|
|
||||||||
J Biol Chem, Vol. 273, Issue 17, 10112-10119, April 24, 1998
From T cell activation leads via multiple
intracellular signaling pathways to rapid induction of interleukin-2
(IL-2) expression, which can be mimicked by costimulation with
12-O-tetradecanoylphorbol-13-acetate (TPA) and ionomycin.
We have identified a distal IL-2 enhancer regulated by the Raf-MEK-ERK
signaling pathway, which can be induced by TPA/ionomycin treatment. It
contains a dyad symmetry element (DSE) controlled by the Ets-like
transcription factor GA-binding protein (GABP), a target of activated
ERK. TPA/ionomycin treatment of T cells stimulates both
mitogen-activated ERK, as well as the stress-activated
mitogen-activated protein kinase family members JNK/SAPK and p38. In
this study, we investigated the contribution of the stress-activated
pathways to the induction of the distal IL-2 enhancer. We show that
JNK- but not p38-activating pathways regulate the DSE activity.
Furthermore, the JNK/SAPK signaling pathway cooperates with the
Raf-MEK-ERK cascade in TPA/ionomycin-induced DSE activity. In T cells,
overexpression of SPRK/MLK3, an activator of JNK/SAPK, strongly induces
DSE-dependent transcription and dominant negative kinases
of SEK and SAPK impair TPA/ionomycin-induced DSE activity. Blocking
both ERK and JNK/SAPK pathways abolishes the DSE induction. The
inducibility of the DSE is strongly dependent on the Ets-core motifs,
which are bound by GABP. Both subunits of GABP are phosphorylated upon
JNK activation in vivo and three different isoforms of
JNK/SAPK, but not p38, in vitro. Our data suggest that GABP
is targeted by signaling events from both ERK and JNK/SAPK pathways.
GABP therefore is a candidate for signal integration and regulation of
IL-2 transcription in T lymphocytes.
T cell activation requires at least two signals mediated by T cell
receptor-CD3 complex and a costimulatory signal such as ligand binding
to CD28 (reviewed by Cantrell (1)). This costimulation can be mimicked
by phorbolester and calcium ionophore and results in rapid increase of
free intracellular calcium ions, activation of mitogen-activated
protein kinase (MAPK)1
cascades, and subsequent induction of IL-2 expression (1). Several
lines of evidence support the hypothesis that activation of MAPK family
members ERK (extracellular signal regulated kinase) and JNK
(c-Jun-N-terminal kinase) play an important role in T cell activation
and IL-2 expression (2-8).
The ERK-activating pathway also designated Raf-MEK-ERK cascade involves
Raf activation at the plasma membrane, leading to subsequent
phosphorylation and activation of the dual specificity kinase MEK
(MAPK/ERK kinase), which in turn activates ERK (9, 10). JNK/SAPK
(stress-activated protein kinase) (11, 12) is triggered by MKK7 (MAP
kinase kinase 7) (13, 14) or SEK/MKK4 (SAPK-ERK kinase) (15, 16).
Multiple upstream activators of SEK have been described, including
SPRK/MLK3 (SH3-domain-containing proline-rich kinase/mixed-lineage
kinase 3) (17). JNK activation in T cells presumably contributes to
proliferation (2), whereas in other cell types it may be involved in
differentiation (18) or proapoptotic processes (19). Another
signaling cascade leads to activation of a third member of the MAPK
family, p38 (20). MKK6 (MAP kinase kinase 6) has been identified as the
physiological p38 activator (21). JNK- and p38-activating pathways are
strongly triggered by inflammatory cytokines (TNF- For each MAPK, many substrates have been identified including kinases
such as MAPKAPK-2, -3pK, and diverse transcription factors (22)
mediating signals of kinase cascades into changed gene expression.
Several members of the Ets family of transcription factors have been
characterized as targets for MAPKs, including Elk-1 (24-26), Sap-1a
and Sap-2 (27, 28), PEA3 (29), ERM (30), ER81 (31), ERF (32), Ets1
(33), and Yan and Pointed-P2 (34). In addition, the Ets-related
transcription factor, GA-binding protein (GABP), is phosphorylated by
ERK controlling the Raf-responsive element of the HIV-1 promoter (35).
GABP, consisting of two subunits, was originally identified as a
protein complex that binds to a purine-rich hexanucleotide 5'-CGGAAR-3'
within the ICP4 promoter of Herpes simplex virus 1 (36, 37).
