JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, Z. H.
Right arrow Articles by Jetten, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, Z. H.
Right arrow Articles by Jetten, A. M.

J Biol Chem, Vol. 273, Issue 18, 10948-10957, May 1, 1998


Regulation of Peroxisome Proliferator-activated Receptor alpha -Induced Transactivation by the Nuclear Orphan Receptor TAK1/TR4*

Zhong Hua YanDagger , Walid G. Karam§, Jeffrey L. Staudinger, Alexander MedvedevDagger , Burhan I. Ghanayem§, and Anton M. JettenDagger parallel

From the Dagger  Cell Biology Section, Laboratory of Pulmonary Pathobiology, § Laboratory of Pharmacology and Chemistry, NIEHS, National Institutes of Health and the  Department of Molecular Endocrinology, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina 27709

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Recently, we reported the cloning of the nuclear orphan receptor TAK1. In this study, we characterized the sequence requirements for optimal TAK1 binding and analyzed the repression of the peroxisome proliferator-activated receptor alpha  (PPARalpha ) signaling pathway by TAK1. Site selection analysis showed that TAK1 has the greatest affinity for direct repeat-1 response elements (RE) containing AGGTCAAAGGTCA (TAK1-RE) to which it binds as a homodimer. TAK1 is a very weak inducer of TAK1-RE-dependent transcriptional activation. We observed that TAK1, as PPARalpha , is expressed within rat hepatocytes and is able to bind the peroxisome proliferator response elements (PPREs) present in the promoter of the PPARalpha target genes rat enoyl-CoA hydratase (HD) and peroxisomal fatty acyl-CoA oxidase (ACOX). TAK1 is unable to induce PPRE-dependent transcriptional activation and represses PPARalpha -mediated transactivation through these elements in a dose-dependent manner. Two-hybrid analysis showed that TAK1 does not form heterodimers with either PPARalpha or retinoid X receptor (RXRalpha ), indicating that this repression does not involve a mechanism by which TAK1 titrates out PPARalpha or RXRalpha from PPAR·RXR complexes. Further studies demonstrated that the PPARalpha ligand 8(S)-hydroxyeicosatetraenoic acid strongly promotes the interaction of PPARalpha with the co-activator RIP-140 but decreases the interaction of PPARalpha with the co-repressor SMRT. In contrast, TAK1 interacts with RIP-140 but not with SMRT and competes with PPARalpha for RIP-140 binding. These observations indicated that the antagonistic effects of TAK1 on PPARalpha ·RXRalpha transactivation act at least at two levels in the PPARalpha signaling pathway: competition of TAK1 with PPARalpha ·RXR for binding to PPREs as well as to common co-activators, such as RIP-140. Our results suggest an important role for TAK1 in modulating PPARalpha -controlled gene expression in hepatocytes.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The nuclear receptor superfamily is comprised of a class of ligand-dependent transcription factors that regulate gene expression during many biological processes, including development, cellular proliferation, and differentiation (1-6). This superfamily includes receptors for steroid hormones, retinoids, and vitamin D and a large number of orphan receptors for which a ligand has not yet been identified (7-11). Nuclear receptors control the transcription of target genes by binding to DNA sequences known as hormone response elements (12-13). Most members of this superfamily bind as homodimers or heterodimers to cis-acting DNA sequences containing two core motifs RGGTCA configured in either a direct repeat (DR),1 a palindrome, or inverted palindrome separated by a spacer of different lengths (2, 8, 12-15). Nuclear receptors regulate gene expression through interaction with intermediary proteins (16-17), including the co-repressors SMRT and N-COR (18-20), the co-activators SRC-1 and RIP-140 (21-22), and the integrators p300 or CREB-binding protein (23-25). The interaction of receptors with many of these proteins is dependent on the presence or absence of ligand.

Recently, we reported the cloning of the nuclear orphan receptor TAK1, also known as TR4 (26), from human and mouse testis cDNA libraries (8, 27). The TAK1/TR4 gene generates two isoforms, alpha 1 and alpha 2, through alternative splicing (28-29). The alpha 1 isoform contains an additional 19 amino acids in the A/B region. Although the consensus response element (RE) for TAK1 binding has not been precisely defined, TAK1 has been reported to recognize a variety of response elements containing a direct repeat motif (14) through which TAK1 acts either as a suppressor or activator of gene transcription. TAK1 antagonizes retinoic acid receptor, RXR, and T3R-mediated transactivation (14), suppresses gene expression through the SV40 major late promoter (30), and induces transactivation of a reporter gene under the control of the human ciliary neurotrophic factor receptor alpha -DR1 site (31).

TAK1 is expressed in many tissues in a cell type- specific manner (8, 26-29). In this study, we show that TAK1 is highly expressed in rat hepatocytes that express several other nuclear receptors, including the peroxisome proliferator-activated receptor alpha  (PPARalpha ) and retinoid X receptor (RXR) (6, 32-37). In the liver, PPARalpha plays an important role in the regulation of the degradation of fatty acids and xenobiotics by microsomal omega -hydroxylation and peroxisomal beta -oxidation pathways (6, 38-40) and has been demonstrated to control the transcription of many genes, such as acyl-CoA oxidase (ACOX), cytochrome P-450 4A1 and 4A6, and enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (HD) (33, 41-48). Regulation of the expression of these genes by PPARalpha involves heterodimerization with RXR and is mediated through cis-acting peroxisome proliferator response elements (PPREs) consisting of a direct repeat of the core motif interspaced by one nucleotide (DR1) (49-53). Many agents, including a variety of peroxisome proliferators, fatty acids, and eicosanoids, such as 8(S)-HETE, bind to and/or activate PPARalpha (32, 34, 54-61).

