serum; DMEM, Dulbecco's modified Eagle's medium; MES, morpholinoethanesulfonic acid; tk, thymidine kinase; RSV, Rous sarcoma virus.

2 Flory, E., Weber, C. K., Chen, P., Hoffmeyer, A., Jassoy, C., and Rapp, U. R. (1998) J. Virol., in press.

3 A. Hoffmeyer and U. R. Rapp, unpublished results.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

  1. Cantrell, D. (1996) Annu. Rev. Immunol. 14, 259-274[CrossRef][Medline] [Order article via Infotrieve]
  2. Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., and Ben-Neriah, Y. (1994) Cell 77, 727-736[CrossRef][Medline] [Order article via Infotrieve]
  3. Whitehurst, C. E., and Geppert, T. D. (1996) J Immunol. 156, 1020-1029[Abstract]
  4. Li, W., Whaley, C. D., Mondino, A., and Mueller, D. (1996) Science 271, 1272-1276[Abstract]
  5. Fields, P. E., Gajewski, T. F., and Fitch, F. W. (1996) Science 271, 1276-1278[Abstract]
  6. Faris, M., Kokot, N., Lee, L., and Nel, A. E. (1996) J. Biol. Chem. 271, 27366-27373[Abstract/Free Full Text]
  7. Galley, Y., Hagens, G., Glaser, I., Davis, W., Eichhorn, M., and Dobbelaere, D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 5119-5124[Abstract/Free Full Text]
  8. Nishina, H., Bachmann, M., Oliveira-dos-Santos, A. J., Kozieradzki, I., Fischer, K. D., Odermatt, B., Wakeham, A., Shahinian, A., Takimoto, H., Bernstein, A., Mak, T. W., Woodgett, J. R., Ohashi, P. S., and Penninger, J. M. (1997) J. Exp. Med. 186, 941-953[Abstract/Free Full Text]
  9. Daum, G., Eisenmann-Tappe, I., Fries, H.-W., Troppmair, J., and Rapp, U. R. (1994) Trends Biochem. Sci. 19, 474-480[CrossRef][Medline] [Order article via Infotrieve]
  10. Rapp, U. R., Bruder, J. T., and Troppmair, J. (1994) in The Fos and Jun Family of Transcription Factors (Angel, P., and Herrlich, P., eds), CRC Press Inc., Boca Raton, FL
  11. Derijard, B., Hibi, M., Wu, I. H., Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R. J. (1994) Cell 76, 1025-1037[CrossRef][Medline] [Order article via Infotrieve]
  12. Kyriakis, J. M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E. A., Ahmad, M. F., Avruch, J., and Woodgett, J. R. (1994) Nature 369, 156-160[CrossRef][Medline] [Order article via Infotrieve]
  13. Tournier, C., Whitmarsh, A. J., Cavanagh, J., Barrett, T., and Davis, R. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7337-7342[Abstract/Free Full Text]
  14. Holland, P. M., Suzanne, M., Campbell, J. S., Noselli, S., and Cooper, J. A. (1997) J. Biol. Chem. 272, 24994-24998[Abstract/Free Full Text]
  15. Sanchez, I., Hughes, R. T., Mayer, B. J., Yee, K., Woodgett, J. R., Avruch, J., Kyriakis, J. M., and Zon, L. I. (1994) Nature 372, 794-798[Medline] [Order article via Infotrieve]
  16. Derijard, B., Raingeaud, J., Barrett, T., I-, Huan, W., Han, J., Ulevitch, R. J., and Davis, R. J. (1995) Science 267, 682-685[Abstract/Free Full Text]
  17. Tibbles, L. A., Ing, Y. L., Kiefer, F., Chan, J., Iscove, N., Woodgett, J. R., and Lassam, N. J. (1996) EMBO J. 15, 7026-7035[Medline] [Order article via Infotrieve]
  18. Heasley, L. E., Storey, B., Fanger, G. R., Butterfield, L., Zamarripa, J., Blumberg, D., and Maue, R. A. (1996) Mol. Cell. Biol. 16, 648-656[Abstract]
  19. Kharbanda, S., Pandey, P., Pen, R., Mayer, B., Zon, L., and Kufe, D. (1995) J. Biol. Chem. 270, 30278-30281[Abstract/Free Full Text]
  20. Raingeaud, J., Gupta, S., Rogers, J. S., Dickens, M., Han, J., Ulevitch, R. J., and Davis, R. J. (1995) J. Biol. Chem. 270, 7420-7426[Abstract/Free Full Text]
  21. Raingeaud, J., Whitmarsh, A. J., Barrett, T., Derijard, B., and Davis, R. J. (1996) Mol. Cell. Biol. 16, 1247-1255[Abstract]
  22. Robinson, M. J., and Cobb, M. H. (1997) Curr. Opin. Cell. Biol. 9, 180-186[CrossRef][Medline] [Order article via Infotrieve]