Recently, we have identified another GABP response element within a
distal IL-2 enhancer and observed increased IL-2 promoter/enhancer activity when GABP was overexpressed (38). The IL-2 gene transcription is tightly regulated and occurs only when T cells are activated via the
TCR complex and a costimulatory signal (39). The IL-2 promoter/enhancer
contains several binding sites for transcription factors regulated by
multiple signaling events. The combined NFAT-AP1 sites in the 320-base
pair minimal promoter/enhancer region play a crucial role in the
integration of different signaling cascades (39). However, upstream DNA
sequences from position Here, we report that overexpression of SPRK/MLK3, an activator of
SEK-JNK/SAPK cascade, strongly induces DSE activity. The SEK-SAPK
cascade partially mediates induced DSE-dependent
transcription, and it cooperates with the Raf-MEK-ERK cascade in
TPA/ionomycin-induced DSE activity. The DSE activity is strongly
dependent on the Ets-core motifs, which are bound by GABP. Both
subunits of GABP are phosphorylated upon JNK activation in
vivo and three different isoforms of JNK/SAPK in vitro.
These data suggest that JNK/SAPK and ERK activation converge on
GABP to regulate DSE activity.
Cell Lines and Antibodies--
A3.01 human T lymphoma cells were
grown in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS)
to a density of 8 × 105 cells/ml. The human embryonic
kidney cell line HEK293 and murine fibroblast cell line NIH-3T3 were
cultured in DMEM medium supplemented with 10% FCS. Cells were
incubated at 37 °C in humidified air with 7% CO2.
Antibodies raised against ERK2 (sc-154), JNK1 (sc-474), p38 (sc-535),
and Flag-tag (sc-807) were purchased from Santa Cruz Biotechnology,
Inc. Antibodies against GABP- DNA Constructs and Cloning--
The Herpes simplex virus
thymidine kinase minimal promoter (
The GABP-responsive Element of the Interleukin-2 Enhancer Is
Regulated by JNK/SAPK-activating Pathways in T Lymphocytes*
§,
,
,
Institut für Medizinische Strahlenkunde
und Zellforschung (MSZ), Universität Würzburg, Versbacher
Strasse 5, D-97078 Würzburg, Germany and ¶ Institut
für Pathologie, Universität Würzburg,
Joseph-Schneider-Strasse 2, D-97080 Würzburg, Germany
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, IL-1), UV
radiation, and chemical stress inducers such as arsenite and
anisomycin, indicating a role in cellular stress response (22).
However, a recent report describes an involvement of p38 in IL-2- and
IL-7-induced T cell proliferation (23).
321 to approximately
600 of the IL-2 gene
that are highly conserved between mouse and man are shown to enhance
the promoter activity (40). We have identified an inducible enhancer
element spanning the region from position
502 to
413 relative to
the transcriptional start site. Within the distal enhancer, the GABP
binding site consists of two palindromic Ets-related elements (EREs)
and were designated dyad symmetry element (DSE) (38). We observed a
potentiated transcriptional activity of the DSE after costimulation
with 12-O-tetradecanoylphorbol-13-acetate (TPA) and
ionomycin (TPA/ionomycin) of T cells as well as by overexpression of
Ras, c-Raf, and ERK in combination with TPA stimulation (38). As
TPA/ionomycin is known to also activate stress-activated protein kinase
JNK/SAPK in T cells (2), we investigated whether stress-activated MAPKs
contribute to DSE activity in T cells.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, GABP-
, and GST were obtained from
rabbits immunized with corresponding bacterially expressed and purified
proteins. The monoclonal antibodies against HA-tag (12CA5) were
produced and purified according to standard protocol.
105/+5) alone or downstream of
four copies of DSE wild type or mutant (described previously in Avots
et al. (38)) were cloned into pGL3 basic luciferase
expression vector (Promega). The mutant DSE has both G nucleotides of
both Ets-core motifs replaced by two C nucleotides: DSE (wild type),
462 TTCTGAAACAGGAAACCAATACACTTCCTGTTTAATCAA
424; and DSE (mutant),
462
TTCTGAAACACCAAACCAATACACTTGGTGTTTAATCAA
424.
and pEBG-SEK1 as well as
prokaryotic expression vectors pGEX-KG-SAPK
I and
pGEX-KG-c-Jun(1-135) were gifts from J. Kyriakis and L. Zon. The
pCDNA3-flag-p38 vector is described by Han et al.
(41). The expression vectors pRSPA-GABP-
and pRSPA-GABP-
were
described earlier (35).