In this study, we characterized the sequence requirements for the consensus TAK1 response element (TAK1-RE) and demonstrated that TAK1 homodimers bound with greatest affinity to REs containing a DR-1 motif. We showed that TAK1 and PPARalpha are co-expressed in hepatocytes and that both receptors recognize several DR1s, including TAK1-RE and PPREs of the ACOX and HD genes. However, in contrast to PPARalpha , TAK1 was unable to induce PPRE-dependent transcriptional activation. Moreover, TAK1 inhibited the PPRE-dependent transcriptional activation mediated by PPARalpha ·RXRalpha heterodimers. We demonstrated that this repression did not involve a mechanism by which TAK1 titrates out PPARalpha or RXRalpha from PPARalpha ·RXR complexes but was due to competition of TAK1 with PPARalpha ·RXRalpha for binding to PPREs and common co-activators, such as RIP140. These results suggest an important role for TAK1 in modulating PPARalpha -controlled gene expression in the liver.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Plasmids-- The expression vector pGEM3Z-TAK1 encoding hTAK1 has been described previously (14). The plasmid pcDNA3-TAK1 was created by inserting the XbaI-KpnI fragment of pGEM3Z-TAK1 containing the full-length TAK1 into the expression vector pcDNA3.1His (Invitrogen). The pSG5 expression vectors encoding mRXRalpha and hPPARalpha were gifts from Drs. P. Chambon (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Illkirch, France) and F. J. Gonzalez (NCI, National Institutes of Health, Bethesda) (33), respectively. The CAT reporter gene constructs (TAK1-RE)3-tk-CAT and HD-tk-CAT were generated by inserting three copies of consensus TAK1-RE (GGCAGAGGTCAAAGGTCAAACGT)3 or one copy of the rat enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (HD) gene PPRE TGTAGGTA-ATAGTTCAATAGGTCAAAGGAGAGGTGG into the HindIII and BamHI sites of pBLCAT5 (62). The reporter plasmid ACOX2-tk-CAT, which contains two copies of the rat peroxisomal fatty acyl-CoA oxidase (ACOX) gene PPRE, was a gift from Dr. J. Lehmann (Glaxo Wellcome, Research Triangle Park, NC). The pSG5-VP16-TAK1 expression plasmid encoding a fusion protein consisting of the VP16 activation domain and the full-length coding region of hTAK1 was created as follows. First, pBSK-TAK1-2 was created by inserting the EclXI and BamHI fragment of pGEM3Z-TAK1 into the Bsp120I and BamHI sites of pBluescript II SK. pSG5-VP16-TAK1 was then obtained by inserting the KpnI-XhoI fragment of pBSK-TAK1-2 into the same sites of pSG5-VP16. The pSG5-VP16, pSG5-Gal4(DBD)-hPPARalpha , and pSG5-VP16-mRXRalpha plasmid were obtained from Dr. J. Lehmann (54). The pSG5-Gal4-TAK1 chimera expression construct encodes a fusion protein between Gal4-DBD and the ligand binding domain of TAK1 (amino acids 181-596). The expression vector pSG5-VP16-PPARalpha was generated by inserting a PPARalpha fragment encoding amino acids 167-468 into the pSG5-VP16 vector. Expression vectors encoding the VP16-mRIP140 and VP16-mSMRT were generated by inserting the 2-kilobase pair XhoI fragment from pACT-mRIP140 into the SalI site of the vector pVP16 (CLONTECH) or the 1.8-kilobase pair BglII fragment from pACT-mSMRT into BamHI site of pVP16 vector, respectively.2 The pG5CAT reporter plasmid containing four copies of the GAL4 upstream activating sequence was purchased from CLONTECH.

Electrophoretic Mobility Shift Assay (EMSA)-- TNT lysate system (Promega) was used to synthesize hTAK1, mRXRalpha , and hPPARalpha proteins from pcDNA3-TAK1, pSG5-mRXRalpha , and pSG5-hPPARalpha plasmids. Oligonucleotide probes for EMSA were end-labeled with [gamma -32P]ATP by T4 polynucleotide kinase (Promega). EMSAs were carried out as described previously (63). Unprogrammed translations with TNT lysates were used as negative controls (not shown).

Identification of TAK1 Binding Sites-- Identification of the DNA binding sequences with the highest affinity for TAK1 was carried out as described previously (63). Briefly, a mixture of 70 base pairs of DNA fragments was synthesized by PCR using the degenerate oligomers 5'-CGCGGATCCTGCAGCTCGAGN12AGGTCAN12GTCGACAAGCTTCTAGAGCA as template and 5'-CGCGGATCCTGCAGCTCGAG and 5'-TGCTCTAGAAGCTTGTCGAC as forward and reverse primers, respectively. PCR amplification (Perkin-Elmer) was carried out using 20 pmol of oligomers, 100 pmol of 32P-end-labeled forward primer and 100 pmol of reverse primer for three cycles under the following conditions: 1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C for each cycle. The double-stranded mixed DNA fragments generated were purified and incubated with in vitro synthesized hTAK1, and complexes were analyzed by EMSA. A band corresponding to the TAK1-RE complexes was excised, and the DNA was eluted in TE buffer. Recovered DNA was amplified by PCR for 15 cycles and used for EMSA analysis with hTAK1 using the conditions described above. This procedure was repeated six times. In the seventh round, PCR products were cloned into the TA vector (Invitrogen). Inserts from individual white colonies were amplified and used in EMSA. DNA that competed in EMSA was subjected to sequence analysis. The sequences of 30 independent clones were analyzed.

Transactivation Assay-- COS-7, CV-1, or Chinese hamster ovary cells were plated at 2 × 105 cells/well 24 h prior to transfections in 6-well dishes containing RPMI, Dulbecco's modified Eagle's medium, or F-12 medium, respectively, containing 10% fetal bovine serum. Cells were transfected in Opti-MEM (Life Technologies, Inc.) with the expression vectors and the CAT/LUC reporter constructs indicated using LipofectAMINE (Life Technologies, Inc.) as described previously (63). The plasmid beta -actin-LUC was used as an internal control of transfection efficiency. Cells were collected 24 h after transfection, and CAT level was determined by the CAT enzyme-linked immunosorbent assay kit (Boehringer Mannheim) according to manufacturer's instructions. Luciferase activity was assayed with a Luciferase kit (Promega) in a Lumat LB9501 Luminometer (Berthold). Generally, transfections involving PPARalpha were done in medium containing delipidized serum (Sigma). After transfection, cells were treated for 24 h with 1 µM 8(S)-HETE or the RXR-selective retinoid SR 11217. The RXR-selective retinoid was obtained from Dr. M. Dawson, SRI, Menlo Park, CA.