  23. Crawley, J. B., Rawlinson, L., Lali, F. V., Page, T. H., Saklatvala, J., and Foxwell, B. M. (1997) J. Biol. Chem. 272, 15023-15027[Abstract/Free Full Text]
  24. Gille, H., Strahl, T., and Shaw, P. E. (1995) Curr. Biol. 5, 1191-1200[CrossRef][Medline] [Order article via Infotrieve]
  25. Cavigelli, M., Dolfi, F., Claret, F.-X., and Karin, M. (1995) EMBO J. 14, 5957-5964[Medline] [Order article via Infotrieve]
  26. Whitmarsh, A. J., Shore, P., Sharrocks, A. D., and Davis, R. J. (1995) Science 269, 403-407[Abstract/Free Full Text]
  27. Janknecht, R., and Hunter, T. (1997) EMBO J. 16, 1620-1627[CrossRef][Medline] [Order article via Infotrieve]
  28. Price, M. A., Cruzalegui, F. H., and Treisman, R. (1996) EMBO J. 15, 6552-6563[Medline] [Order article via Infotrieve]
  29. O'Hagan, R. C., Tozer, R. G., Symons, M., McCormick, F., and Hassell, J. A. (1996) Oncogene 13, 1323-1333[Medline] [Order article via Infotrieve]
  30. Janknecht, R., Monte, D., Baert, J. L., and de-Launoit, Y. (1996) Oncogene 13, 1745-1754[Medline] [Order article via Infotrieve]
  31. Janknecht, R. (1996) Mol. Cell. Biol. 16, 1550-1556[Abstract]
  32. Sgouras, D. N., Athanasiou, M. A., Beal, G. J., Fisher, R. J., Blair, D. G., and Mavrothalassitis, G. J. (1995) EMBO J. 14, 4781-4793[Medline] [Order article via Infotrieve]
  33. Wasylyk, C., Bradford, A. P., Gutierrez-Hartmann, A., and Wasylyk, B. (1997) Oncogene 14, 899-913[CrossRef][Medline] [Order article via Infotrieve]
  34. O'Neill, E. M., Rebay, I., Tjian, R., and Rubin, G. M. (1994) Cell 78, 137-147[CrossRef][Medline] [Order article via Infotrieve]
  35. Flory, E., Hoffmeyer, A., Smola, U., Rapp, U. R., and Bruder, J. T. (1996) J. Virol. 70, 2260-2268[Abstract]
  36. LaMarco, K., Thompson, C. C., Byers, B. P., Walton, E. M., and McKnight, S. L. (1991) Science 253, 789-792[Abstract/Free Full Text]
  37. Thompson, C. C., Brown, T. A., and McKnight, S. L. (1991) Science 253, 762-768[Abstract/Free Full Text]
  38. Avots, A., Hoffmeyer, A., Flory, E., Cimanis, A., Rapp, U. R., and Serfling, E. (1997) Mol. Cell. Biol. 17, 4381-4389[Abstract]
  39. Serfling, E., Avots, A., and Neumann, M. (1995) Biochim. Biophys. Acta 1263, 181-200[Medline] [Order article via Infotrieve]
  40. Rothenberg, E., and Ward, S. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9358-9365[Abstract/Free Full Text]
  41. Han, J., Lee, J.-D., Bibbs, L., and Ulevitch, R. J. (1994) Science 265, 808-811[Abstract/Free Full Text]
  42. Wang, H.-G., Rapp, U. R., and Reed, J. C. (1996) Cell 87, 629-638[CrossRef][Medline] [Order article via Infotrieve]
  43. Whitehurst, C. E., Owaki, H., Bruder, J. T., Rapp, U. R., and Geppert, T. D. (1995) J. Biol. Chem. 270, 5594-5599[Abstract/Free Full Text]
  44. Ludwig, S., Engel, K., Hoffmeyer, A., Sithanandam, G., Neufeld, B., Palm, D., Gaestel, M., and Rapp, U. R. (1996) Mol. Cell. Biol. 16, 6687-6697[Abstract]
  45. Robbins, D. J., Zhen, E., Owaki, H., Vanderbilt, C. A., Ebert, D., Geppert, T. D., and Cobb, M. H. (1993) J. Biol. Chem. 268, 5097-5106[Abstract/Free Full Text]
  46. Dorn, P. L., DaSilva, L., Matarano, L., and Derse, D. (1990) J. Virol. 64, 1616-1624[Abstract/Free Full Text]
  47. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2 Ed., Cold Spring Harbor Laboratory Press, New York
  48. Gunther, C. V., and Graves, B. J. (1994) Mol. Cell. Biol. 14, 7569-7580[Abstract/Free Full Text]
  49. Cuenda, A., Rouse, J., Doza, Y. N., Meier, R., Cohen, P., Gallagher, T. F., Young, P. R., and Lee, J. C. (1995) FEBS Lett. 364, 229-233[CrossRef][Medline] [Order article via Infotrieve]
  50. Alessi, D. R., Cuenda, A., Cohen, P., Dudley, D. T., and Saltiel, A. R. (1995) J. Biol. Chem. 270, 27489-27494[Abstract/Free Full Text]
  51. Watanabe, H., Sawada, J., Yano, K., Yamaguchi, K., Goto, M., and Handa, H. (1993) Mol. Cell. Biol. 13, 1385-1391[Abstract/Free Full Text]
  52. Gu