(K-R) (44), ERK2
mutants (ERK-C3 and ERK-B3) (45), and HA-ERK1 were subcloned into the
multiple cloning site of pRSPA vector. pRSPA is an expression vector
with the Rous sarcoma virus promoter and simian virus 40 polyadenylation signal in a Bluescript backbone (46). MKK6 (EE) is a
constitutively active mutant of MKK6 of which two activating
phosphorylation sites were replaced by glutamic acid (21). ERK-C3
mutant is inactivated by exchange of the tyrosine in the TEY motif to
phenylalanine (45), whereas the other interfering mutants are
ATP-binding site mutants generated by replacement of lysine to arginine
(ERK-B3, SAPK
(K-R), SEK1 (K-R)) or to alanine (MKK6 (A)) (21, 44,
45). All mutants were tested in transient transfection assays and
immune complex kinase assays for their inhibiting or activating
effects.
Transient Transfections, Metabolic Labeling, and Reporter Gene Assays-- NIH-3T3 cells were seeded at 7 × 104 cells per well of a 6-well plate and grown for 24 h prior to transfection. HEK-293 cells were seeded at 7 × 105 cells per 10-cm-diameter dish and grown for 24 h prior to transfection. Transfections were performed by a calcium phosphate coprecipitation method using up to 15 µg of vector DNA according to a modified Stratagene transfection protocol. Cells were starved in DMEM containing 0.3% FCS 48 h before stimulation or metabolic labeling. For radiolabeling, cells were washed twice with phosphate-free DMEM and starved 2 h for phosphate. The concentration of [32P]phosphate added to the medium was 500 µCi/ml. At the end of the 2-h-labeling period, cells were washed twice with phosphate-buffered saline and then immediately lysed in RIPA buffer (25 mM Tris-HCl (pH 8), 137 mM NaCl, 10% glycerol, 0.1% SDS, 0.5% deoxycholate, 1% Nonidet P-40, 2 mM EDTA, 1 mM Pefabloc, 1 mM sodium orthovanadate, 5 mM benzamidine, 5 µg/ml aprotinin, 5 µg/ml leupeptin). Stimulation of HEK-293 cells was done with 10% FCS, 100 ng/ml TPA (Sigma), or 10 µg/ml anisomycin (Sigma) for indicated times.
A3.01 cells were split 4 × 105 cells/ml 1 day before transfection. A DMRIETM-C-based transfection protocol was used according to manufacturer's instructions (Life Technologies, Inc.). Cells were seeded in 6-well plates 7 × 105 cells/well in 1.5 ml of Opti-MEM (Life Technologies, Inc.) containing 3 µl of DMRIE and up to 3 µg of vector DNA. Transfections for luciferase assays were performed with 0.6 µg of reporter construct plus 2 µg of pRSPA containing diverse cDNAs. Unless otherwise indicated, 24 h after transfection, cells of each well were harvested in 100 µl lysis buffer (50 mM Na-MES, pH 7.8, 50 mM Tris-HCl, pH 7.8, 10 mM dithiothreitol, 2% Triton X-100). The crude cell lysates were cleared by centrifugation, and 50 µl of precleared cell extracts were added to 50 µl of luciferase assay buffer (125 mM Na-MES, pH 7.8, 125 mM Tris-HCl, pH 7.8, 25 mM Mg-acetate, 2 mg/ml ATP). Immediately after injection of 50 µl of 1 mM D-luciferin (AppliChem) into each sample, the luminescence was measured for 5 s in a luminometer (Berthold). The luciferase activities were normalized on the basis of
-galactosidase activity of cotransfected RSV-
-gal vector and protein content. The
-galactosidase assay was
performed with 20 µl of precleared cell lysate according to a
standard protocol (47). Mean and standard deviations of at least three
independent experiments each done in duplicates or triplicates are
shown in the figures.
A3.01 cells were stimulated with 10 ng/ml TPA or 0.5 µM
ionomycin (Sigma) for 24 h unless otherwise indicated. The MEK
specific inhibitor, PD098059 (Calbiochem), was used in a 30 µM concentration of a 15 mM stock solution in
Me2SO. The p38-specific inhibitor, SB203580 (Calbiochem),
was used at a concentration of 2 µM of a 20 mM stock solution in Me2SO. Cells were
preincubated with either inhibitor 20 min before stimulation.