Isolation of Hepatocytes and Northern Analysis-- Isolation and culture of rat hepatocytes was done as described previously (64). Cultures were treated with 10 µM Wy-14643 or Me2SO (0.1%) for 24 h. Total RNA was isolated using TriReagent (Sigma) according to manufacturer's directions. RNA (25 µg) was separated on a 1.2% formaldehyde agarose gel, blotted to Nytran membrane (Schleicher & Schuell), and hybridized to 32P-labeled probes for TAK1, PPARalpha , RIP-140, ACOX, or glyceraldehyde-3-phosphate dehydrogenase as described previously (65). Hybridizations were performed for 1-2 h at 68 °C using QuikHybTM reagent (Stratagene); blots were subsequently washed once with 2× SSC, 0.05% SDS at room temperature for 30 min, and then with 0.5 × SSC, 0.1% SDS at 65 °C for 30 min. Autoradiography was performed using with Hyperfilm-MP (Amersham Pharmacia Biotech) at -70 °C with double intensifying screens.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Identification of the Consensus DNA Binding Sequence for TAK1-- Although previous studies showed that TAK1 can bind a variety of direct repeat response elements (DR1-5) (14), the precise requirements for optimal binding of TAK1 had not been determined. To identify the consensus sequence of the response elements that bind TAK1 with the greatest affinity, a DNA-binding site selection strategy was employed based on a combination of PCR and EMSA. A mixture of degenerate oligonucleotides consisting of the fixed core motif AGGTCA, flanked upstream and downstream by 12 random nucleotides, was used in the initial PCR and EMSA (Fig. 1A). After six rounds of selection with in vitro synthesized TAK1 protein, a strong radiolabeled band consisting of TAK1-oligonucleotide complexes was observed by EMSA. The PCR products generated after the seventh selection were cloned into the TA vector and the sequences of 30 independent clones analyzed (Fig. 1A). Sequence analysis showed that in 23 clones the consensus sequence was determined by the nucleotides upstream from the fixed AGGTCA core motif, whereas in 7 clones, it was determined by nucleotides downstream of AGGTCA. The consensus sequence was calculated from these two sets of flanking sequences (Fig. 1B). This analysis demonstrated that DR1 is strongly preferred by TAK1 for high affinity binding. Both the upstream and downstream sequences yielded as consensus AGGTCA. The two bases of the 5'-flanking region of DR1 at positions -7 and -8 showed a slight preference for G and A, respectively. Adenosine was the preferred nucleotide spacing the two core motifs.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1.   Identification of the consensus sequence TAK1-RE. A DNA-binding site selection strategy based on a combination of PCR and EMSA was used as described under "Experimental Procedures." A, sequences of the 30-nucleotide-long fragments that bound TAK1 with high affinity identified in 30 independent clones. N12AGGTCAN12 are the degenerate oligonucleotides used at the start of the selection. The sequences within the boxes are the fixed core motif AGGTCA. B, calculation of the consensus TAK1-RE (CON. RE). The consensus sequence of the 7 nucleotides 5' of the fixed core motif was calculated from the first 23 sequences; those of the 3'-flanking sequence were calculated from the remaining seven sequences. The consensus further upstream and downstream (positions -7 to -11 and +7 to +11, respectively) was calculated from all 30 sequences. Numbers indicate frequency (percent) of a particular nucleotide at a given position. N indicates no strong requirement for a specific nucleotide.

Based on the sequence analysis detailed above, we synthesized the consensus TAK1 response element GGCAGAGGTCAAAGGTCAAACGT (named TAK1-RE) as well as a DR0, DR2, and DR3 with the same flanking sequences (Fig. 2A) and analyzed their ability to compete with 32P-TAK1-RE for TAK1 binding in EMSA. As shown in Fig. 2B, unlabeled TAK1-RE competed effectively with 32P-TAK1-RE for binding of TAK1. The DR0, DR2, and DR3 oligonucleotides exhibited reduced ability to compete with 32P-TAK1-RE for TAK1 binding, supporting the conclusion that TAK1 binds most strongly to DR1 response elements.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2.   Comparison of TAK1 binding to several DR elements. A, sequence of TAK1-RE, DR0, DR2, and DR3 used in EMSA. B, EMSA analysis using in vitro translated TAK1 and 32P-TAK1-RE as a probe and the unlabeled REs listed in A as competitors. Competitors were used at 5-, 25-, and 100-fold excess. EMSA was performed as described under "Experimental Procedures." Shifted bands were quantitated by phosphorimaging analysis, and the relative level was plotted below each lane. Results are representative of two independent experiments.

To analyze further the requirements for high affinity TAK1 binding, several mutations in the TAK1-RE sequence were made (Fig. 3A), and the ability of these oligonucleotides to compete with 32P-TAK1-RE for TAK1 binding was examined by EMSA. The oligonucleotides M1 and M4, in which the 5'-flanking sequence was altered, did not compete as well as did TAK1-RE (Fig. 3B). Mutation of the nucleotide between the two core motifs from A to C also slightly reduced the binding affinity of TAK1. These results indicated that although these nucleotides were preferred for optimal binding by TAK1, these positions are not critical for TAK1 binding. The nucleotide M3, which contains only one core motif, was a very weak competitor, suggesting that TAK1 has a very low affinity for REs containing a single core motif.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of various TAK1-RE mutations on TAK1 binding. A, sequences of mutated TAK1-REs. Arrows indicate the mutated positions in TAK1-RE. B, EMSA analysis of the ability of mutated TAK1-REs to compete with 32P-TAK1-RE for TAK1 binding. Competitors were used at 5-, 25-, and 100-fold excess. Shifted bands were quantitated by phosphorimaging analysis, and the relative level was plotted below each lane. Results are representative of two independent experiments.

TAK1-RE-dependent Transcriptional Activation by TAK1-- To examine whether TAK1 could induce TAK1-RE-dependent transactivation, the TAK1 expression vector pcDNA3-TAK1 and the (TAK1-RE)3-tk-CAT reporter plasmid were transfected into COS-7 cells and 24 h later assayed for CAT enzyme levels. A consistent 2-3-fold increase in CAT expression was measured compared with cells transfected with (TAK1-RE)3-tk-CAT reporter DNA only, indicating that TAK1 was a weak inducer of TAK1-RE-dependent transactivation (Fig. 4). Similar levels of transactivation were observed when cells were grown in delipidized serum indicating that serum lipids did not influence transactivation mediated by TAK1. Transfection with VP16-TAK1, encoding the activation domain of VP16 fused to the full coding region of TAK1, induced a dramatic increase in CAT expression through (TAK1-RE)3-tk-CAT in cells that were grown in either normal or delipidized serum. This suggests that the weak transactivation mediated by TAK1 was not due to its inability to bind to the TAK1-RE in cells (Fig. 4).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Analysis of the transactivation activity of TAK1 and VP16-TAK1. COS-7 cells were transfected with the reporter plasmid (TAK1-RE)3-tk-CAT (0.5 µg) and expression vectors pSG5-VP16-TAK1, pSG5-VP16 (0.5 µg), or pcDNA3-TAK1 (0.25, 0.5, or 1.0 µg). beta -Actin-LUC DNA (0.1 µg) served as an internal control. After 24 h cells were collected and assayed for CAT and LUC activity. The relative CAT activity was calculated and plotted. Solid bars, COS-7 grown in regular serum; hatched bars, cells grown in delipidized serum were plotted. 1st and 7th bars represent the basal activity of (TAK1-RE)3-tk-CAT reporter in regular and delipidated serum transfection, respectively. Results are representative of three independent experiments.