Immunoprecipitation, Kinase Assay, and Immunoblotting-- Cells were lysed in RIPA buffer (described above), and cell debris was removed by centrifugation. Supernatants were incubated with different antisera for 2 h at 4 °C. The immune complexes were precipitated with protein-A agarose (Boehringer) and washed twice with high-salt RIPA buffer containing 500 mM NaCl. Immune complexes were either resuspended in electrophoresis sample buffer or used for in vitro kinase assays as described previously by Ludwig et al. (44). Proteins were separated by SDS-polyacrylamide gel electrophoresis, blotted onto polyvinylidene difluoride membranes, and detected with a BAS 2000 BioImaging Analyzer (Fuji) and by autoradiography. For detection of the proteins in immunoblots, appropriate primary antibodies together with peroxidase-coupled protein A were used followed by a standard enhanced chemiluminescence reaction (Amersham, Little Chalfont, United Kingdom).
Purification of Bacterially Expressed Proteins--
Bacterially
expressed proteins GABP-
, GABP-
, 3pK(K-M), GST-c-Jun(1-135), and
GST-SAPK
I were purified as described earlier (35, 44).
Electromobility Shift Assays (EMSAs)-- Crude nuclear extracts of A3.01 cells were prepared as described previously (38). 2 µg of nuclear proteins or various amounts of recombinant GABP proteins were preincubated on ice with 2 µg of poly(dI-dC) (Boehringer) and 1 µg of bovine serum albumin in bandshift buffer (60 mM Hepes, pH 7.9, 3 mM dithiothreitol, 3 mM EDTA, 150 mM KCl, 12% Ficoll). After 10 min, 12.5 fmol of a 32P-labeled oligonucleotide (equivalent to approximately 50,000 cpm) was added in a total volume of 10 µl, incubated at room temperature for 15 min, and loaded onto 5% native polyacrylamide gels in 0.4 × Tris borate-EDTA buffer. Upon fractionation, gels were dried and exposed for autoradiography. The following oligonucleotides were used as labeled probes and unlabeled competitors, which were optionally added to the DNA-protein-binding reaction: DSE (wild type), 5'-TCTGAAACAGGAAACCAATACACTTCCTGTTTAATC-3'; DSE-Am, 5'-TCTGAAACAGGAAACCAATACACTTGGTGTTTAATC-3'; ERE-A (wild type), 5'-AATACACTTCCTGTTTAATC-3'; ERE-Am, 5'-AATACACTTGGTGTTTAATC-3'; ERE-Bm, 5'-TCTGAAACACCAAACCAATA-3'; ICP4 (GABP site), 5'-AGCTTGCGGAACGGAAGCGGAAACCGCCGGATCG-3'.
For supershift EMSAs, 2 µg of purified preimmune serum or antiserum against GABP-
or GABP-
were incubated on ice with 2 µg of
nuclear extracts for 20 min before adding the labeled DSE oligonucleotides. The DNA-protein complexes were separated on 4%
native polyacrylamide gels.
| |
RESULTS |
|---|
|
|
|---|
SPRK/MLK3 Strongly Induces the Activity of the DSE of the Distal IL-2 Enhancer-- Overexpression of SPRK/MLK3 activates JNK/SAPK and p38 via SEK and MKK6, respectively, in COS1 and HEK-293 cells (17). We investigated the effects of these stress pathways on the DSE activity in the CD4 positive T cell line A3.01 using a four-copy DSE cloned in front of a minimal thymidine kinase (tk) promoter construct in transient transfection assays. Compared with vector control, the DSE activity increased 28-fold when SPRK/MLK3 was cotransfected (Fig. 1A). As a positive control, we stimulated A3.01 cells with TPA/ionomycin, which lead to IL-2 secretion (data not shown) and resulted in a 16-fold induction of the DSE activity (Fig. 1A). Mutations of the GGAA-Ets-core motifs of the DSE abolished both the SPRK/MLK3 as well as TPA/ionomycin-induced DSE activity (Fig. 1). These data demonstrate that overexpression of SPRK/MLK3 can induce DSE transactivation via the Ets-core binding motifs. We next investigated the effects of stress kinase cascades on the DSE activity in more detail.
|
Specific Activation of either ERK or JNK/SAPK, but Not p38, Is Sufficient to Transactivate DSE-dependent Transcription in A3.01 Cells-- Because TPA/ionomycin triggers JNK/SAPK activity in Jurkat cells and thymocytes (2) and strongly induces DSE activity in A3.01 T cells, we measured the stimulation of the different MAPKs in A3.01 cells. Immune complex kinase assays were performed with endogenous ERK, JNK1, and p38 of unstimulated or stimulated A3.01 cells. TPA led to a strong activation of ERK, which could not be further enhanced by ionomycin (Fig. 2A, upper panel). JNK1 was only 5-fold activated by TPA; ionomycin alone had no activating effect. Costimulation with TPA/ionomycin led to a strong synergistic activation (Fig. 2A, middle panel). Interestingly, p38 showed a similar pattern of regulation as JNK, as it was only modestly activated by TPA and synergistically by TPA plus ionomycin (Fig. 2A, lower panel). Thus, all three MAPKs are strongly activated under TPA/ionomycin costimulation.