Co-expression of TAK1 and PPARalpha in Rat Hepatocytes-- Previous studies revealed that TAK1 is highly expressed in liver (8, 26). Northern blot analysis with RNA isolated from rat hepatocytes showed that TAK1 and PPARalpha are co-expressed in these cells (Fig. 5). Activation of PPARalpha , which plays an important role in the regulation of many genes in the liver, by the peroxisome proliferator Wy-14643 increased the expression of both PPARalpha and ACOX mRNA as has been shown previously (41-42). The level of TAK1 mRNA was not altered by Wy-14643, suggesting that TAK1 expression is not controlled by PPARalpha in these cells.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5.   Co-expression of TAK1, PPARalpha , and RIP-140 in rat hepatocytes. Total RNA was isolated from primary rat hepatocytes treated for 24 h with 10 µM Wy-14643 (WY) or Me2SO (DMSO) (0.1%). RNA (25 µg) was examined by Northern blot analysis using radiolabeled probes for TAK1, PPARalpha , ACOX, RIP-140, and glyceraldehyde-3-phosphate dehydrogenase (GPDH).

Interaction of TAK1 with PPREs-- Since TAK1 and PPARalpha are co-expressed in hepatocytes and the action of both receptors on target gene expression is mediated by DR1-like response elements (8, 28-29), we were interested in examining interactions between these two receptor signaling pathways. To identify a possible role for TAK1 in modulating the transcriptional activation by the PPARalpha signaling pathway, the binding of TAK1 to PPREs present in the promoter of two PPARalpha target genes, ACOX and HD, was analyzed. As shown in Fig. 6B, ACOX-PPRE and HD-PPRE were able to compete with 32P-TAK1-RE for TAK1 binding in EMSA; however, both PPREs demonstrated a lower affinity for TAK1 than did TAK1-RE. Fig. 6C shows a comparison between the binding of TAK1 and RXRalpha homodimers and PPARalpha ·RXRalpha heterodimers to radiolabeled TAK1-RE, ACOX-PPRE, and HD-PPRE. In contrast to TAK1 homodimers and PPARalpha ·RXRalpha heterodimers, which bound to all three REs, RXR homodimers bound effectively only to TAK1-RE. The two bands observed in the EMSA performed with PPARalpha , RXRalpha , and 32P-TAK1-RE (Fig. 6C, lane 4) represented the RXRalpha homodimer (upper band) and the PPARalpha ·RXRalpha complex (lower band). These results show that TAK1 and PPARalpha ·RXRalpha can recognize similar REs.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   Comparison of TAK1, PPARalpha , and RXRalpha binding to TAK1-RE, ACOX-PPRE, and HD-PPRE. A, comparison of TAK1-RE, ACOX-PPRE, and HD-PPRE. Underlined nucleotides indicate core motifs. B, EMSA analysis of the ability of TAK1-RE, ACOX-PPRE, and HD-PPRE to compete with 32P-TAK1-RE for TAK1 binding. Unlabeled oligonucleotides were added at 25-, 50-, and 100-fold excess. Shifted bands were quantitated by phosphorimaging analysis, and the relative level was plotted below each lane. C, comparison of the binding of TAK1 homodimers, RXRalpha homodimers, and PPARalpha ·RXRalpha heterodimers to 32P-TAK1-RE (lanes 1, 4, and 7), 32P-ACOX-PPRE (lanes 2, 5, and 6), and 32P-HD-PPRE (lanes 3, 6, and 9).

We next compared the transactivation potential of TAK1 and PPARalpha ·RXRalpha using CAT reporter plasmids controlled by the PPREs described above (Fig. 7). TAK1, which was a weak inducer of TAK1-RE-dependent transactivation, did not induce ACOX-PPRE- or HD-PPRE-dependent transactivation in COS-7 cells. In contrast, a VP16-TAK1 fusion protein was able to increase TAK-1-RE, ACOX-PPRE-, and HD-PPRE-dependent transactivation 18-, 7-, and 15-fold, respectively, confirming TAK1 binding to these PPREs. The PPARalpha ligand 8(S)-HETE induced TAK1-RE-, ACOX-PPRE-, and HD-PPRE-dependent transactivation of the CAT reporter by PPARalpha ·RXRalpha heterodimers about 10-, 18-, and 10-fold, respectively. The highest transactivation by PPARalpha ·RXRalpha was observed with ACOX-PPRE, whereas transactivation by TAK1-VP16 was greatest with TAK-1-RE and HD-PPRE. These results indicate that the relative level of transactivation induced by TAK1-VP16 and PPARalpha ·RXRalpha through these three elements are not equivalent and may reflect differences in the relative affinity of TAK1 and PPARalpha ·RXR complexes for these elements.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 7.   Comparison of the transcriptional activation by TAK1, VP16-TAK1, and PPARalpha ·RXRalpha through TAK1-RE, ACOX-PPRE, or HD-PPRE. COS-7 cells were transfected with a CAT reporter under the control of either TAK1-RE, ACOX-PPRE, or HD-PPRE and expression vector plasmid DNA encoding TAK1, VP16-TAK1, VP16, PPARalpha , or RXRalpha , as indicated in the Fig. After 24 h, cells were collected and analyzed for CAT/LUC activity, and relative CAT activity was plotted. Cells transfected with PPARalpha were treated with 1 µM 8(S)-HETE. Results are representative of two independent experiments. DR1-CAT, (TAK1-RE)3-tk-CAT; ACOX-CAT, (ACOX)2-tk-CAT; HD-CAT, HD-tk-CAT.