|
|
Block of the ERK and JNK/SAPK Pathway Abolishes the TPA/Ionomycin-induced DSE Activity-- Because TPA/ionomycin-induced activation of ERK, JNK, and p38 correlated with strong DSE activity, we addressed the question whether these MAPKs play a role in the induction of DSE activity. Therefore, cotransfections were performed using the 4xDSE-tk luciferase construct together with interfering kinase mutants of MKK6, SEK, JNK/SAPK, and ERK. Kinase-inactive MKK6 (MKK6 (A)) showed no inhibitory effect on TPA/ionomycin-induced DSE activity (Fig. 3B). Also, pretreatment with the p38-specific inhibitor, SB203580 (49), had no effect on TPA/ionomycin DSE induction. The concentration used was sufficient to almost abolish p38 activity without affecting ERK or JNK activities (data not shown).
Interfering mutants of both, SEK (SEK(K-R)) and SAPK (SAPK
(K-R))
partially inhibited the TPA/ionomycin effect on DSE (Fig. 3B). Moreover, two different interfering mutants of ERK2
(ERK2 C3 and B3) only partially inhibited the DSE induction (Fig.
3B). Using the MEK-specific inhibitor, PD098059 (50), an
inhibition of 65% of the TPA/ionomycin-induced DSE activity is
demonstrated (Fig. 3B). The concentration of the inhibitor
used was sufficient to abolish catalytic activity of ERK without
affecting JNK or p38 activity (data not shown). In T cells transfected
with interfering SAPK
(K-R) preincubated with MEK inhibitor,
PD098059, the TPA/ionomycin-induced DSE activity was almost abolished
(Fig. 3B).
These data show that both Raf-MEK-ERK and SEK-JNK/SAPK pathways mediate
TPA/ionomycin-induced DSE activity in a cooperative fashion. However,
the MKK6-p38 pathway seems to have no effect.
GABP Is the Predominant Binding Factor of the DSE in A3.01 T Cells-- The involvement of different pathways on DSE activity suggests a complex regulation of this element. Previously, we have described GABP as one DSE binding factor in Jurkat nuclear extracts (38). To elucidate the effects of T cell stimulation on DSE binding factors, we characterized the binding factors of A3.01 T cells. We performed EMSAs using labeled DSE oligonucleotides in reconstitution experiments with recombinant GABP proteins (Fig. 4A), competition assays (Fig. 4B), and supershift analysis (Fig. 4C).
|
and GABP-
showed a very similar migratory behavior when
incubated with DSE oligonucleotides compared with crude nuclear
extracts (Fig. 4A, lanes 14-18). To elucidate
the composition of the complexes, we used GABP-
and -
subunits
alone or in combination with either wild type DSE or DSE
oligonucleotides containing a mutation in one of the two Ets-related
elements (DSE-Am). Recombinant GABP-
, which contains the Ets domain
required for DNA contact (37), binds to DSE-Am as a single shifted
complex, corresponding to complex III (Fig. 4A, lanes
1-4). GABP-
alone does not bind (lane 5), but
addition of GABP-
resulted in a slower migrating complex. This
heterodimeric formation of both GABP subunits corresponds to complex II
(Fig. 4A, lanes 6-9). Binding assays using wild type DSE oligonucleotides with GABP-
together with increasing amounts of GABP-
resulted in a heterodimeric GABP formation at lower
concentrations of
-subunit (corresponding to complex II, lanes
10 and 11). The two complexes IIa and IIb of nuclear
extracts might be explained by the existence of different GABP-
isoforms (51, 52).
At higher concentrations of GABP-
, another slower migrating complex
was observed, most likely a tetrameric association of two heterodimeric
GABP proteins bound to DSE (lanes 12-14), which is also
observed with other promoter elements and seems to be critical for
strong transcriptional activation (37, 53, 54). This complex of
purified GABP proteins shows the same migratory behavior as complex I
of nuclear extracts, indicating that complex I consists only of
tetrameric GABP complex. Using mutant DSE-Am oligonucleotides, which
allows GABP binding only at one Ets-binding motif, the tetrameric
formation of GABP on the DSE can be prohibited. When crude nuclear
extracts were incubated with these oligonucleotides, no complex I was
detected (data not shown).
To confirm that the complexes contain GABP, we used an oligonucleotide
as competitor containing the GABP-specific binding sites of the ICP-4
promoter (Fig. 4B, lanes 11-13), which was used
for the identification of GABP (36). This oligonucleotide competed as
efficiently as wild type Ets-related element A (ERE-A) for DSE-bound
protein complexes (Fig. 4B, lanes 2-4), whereas mutations in the Ets-core motif in either ERE-A or ERE-B
oligonucleotides abolished their ability to compete with labeled DSE
(Fig. 4B, lanes 5-10). Finally, incubation of
A3.01 nuclear extracts with specific anti-GABP-
or anti-GABP-
antibodies supershifted the complexes of A3.01 nuclear extracts (Fig.
4C, lanes 3 and 4, indicated by
ss).
These results suggest that GABP is the predominant DSE binding factor,
and complex I, which seemed to be responsible for the transcriptional
activity (38), was characterized as the tetrameric GABP complex.
Interestingly, the DNA binding activity of GABP seems not to be
regulated by stimulation with TPA, ionomycin, or their combination, as
no significant changes in DNA binding activity were observed when
nuclear extracts of unstimulated or stimulated A3.01 cells were used
for EMSA (Fig. 4A, lanes 15-18).
GABP Is Phosphorylated upon JNK/SAPK Stimulation in Vivo and by
JNK/SAPK in Vitro--
Because GABP is the predominant DSE-binding
factor and GABP binding sites are necessary for transactivation by Raf
and SPRK/MLK3, we tested whether GABP is a direct substrate not only
for mitogen-stimulated ERK (35, 55) but also for other MAPK family
members. We have shown that GABP factors are also phosphorylated
in vivo upon stimulation of HEK-293 cells with TPA and serum
(35). To study the effects of SAPK on phosphorylation of GABP in
vivo, this cell line was transfected with GABP-
and -
expression vectors alone or in combination with SAPK
expression
vector and metabolically labeled with
[32P]orthophosphate. Cells were treated with
anisomycin to strongly activate SAPK without affecting ERK activity.
Fig. 5 shows the autoradiography
(Fig. 5A) and corresponding immunoblot (Fig.
5B) of immune precipitated GABP subunits. We observed an
increased phosphorylation of both GABP subunits upon anisomycin
stimulation, which was further increased when SAPK
was
overexpressed, implicating a function in GABP phosphorylation.
Treatment of HEK-293 cells with anisomycin leads to SEK, JNK/SAPK, and
3pK activation as well as to p38 stimulation (44).
|
but not
Flag-tagged p38 phosphorylated both subunits of GABP (Fig.
6B). Bacterially expressed,
purified, and preactivated GST-SAPK
I also was able to phosphorylate
both GABP subunits in vitro like GST-c-Jun (Fig.
6C). Both activated SEK and 3pK did not phosphorylate GABP
(data not shown).
|
, in addition to p38 and ERK of untreated or TPA/ionomycin-stimulated A3.01 cells, was tested for their ability to
phosphorylate GABP factors in vitro (Fig. 6A).
Consistent with the above described data of the in vitro
kinase assays and with our transactivation data, ERK and JNK1 but not
p38 functioned as a GABP kinase (Fig. 6A).
The ability of three different isoforms of JNK/SAPK (SAPK
, -
, and
JNK1) to phosphorylate GABP in vitro, in combination with the in vivo phosphorylation of GABP upon SAPK activation by
anisomycin, suggests that GABP is targeted by JNK/SAPK-activating
pathways.
| |
DISCUSSION |
|---|
|
|
|---|
We characterized the Ets-core motifs of a distal IL-2 enhancer as a SPRK/MLK3-SEK-JNK/SAPK responsive element. In the TPA/ionomycin induction of the DSE activity, the JNK/SAPK activating pathway cooperates with the Raf-MEK-ERK signaling pathway. Block of both cascades almost abolished the induction, whereas activation of either of these signaling cascades is sufficient to induce DSE activity independently. Despite being activated, we observed no critical contribution of the MKK6-p38 pathway in DSE regulation. The DSE activity is strongly dependent on the Ets-core motifs, which are bound by GABP. Both subunits of GABP are phosphorylated upon JNK activation in vivo and three different isoforms of JNK/SAPK, but not p38, in vitro. These data suggest that ERK and JNK activation converge on GABP to regulate DSE activity, which enhances IL-2 induction (Fig. 7).