Inhibition of PPARalpha -mediated Transactivation by TAK1-- To determine if TAK1 could interfere with the regulation of gene expression mediated by PPARalpha , we analyzed the effect of TAK1 on TAK1-RE-, ACOX-PPRE-, and HD-PPRE-dependent transactivation of the CAT reporter gene by PPARalpha ·RXRalpha . Co-transfection of expression plasmids encoding TAK1 and PPARalpha ·RXRalpha into COS-7 (Fig. 8) showed that TAK1 was able to effectively antagonize PPARalpha -mediated transactivation. The induction of TAK1-RE-, ACOX-PPRE- and HD-PPRE-dependent transactivation of CAT by PPARalpha ·RXRalpha was repressed by TAK1 in a dose-dependent manner.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 8.   Inhibition of PPARalpha -mediated transcriptional activation by TAK1. COS-7 cells were transfected with the reporter plasmids (TAK1-RE)3-tk-CAT (DR1-CAT), (ACOX)2-tk-CAT (ACOX-CAT), or HD-tk-CAT (HD-CAT) and the expression vectors encoding PPARalpha , RXRalpha , and TAK1, as indicated in the figure. After transfection 1 µM 8(S)-HETE was added, and 24 h later cells were collected and assayed for CAT and LUC activity. TAK1 was co-transfected as a competitor to PPARalpha ·RXRalpha at 0.4, 0.8, and 1.2 µg. Relative CAT activity was plotted. Results are representative of two independent experiments.

TAK1 Forms Homodimers and Does Not Heterodimerize with RXRalpha or PPARalpha -- Cross-talk between the TAK1 and PPARalpha pathways may occur at several levels of the receptor signaling cascade. To determine whether the antagonistic action of TAK1 was related to competition for RXRalpha or PPARalpha binding, we examined by two-hybrid analysis whether TAK1 formed heterodimeric complexes with RXRalpha or PPARalpha . The expression vector Gal4-TAK1, encoding the fusion protein Gal4(DBD)-TAK1, was co-transfected with the pG5CAT reporter plasmid and either RXRalpha -VP16(AD), PPARalpha -VP16(AD), or TAK1-VP16(AD) into COS-7 cells, and the transactivation of CAT was analyzed. As shown in Fig. 9, cells transfected with Gal4-TAK1 and pG5CAT exhibited levels of CAT similar to that seen in cells transfected with pG5CAT only. Cells co-transfected with RXRalpha -VP16(AD) or PPARalpha -VP16(AD) also did not increase CAT above control levels. The presence of the RXR-selective ligand SR11217 or the PPARalpha ligand 8(S)-HETE had little effect on CAT levels. In contrast, co-transfection with TAK1-VP16(AD) increased CAT activity about 9-fold. These results showed that TAK1 does not form a heterodimer with RXRalpha or PPARalpha and confirmed the ability of TAK1 to form homodimers.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 9.   TAK1 homodimerizes and is unable to form heterodimeric complexes with RXRalpha or PPARalpha . The ability of the fusion protein Gal4-TAK1, comprising the ligand-binding domain of TAK1 and the DNA-binding domain of Gal4, to interact with the ligand-binding domain of TAK1, RXRalpha , or PPARalpha fused to the activation domain of VP16, was examined in COS-7 cells by determining the level of CAT activity from the reporter plasmid pG5-CAT. After transfection, cells transfected with PPARalpha or RXRalpha were treated with 1 µM 8(S)-HETE or 1 µM of the RXRalpha -selective ligand SR11217, respectively, as indicated. Results shown are representative of three independent experiments.

TAK1 Competes with PPARalpha for Binding of Co-activators-- The results described thus far suggest that the inhibition of PPARalpha ·RXRalpha -mediated transactivation by TAK1 is due at least in part to competition of TAK1 with PPARalpha ·RXRalpha for PPRE binding. However, gene regulation by nuclear receptors involves interactions with a number of other nuclear proteins, including co-repressors and co-activators (16). Competition of receptors for binding to these nuclear proteins is one mechanism by which nuclear receptor pathways interfere with one another (24). To examine whether such a mechanism applies to the antagonism between the TAK1 and PPARalpha signaling pathways, we first analyzed the interactions of TAK1 and PPARalpha with the co-repressor, SMRT (20), and the co-activator, RIP-140 (22, 66), using the mammalian two-hybrid system. In Fig. 5, we demonstrate that RIP-140, as TAK1 and PPARalpha , was expressed with TAK1 and PPARalpha in hepatocytes. The results in Fig. 10 show that TAK1 interacted with the co-activator RIP-140 but not with the co-repressor SMRT, whereas PPARalpha interacted with both RIP-140 or SMRT. In the absence of exogenous ligand, cells transfected with pG5CAT reporter plasmid plus Gal4-PPARalpha exhibited a low level of CAT expression, while co-transfection with VP16-RIP-140 increased CAT levels about 4-fold. Addition of 8(S)-HETE further increased the transactivation in these cells about 14-fold (Fig. 10B, 3rd and 4th bars). It is likely that the increase in transactivation by VP16-RIP-140 in the absence of exogenous ligand was due to the presence of low levels of ligand either synthesized by the cells or still remaining in the delipidized serum. Addition of 8(S)-HETE reduced CAT levels in cells co-transfected with Gal4-PPARalpha and VP16-SMRT (Fig. 10B, 5th and 6th bars) to levels similar to that of cells transfected with Gal4-PPARalpha only (Fig. 10B, 2nd bar). These results indicate that ligand binding promoted PPARalpha interaction with RIP-140 and inhibited PPARalpha binding to SMRT. To determine whether TAK1 was able to interfere with PPARalpha -mediated transactivation through squelching of RIP-140 activity, cells were co-transfected with the pG5-CAT reporter plasmid, Gal4-PPARalpha , VP16-RIP-140, and increasing amounts of TAK1. As shown in Fig. 10C, TAK1 inhibited the PPARalpha /VP16-RIP-140-mediated transactivation in a dose-dependent manner (4th and 5th bars) suggesting that TAK1 competes with PPARalpha for RIP-140 binding.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 10.   Interaction of TAK1 and PPARalpha with RIP-140 and SMRT. A, interaction of Gal4-TAK1 fusion protein with the C-terminal portion of RIP-140 or SMRT fused to the activating domain of VP16 was examined in Chinese hamster ovary, CV-1, and COS-7 cells by determining the (GAL4 upstream activating sequence)4-dependent transactivation of the CAT reporter (pG5-CAT), as indicated by +/-. 1st three bars represent the basal activity of pG5-CAT as a control. B, two-hybrid analysis of the interaction of Gal4-PPARalpha fusion protein with VP16-RIP-140 and VP16-SMRT in CV-1 cells in the presence or absence of 1 µM 8(S)-HETE. C, squelching of the interaction between Gal4-PPARalpha and VP16-RIP-140 by TAK1 in CV-1 cells. The plasmid pcDNA3-TAK1 (0.2 or 0.5 µg) was co-transfected with Gal4-PPARalpha and VP16-RIP-140 plasmids (0.5 µg each). Results are representative for two independent experiments.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In this study, we identified and characterized the consensus response element for the nuclear orphan receptor TAK1 (TAK1-RE) and the mechanisms by which TAK1 antagonizes PPARalpha -mediated transcriptional activation. Our results demonstrate that TAK1 has the greatest affinity for a DR1 repeat consisting of the consensus sequence GGCAGAGGTCAAAGGTCAAACGT (TAK1-RE). TAK1 can also bind response elements containing a direct repeat of the core motif interspaced by 0, 2, or 3 nucleotides (DR0, DR2, or DR3, respectively) but with a lower affinity than DR1 and does not bind well to a single core motif. Previous studies have demonstrated that TAK1 can also bind DR4 and DR5 response elements (14). Thus TAK1 can interact with a wide variety of response elements containing direct repeats and, in this regard, resembles COUP-TF which also has highest affinity for DR1 (4, 68). However, in contrast to COUP-TF, TAK1 does not interact with palindromic response elements (4, 14). Another characteristic TAK1 and COUP-TF have in common is that both can act as negative and positive regulators of transcription (14, 30-31, 66-70).

Previous studies showed that TAK1 is highly expressed in many tissues, including liver (8, 26, 28-29). In this study, we demonstrated that TAK1 is expressed in rat hepatocytes. These cells have been reported to express a variety of other nuclear receptors, including PPARalpha , RXR, COUP-TF, and HNF-4 (4, 6, 32-35, 40, 71). Several of these receptors bind either as a homodimer or as a heterodimeric complex with RXR to response elements containing DR1 motifs. This has instigated studies examining cross-talk between different nuclear receptor signaling pathways (14, 69-70, 72-73). Such interactions could take place at different levels of the receptor signaling cascade as follows: at the level of binding to common hormone response elements, at the level of receptor dimerization, or at the level of interactions with other nuclear proteins involved in transcriptional control. In this study, we analyzed the cross-talk between TAK1 and PPARalpha signaling pathways.

In liver, PPARalpha , in complex with RXR, regulates the transcription of many genes encoding various enzymes important in the microsomal omega -hydroxylation and peroxisomal beta -oxidation pathways (6, 38-40). In this study, we show that TAK1 and PPARalpha , which are co-expressed in hepatocytes, can bind common PPREs, including those present in the PPARalpha target genes ACOX and HD. However, in contrast to PPARalpha , TAK1 was unable to induce transactivation through these PPREs and strongly repressed PPARalpha -mediated transactivation through the ACOX- and HD-PPREs. Our results demonstrate that competition between TAK1 and PPARalpha for PPRE binding is one mechanism by which TAK1 can repress PPARalpha -mediated transactivation. Such a mechanism has also been implicated in the antagonism between TAK1 and RXR (14) and between COUP-TF and PPARalpha (69-70). Because an AT-rich 5'-flanking region in PPREs contributes to optimal binding of PPARalpha ·RXR (46), but not of TAK1 (Fig. 1 and 2) or RXR homodimers, TAK1 and RXR bind well to TAK1-REs but not very effectively to ACOX-PPREs or HD-PPREs in agreement with a previous study (46). Therefore, the extent and specificity by which PPRE-dependent transcription is suppressed by TAK1 will depend on the difference between the affinity of TAK1 and PPARalpha ·RXR for a particular PPRE and the levels of TAK1 and PPARalpha expressed in the cell.

Many nuclear receptors, including PPARalpha , form a heterodimeric complex with RXR (49-50, 52-53). TAK1 could suppress PPARalpha ·RXR-mediated transactivation by recruiting either RXR or PPARalpha into an inactive complex. Such an interplay has been reported to exist between the thyroid hormone receptor T3R and PPARalpha signaling pathways (74). Thyroid hormone inhibits PPRE-dependent transactivation of the LUC reporter by ciprofibrate as well the induction of several genes involved in peroxisomal beta -oxidation. This inhibition is related to competition of T3R with PPARalpha for RXR binding (squelching). Increased RXR has been shown to relieve this suppression of PPAR-mediated transactivation by T3R (74). Our results indicate that this mechanism is not implicated in the antagonism between TAK1 and PPARalpha since two-hybrid analysis showed that TAK1 was unable to interact with either PPARalpha or RXR whether the ligands for RXR or PPARalpha were present or not.

Regulation of gene transcription nuclear receptors involves interaction with the basal transcription machinery through many intermediary proteins. Such proteins can act as co-repressors, co-activators, or integrators (16-18, 21-23). As shown for several nuclear receptors, the absence of ligand stimulates the association of receptor with co-repressors, such as N-CoR or SMRT (18, 20), whereas the presence of ligand induces dissociation of the co-repressor and promotes interaction with co-activators, such as SRC-1, PBP, and RIP-140 (21-22, 76), as well as integrators such as CREB-binding protein (24). It is likely that nuclear receptors compete with each other for binding to these proteins. To examine whether such a mechanism could be involved in the antagonism between the TAK1 and the PPARalpha signaling pathways, the interactions of TAK1 and PPARalpha with the co-activator RIP-140 and co-repressor SMRT were examined. We show that PPARalpha is able to bind to both RIP-140 and SMRT, whereas TAK1 is only able to bind RIP-140. The PPARalpha ligand 8(S)-HETE inhibited interaction of PPARalpha with SMRT and increased interaction with RIP-140. Our results suggest that ligand binding, probably through a conformational change in PPARalpha , induces dissociation of the PPARalpha ·co-repressor complex and promotes interaction of PPARalpha with co-activators that leads to transcriptional activation of PPARalpha target genes. In addition, we show that TAK1 inhibits transactivation mediated through Gal4-PPARalpha and RIP-140-VP16, indicating that competition for co-activators is a valid mechanism by which TAK1 antagonizes the regulation of gene expression by PPARalpha . Recently a novel co-activator PBP was identified that interacts with PPARs in a ligand-dependent manner (75). Whether modulation of PPARalpha -mediated transcription by TAK1 also involves competition for this co-activator has to be determined.

Transcriptional regulation by nuclear receptors is complex involving not only interaction with many co-repressors and co-activators but also competition between receptors for the binding of REs and these transcription intermediary proteins. In addition, the transcriptional activity of nuclear receptors depends on the type of RE, promoter architecture, and cell context. Characterization of the functional domains of TAK1 will be required to more completely understand the molecular mechanisms underlying transcriptional repression by TAK1.