|
In our experimental study, we used SPRK/MLK3 as a JNK/SAPK activator. SPRK/MLK3 overexpression induced the IL-2 promoter/enhancer activity in A3.01 T cells (data not shown) and is a strong transactivator of the DSE. Interestingly, the SPRK/MLK3-induced DSE activity exceeded the induction by TPA/ionomycin (Fig. 1). Because SPRK/MLK3 activates SAPK to the same extent as TPA/ionomycin after 20 min of stimulation (Fig. 2), the difference might be explained by the duration of the signal. JNK/SAPK activity is triggered by TPA/ionomycin maximally after 20 min and returns to baseline activity after 2 h (data not shown). In contrast, SPRK/MLK3 overexpression leads to sustained high JNK activity (Fig. 2).
Employing a constitutively active kinase version of MKK6, we were not able to measure significant induction of DSE activity. In addition, neither an interfering kinase mutant of MKK6 nor the specific p38 inhibitor, SB203580, impaired the TPA/ionomycin-induced DSE activity. Although both JNK and p38 are stimulated by an overlapping spectrum of stimuli, activation of these kinases shows specific cellular responses. The specificity might be a consequence of the selective choice of the transcription factor mediating the kinase activity. We identified GABP as a target of JNK/SAPK, but not p38. C-Jun is another factor that is activated by JNK, which also has not yet been demonstrated to be phosphorylated by p38. Even though both JNK and p38 phosphorylate Elk, both kinases show different preferences for the phospho-acceptor sites (28). The elucidation of effectors, which are either targeted by JNK or p38, will provide further insights into the specificities of both pathways.
Interestingly, triggering of the ERK or JNK signal transduction pathway by overexpression of either constitutively active Raf or SPRK/MLK3, respectively, is sufficient to induce DSE activity (Fig. 3A). Two observations point to a cooperative mechanism of both pathways in TPA/ionomycin-induced DSE-dependent transcription. First, TPA/ionomycin-induced DSE activity is impaired by inhibition of JNK or ERK activation (Fig. 3B). Second, costimulation by TPA/ionomycin, which synergistically activate JNK but not ERK, significantly enhanced the DSE-driven transcription compared with the induction by TPA alone when only ERK is highly active (data not shown). Another example for a cooperation of diverse MAPKs has been elucidated for TCF activation by ERK and p38 in response to stress stimuli; however, the mechanism of cooperation is still unclear (28). In case of the GABP-responsive element, cooperation of ERK and JNK can occur via phosphorylation of diverse phospho-acceptor sites differentially contributing to the activity of GABP. Phosphorylation site mapping and mutational analysis will help to answer this question. However, the phospho-modification of GABP seems to be a complex mechanism, as both subunits of GABP contain multiple potential MAPK phosphorylation sites and are phosphorylated by ERK and JNK/SAPK on serine as well as on threonine residues (data not shown). On the other hand, cooperation may also occur at the level of the strength and duration of the MAPK activity. TPA/ionomycin costimulation might not activate ERK and JNK sufficiently for full induction of DSE activity. This also explains why either SPRK/MLK3 or membrane-targeted Raf-BXB is sufficient for strong DSE induction. The strong and constitutive activation of JNK by SPRK/MLK3 or ERK by Raf-BXB-CX might compensate for the missing activation of the unresponsive MAPK.
The most prominent candidate for linking phosphorylation cascades to transcriptional activity is the transcription factor GABP, as the DSE binding complexes of A3.01 nuclear extracts have been identified as monomeric, dimeric, and tetrameric GABP complexes (Fig. 4). Interestingly, the transcription factor is a target of two diverse MAPKs. However, other Ets family members such as Sap-1a (27) and PEA3 (29) have been described as substrates for mitogenic-induced ERK and stress-activated JNK/SAPKs. This implicates that signal convergence is an important mechanism in regulation of these transcription factors. The regulation of GABP by these kinase cascades is based on an as yet unidentified mechanism, as T cell stimulation neither modifies the subcellular localization of GABP subunits (not shown) nor dramatically changes the DSE binding complexes (Fig. 4). The regulation might involve changes in the intra- and intermolecular protein folding of the GABP complex, which might result in enhanced recruitment of RNA polymerase II transcriptional coactivators. A similar example is ERF, an Ets-family member with repressor functions. It has been identified as a target for ERK, in which ERK phosphorylation regulates its activity without affecting the DNA binding affinity (32).