    ACKNOWLEDGEMENTS

We thank Dr. Jürgen Lehmann (Glaxo-Wellcome) for providing plasmids and technical suggestions regarding CV-1 cell transfections and Drs. D. Swope, D. Zhu, and S. Dou for their comments on the manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

parallel To whom correspondence should be addressed. Tel.: 919-541-2768; Fax: 919-541-4133; E-mail: jetten{at}niehs.nih.gov.

1 The abbreviations used are: DR, direct repeat; PPARalpha , proliferator-activated receptor alpha ; RE, response element(s); PPRE, peroxisome proliferator response elements; HD, enoyl-CoA hydratase; ACOX, fatty acyl-CoA oxidase; EMSA, electrophoretic mobility shift assay; RXR, retinoid X receptor; LUC, luciferase; CAT, chloramphenicol acetyltransferase; 8(S)-HETE, 8(S)-hydroxyeicosatetraenoic acid; COUP-TF, chicken ovalbumin upstream promoter-transcription factor; T3R, thyroid hormone receptor; m, mouse; h, human; PCR, polymerase chain reaction; CREB, cAMP response element binding protein.

2 J. L. Staudinger, manuscript in preparation.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. De Luca, L. M. (1991) FASEB J. 5, 2924-2933[Abstract]
  2. Giguère, V. (1994) Endocr. Rev. 15, 61-79[CrossRef][Medline] [Order article via Infotrieve]
  3. Kastner, P., Mark, M., and Chambon, P. (1995) Cell 83, 859-869[CrossRef][Medline] [Order article via Infotrieve]
  4. Qui, Y., Tsai, S. Y., and Tsai, M.-J. (1994) Trends Endocrinol. Metab. 5, 234-239[Medline] [Order article via Infotrieve]
  5. Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994) Cell 79, 1147-1156[CrossRef][Medline] [Order article via Infotrieve]
  6. Schoonjans, K., Staels, B., and Auwerx, J. (1996) Biochim. Biophys. Acta 1302, 93-109[Medline] [Order article via Infotrieve]
  7. Evans, R. M. (1988) Science 240, 889-895[Abstract/Free Full Text]
  8. Hirose, T., Fujimoto, W., Yamaai, T., Kim, K. H., Matsuura, H., and Jetten, A. M. (1994) Mol. Endocrinol. 8, 1667-1680[Abstract]
  9. Laudet, V., Hanni, C., Coll, J., Catzeflis, F., and Stehelin, D. (1992) EMBO J. 11, 1003-1013[Medline] [Order article via Infotrieve]
  10. Escriva, H., Safi, R., Hanni, C., Langlois, M.-C., Saumitou-Laprade, P., Stehelin, D., Capron, A., Pierce, R., and Laudet, V. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 6803-6808[Abstract/Free Full Text]
  11. Ribeiro, R. C. J., Kusher, P. J., and Baxter, J. D. (1995) Annu. Rev. Med. 46, 443-453[CrossRef][Medline] [Order article via Infotrieve]
  12. Glass, C. K. (1994) Endocr. Rev. 15, 391-407[CrossRef][Medline] [Order article via Infotrieve]
  13. Truss, M., and Beato, M. (1993) Endocr. Rev. 14, 459-479[Abstract]
  14. Hirose, T., Apfel, R., Pfahl, M., and Jetten, A. M. (1995) Biochem. Biophys. Res. Commun. 211, 83-91[CrossRef][Medline] [Order article via Infotrieve]
  15. Mangelsdorf, D. J., and Evans, R. M. (1995) Cell 83, 841-850[CrossRef][Medline] [Order article via Infotrieve]
  16. Horwitz, K. B., Jackson, T. A., Bain, D. L., Richer, J. K., Takimoto, G. S., and Tung, L. (1996) Mol. Endocrinol. 10, 1167-1177[Abstract]
  17. Le Douarin, B., Nielsen, A. L., Garnier, J.-M., Ichinose, H., Jeanmougin, F., Losson, R., and Chambon, P. (1996) EMBO J. 15, 6701-6715[Medline] [Order article via Infotrieve]
  18. Hörlein, A. J., Näär, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Söderström, M., Glass, C. K., and Rosenfeld, M. G. (1995) Nature 377, 397-404[CrossRef][Medline] [Order article via Infotrieve]
  19. Kurokawa, R., Soderstrom, M., Horlein, A., Halachmi, S., Brown, M., Rosenfeld, M. G., and Glass, C. K. (1995) Nature 377, 451-454[CrossRef][Medline] [Order article via Infotrieve]
  20. Chen, J. D., and Evans, R. M. (1995) Nature 377, 454-457[CrossRef][Medline] [Order article via Infotrieve]
  21. Onate, S. A., Tsai, S. Y., Tsai, M.-J., and O'Malley, B. W. (1995) Science 270, 1354-1357[Abstract/Free Full Text]
  22. Cavailles, V., Dauvois, S., L'Illorset, F., Lopex, G., Hoarc, S., Kushner, P. J., and Parker, M. G. (1995) EMBO J. 14, 3741-3751[Medline] [Order article via Infotrieve]
  23. Hanstein, B., Eckner, R., DiRenzo, J., Halachmi, S., Liu, H., Searcy, B., Kurokawa, R., and Brown, M. (1996) Proc. Natl. Acad. Sci. U. S. A. 91, 10009-10013[Abstract/Free Full Text]
  24. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S.-C., Heyman, R., Rose, D., Glass, C., and Rosenfeld, M. (1996) Cell 85, 1-12[CrossRef][Medline] [Order article via Infotrieve]
  25. Chakravarti, D., LaMorte, V. J., Nelson, M. C., Nakajima, T., Schulman, I. G., Juguilon, H., Montminy, M., and Evans, R. M. (1996) Nature 383, 99-103[CrossRef][Medline] [Order article via Infotrieve]
  26. Chang, C., Lopes da Silva, S., Ideta, R., Lee, Y., Yeh, S., and Burbach, J. P. H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6040-6044[Abstract/Free Full Text]
  27. Hirose, T., O'Brien, D. A., and Jetten, A. M. (1995) Gene (Amst.) 163, 239-242[CrossRef][Medline] [Order article via Infotrieve]
  28. Yoshikawa, T., DuPont, B. R., Leach, R. J., and Detera-Wadleigh, S. D. (1996) Genomics 35, 361-366[CrossRef][Medline] [Order article via Infotrieve]
  29. Yoshikawa, T., Makino, S., Gao, X., Xing, G., Chuang, D., and Detera-Wadleigh, S. D. (1996) Endocrinology 137, 1562-1571[Abstract]