Because GABP is ubiquitously expressed, we tested whether the regulation of DSE activity occurs also in non-T cell lines. Indeed, in the human embryonic kidney cell line HEK-293, the DSE activity also is up-regulated by constitutively active Raf and SPRK/MLK3 overexpression (data not shown), and GABP phosphorylation is induced upon TPA treatment in vivo (35), which activates ERK but not JNK/SAPK or p38 (44). In this study, we addressed the question whether GABP phosphorylation occurs in vivo, when JNK is active. To exclude the phosphorylation by ERK, we treated HEK-293 cells with the stress inducer anisomycin, which strongly up-regulates JNK/SAPK but does not affect ERK activity (44). Under these conditions, both subunits of GABP are induced phosphorylated and even more when SAPK was overexpressed. Also in NIH-3T3 fibroblasts (35) and pituitary GH4 cells (55), an induction of GABP-responsive elements occurs via extracellular stimuli. In this context, it might be interesting to test whether GABP-responsive promoters of house-keeping genes (54, 56) can be activated beyond the level of constitutive activity by triggering intracellular signaling events. In particular, GABP has been shown to regulate the expression of nuclear-encoded mitochondrial proteins, cytochrome oxidase subunits IV and Vb, and the mitochondrial transcription factor mtTF-1, which is constitutively expressed but can also be regulated in response to changes in the redox state of the cell (for example, by hypoxia). Hypoxia induces ERK, JNK, and p38 (57). This observation, combined with our finding that the GABP-responsive element is regulated by ERK and JNK, allows us to speculate that phosphoregulation of GABP mediates hypoxia-regulated expression of mitochondrial proteins involved in cellular respiration. Furthermore, several viruses such as herpes simplex virus 1 (36, 58), adenovirus (53), and Moloney murine leukemia virus (48) as well as human immunodeficiency virus 1 (35) recruit GABP for viral gene expression. Indeed, we observed an induced HIV-1 long terminal repeat activity when we overexpressed SPRK/MLK3 in A3.01 T cells.3 In the light of our observations that GABP is a shared target of ERK and JNK/SAPK, one might speculate that GABP converts diverse signals mediated by ERK and JNK/SAPK into induced gene expression.
| |
ACKNOWLEDGEMENTS |
|---|
We are very grateful to S. Ludwig for
dominant negative kinase versions of SAPK(K-R) and SEK(K-R), numerous
discussions, and reading the manuscript. We thank A. Gro
e-Wilde for
the support of subcloning of cDNAs in pRSPA vectors. The expression
vectors for RSV-
-gal, GST-SEK, GST-SAPK
, GST-SAPK
I,
GST-cJun(1-135), MKK6, SPRK/MLK3, Flag-p38, and ERK constructs were
kind gifts of T. Wirth, J. Kyriakis, J. Woodgett, R. Davis, J. Han, and
M. Cobb. Bacterially expressed and purified proteins of GABP-
and -
, GST-c-Jun(1-135), and 3pK(K-M) were kindly provided by J. Bruder, K. Kilian, and H. Häfner. We greatly appreciate helpful discussions with B. Baumann, B. Jordan, B. Neufeld, R. Schreck, and T. Wirth.
| |
FOOTNOTES |
|---|
* This work was supported by the Deutsche Forschungsgemeinschaft Sonderforschungsbereich 165 and DFG Grant We 2023/2-1.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by EC Grant (ERB-CIPA-CT-92-0108) for Cooperation in Science and Technology with Central and Eastern European Countries.
To whom correspondence should be addressed. Tel.:
49-931-201-5140; Fax: 49-931-201-3835; E-mail:
rappur{at}rzbox.uni-wuerzburg.de.
1 The abbreviations used are: MAPK, mitogen-activated protein kinase; GABP, GA-binding protein; IL-2, interleukin-2; DSE, dyad symmetry element; ERK, extracellular signal-regulated kinase; SAPK, stress-activated protein kinase; JNK, c-Jun N-terminal kinase; SEK, SAPK/ERK-kinase; MEK, MAPK/ERK kinase; MKK6, MAPK kinase 6; SPRK, SH3-domain-containing proline-rich kinase; MLK-3, mixed lineage kinase 3; FCS, fetal calf serum; DMEM, Dulbecco's modified Eagle's medium; MES, morpholinoethanesulfonic acid; tk, thymidine kinase; RSV, Rous sarcoma virus.
2 Flory, E., Weber, C. K., Chen, P., Hoffmeyer, A., Jassoy, C., and Rapp, U. R. (1998) J. Virol., in press.
3 A. Hoffmeyer and U. R. Rapp, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|