  30. Lee, H., Lee, Y., Burbach, J. P. H., and Chang, C. (1995) J. Biol. Chem. 270, 30129-30133[Abstract/Free Full Text]
  31. Young, W. J., Smith, S. M., and Chang, C. (1997) J. Biol. Chem. 272, 3109-3116[Abstract/Free Full Text]
  32. Keller, H., Dreyer, C., Medin, J., Mahfoudi, A., Ozato, K., and Wahli, W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2160-2164[Abstract/Free Full Text]
  33. Sher, T., Yi, H.-F., McBride, O. W., and Gonzalez, F. J. (1993) Biochemistry 32, 5598-5604[CrossRef][Medline] [Order article via Infotrieve]
  34. Issemann, I., and Green, S. (1990) Nature 347, 645-650[CrossRef][Medline] [Order article via Infotrieve]
  35. Braissant, O., Foufelle, F., Scotto, C., Dauca, M., and Wahli, W. (1996) Endocrinology 137, 354-366[Abstract]
  36. Zhu, Y., Alvarez, K., Huang, Q., Rao, S. M., and Reddy, J. K. (1993) J. Biol. Chem. 268, 26817-26820[Abstract/Free Full Text]
  37. Gonzalez, F. J. (1997) Biochimie (Paris) 79, 139-144[Medline] [Order article via Infotrieve]
  38. Desvergne, B., and Wahli, W. (1995) in Inducible Gene Expression (Baeuerle, P., ed), Vol. 1, pp. 142-176, Birkhäuser, Boston
  39. Wahli, W., Braissant, O., and Desvergne, B. (1995) Chem. Biol. 2, 261-266[CrossRef][Medline] [Order article via Infotrieve]
  40. Reddy, J. K., and Mannaerts, G. P. (1994) Annu. Rev. Nutr. 14, 343-370[CrossRef][Medline] [Order article via Infotrieve]
  41. Dreyer, C., Krey, G., Keller, H., Givel, F., Helftenbein, G., and Wahli, W. (1992) Cell 68, 879-887[CrossRef][Medline] [Order article via Infotrieve]
  42. Tugwood, J. D., Issemann, I., Anderson, R. G., Bundell, K. R., McPheat, W. L., and Green, S. (1992) EMBO J. 11, 433-439[Medline] [Order article via Infotrieve]
  43. Zhang, B., Marcus, S. L., Sajjadi, F. G., Alvares, K., Reddy, J. K., Subramani, S., Rachubinski, R. A., and Capone, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7541-7545[Abstract/Free Full Text]
  44. Zhang, B., Marcus, S. L., Miyata, K. S., Subramani, S., Capone, J. P., and Rachubinski, R. A. (1993) J. Biol. Chem. 268, 12939-12945[Abstract/Free Full Text]
  45. Muerhoff, A. S., Griffin, K. J., and Johnson, E. F. (1992) J. Biol. Chem. 267, 19051-19053[Abstract/Free Full Text]
  46. Palmer, C. N. A., Hsu, M.-H., Muerhoff, A. S., Griffin, K. J., and Johnson, E. F. (1994) J. Biol. Chem. 269, 18083-18089[Abstract/Free Full Text]
  47. Varanasi, U., Chu, R., Huang, Q., Castellon, R., Yeldandi, A. V., and Reddy, J. K. (1996) J. Biol. Chem. 271, 2147-2155[Abstract/Free Full Text]
  48. Krey, G., Mahfoudi, A., and Wahli, W. (1995) Mol. Endocrinol. 9, 219-231[Abstract]
  49. Kliewer, S. A., Forman, B. M., Blumberg, B., Ong, E. S., Borgmeyer, U., Mangelsdorf, D. J., and Evans, R. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7355-7359[Abstract/Free Full Text]
  50. Marcus, S. L., Miyata, K. S., Zhang, B., Rachubinski, R. A., and Capone, J. P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5723-5727[Abstract/Free Full Text]
  51. Palmer, C. N. A., Hsu, M.-H., Griffin, K. J., and Johnson, E. F. (1995) J. Biol. Chem. 270, 16114-16121[Abstract/Free Full Text]
  52. Chu, R., Lin, Y., Rao, M. S., and Reddy, J. K. (1995) J. Biol. Chem. 270, 29636-29639[Abstract/Free Full Text]
  53. Gearing, K. L., Gottlicher, M., Teboul, M., Widmark, E., and Gustafsson, J.-A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1440-1444[Abstract/Free Full Text]
  54. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) J. Biol. Chem. 270, 12953-12956[Abstract/Free Full Text]
  55. Forman, B. M., Chen, J., and Evans, R. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4312-4317[Abstract/Free Full Text]
  56. Kliewer, S. A., Sundseth, S. S., Jones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4318-4323[Abstract/Free Full Text]
  57. Martin, G., Schoonjans, K., Lefebvre, A.-M., Staels, B., and Auwerx, J. (1997) J. Biol. Chem. 272, 28210-28217[Abstract/Free Full Text]
  58. Göttlicher, M., Widmark, E., Li, Q., and Gustafsson, J.-A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4653-4657[Abstract/Free Full Text]
  59. Keller, H., and Wahli, W. (1993) Trends Endocrinol. Metab. 4, 291-296
  60. Bocos, C., Gottlicher, M., Gearing, K., Banner, C., Enmark, E., Teboul, M., Crickmore, A., and Gustafsson, J.-A. (1995) J. Steroid Biochem. Mol. Biol. 53, 467-473[CrossRef][Medline] [Order article via Infotrieve]
  61. Krey, G., Braissant, O., L'Horset, F., Kalkhoven, E., Perroud, M., Parker, M. G., and Wahli, W. (1997) Mol. Endocrinol. 11, 779-791[Abstract/Free Full Text]
  62. Boshart, M., Klüppel, M., Schmidt, A., Schütz, G., and Luckow, B. (1992) Gene (Amst.) 110, 129-130[CrossRef][Medline] [Order article via Infotrieve]
  63. Yan, Z. H., Medvedev, A., Hirose, T., Gotoh, H., and Jetten, A. M. (1997) J. Biol. Chem. 272, 10565-10572[Abstract/Free Full Text]
  64. Karam, W. G., and Ghanayem, B. I. (1997) Carcinogenesis 18, 2077-2083[Abstract/Free Full Text]
  65. Adachi, H., Dawson, M. I., and Jetten, A. M. (1996) Mol. Cell. Differ. 4, 365-381
  66. Joyeux, A., Cavailles, V., Balaguer, P., and Nicolas, J. C. (1997) Mol. Endocrinol. 11, 193-202[Abstract/Free Full Text]</