J Biol Chem, Vol. 273, Issue 18, 10948-10957, May 1, 1998
Regulation of Peroxisome Proliferator-activated Receptor
-Induced Transactivation by the Nuclear Orphan Receptor
TAK1/TR4*
Zhong Hua
Yan
,
Walid G.
Karam§,
Jeffrey L.
Staudinger¶,
Alexander
Medvedev
,
Burhan I.
Ghanayem§, and
Anton M.
Jetten
From the
Cell Biology Section, Laboratory of
Pulmonary Pathobiology, § Laboratory of Pharmacology and
Chemistry, NIEHS, National Institutes of Health and the
¶ Department of Molecular Endocrinology, Glaxo Wellcome Research
and Development,
Research Triangle Park, North Carolina 27709
 |
ABSTRACT |
Recently, we reported the cloning of the nuclear
orphan receptor TAK1. In this study, we characterized the sequence
requirements for optimal TAK1 binding and analyzed the repression of
the peroxisome proliferator-activated receptor
(PPAR
) signaling
pathway by TAK1. Site selection analysis showed that TAK1 has the
greatest affinity for direct repeat-1 response elements (RE) containing AGGTCAAAGGTCA (TAK1-RE) to which it binds as a homodimer. TAK1 is a
very weak inducer of TAK1-RE-dependent transcriptional
activation. We observed that TAK1, as PPAR
, is expressed within rat
hepatocytes and is able to bind the peroxisome proliferator response
elements (PPREs) present in the promoter of the PPAR
target genes
rat enoyl-CoA hydratase (HD) and peroxisomal fatty acyl-CoA
oxidase (ACOX). TAK1 is unable to induce
PPRE-dependent transcriptional activation and represses
PPAR
-mediated transactivation through these elements in a
dose-dependent manner. Two-hybrid analysis showed that TAK1
does not form heterodimers with either PPAR
or retinoid X receptor
(RXR
), indicating that this repression does not involve a mechanism
by which TAK1 titrates out PPAR
or RXR
from PPAR·RXR complexes.
Further studies demonstrated that the PPAR
ligand
8(S)-hydroxyeicosatetraenoic acid strongly promotes the
interaction of PPAR
with the co-activator RIP-140 but decreases the
interaction of PPAR
with the co-repressor SMRT. In contrast, TAK1
interacts with RIP-140 but not with SMRT and competes with PPAR
for
RIP-140 binding. These observations indicated that the antagonistic
effects of TAK1 on PPAR
·RXR
transactivation act at least at two
levels in the PPAR
signaling pathway: competition of TAK1 with
PPAR
·RXR for binding to PPREs as well as to common co-activators,
such as RIP-140. Our results suggest an important role for TAK1 in
modulating PPAR
-controlled gene expression in hepatocytes.
 |
INTRODUCTION |
The nuclear receptor superfamily is comprised of a class of
ligand-dependent transcription factors that regulate gene
expression during many biological processes, including development,
cellular proliferation, and differentiation (1-6). This superfamily
includes receptors for steroid hormones, retinoids, and vitamin D and a large number of orphan receptors for which a ligand has not yet been
identified (7-11). Nuclear receptors control the transcription of
target genes by binding to DNA sequences known as hormone response elements (12-13). Most members of this superfamily bind as homodimers or heterodimers to cis-acting DNA sequences containing two core motifs
RGGTCA configured in either a direct repeat
(DR),1 a palindrome, or
inverted palindrome separated by a spacer of different lengths (2, 8,
12-15). Nuclear receptors regulate gene expression through interaction
with intermediary proteins (16-17), including the co-repressors SMRT
and N-COR (18-20), the co-activators SRC-1 and RIP-140 (21-22), and
the integrators p300 or CREB-binding protein (23-25). The interaction
of receptors with many of these proteins is dependent on the presence
or absence of ligand.
Recently, we reported the cloning of the nuclear orphan receptor TAK1,
also known as TR4 (26), from human and mouse testis cDNA libraries
(8, 27). The TAK1/TR4 gene generates two isoforms,
1 and
2, through alternative splicing (28-29). The
1 isoform contains
an additional 19 amino acids in the A/B region. Although the consensus
response element (RE) for TAK1 binding has not been precisely defined,
TAK1 has been reported to recognize a variety of response elements
containing a direct repeat motif (14) through which TAK1 acts either as
a suppressor or activator of gene transcription. TAK1 antagonizes
retinoic acid receptor, RXR, and T3R-mediated transactivation (14),
suppresses gene expression through the SV40 major late promoter (30),
and induces transactivation of a reporter gene under the control of the
human ciliary neurotrophic factor receptor
-DR1 site (31).
TAK1 is expressed in many tissues in a cell type- specific manner (8,
26-29). In this study, we show that TAK1 is highly expressed in rat
hepatocytes that express several other nuclear receptors, including the
peroxisome proliferator-activated receptor
(PPAR
) and retinoid X
receptor (RXR) (6, 32-37). In the liver, PPAR
plays an important
role in the regulation of the degradation of fatty acids and
xenobiotics by microsomal
-hydroxylation and peroxisomal
-oxidation pathways (6, 38-40) and has been demonstrated to control
the transcription of many genes, such as acyl-CoA oxidase (ACOX), cytochrome P-450 4A1 and 4A6, and enoyl-CoA
hydratase/3-hydroxyacyl-CoA dehydrogenase (HD) (33, 41-48).
Regulation of the expression of these genes by PPAR
involves
heterodimerization with RXR and is mediated through cis-acting
peroxisome proliferator response elements (PPREs) consisting of a
direct repeat of the core motif interspaced by one nucleotide (DR1)
(49-53). Many agents, including a variety of peroxisome proliferators,
fatty acids, and eicosanoids, such as 8(S)-HETE, bind to
and/or activate PPAR
(32, 34, 54-61).
In this study, we characterized the sequence requirements for the
consensus TAK1 response element (TAK1-RE) and demonstrated that TAK1
homodimers bound with greatest affinity to REs containing a DR-1 motif.
We showed that TAK1 and PPAR
are co-expressed in hepatocytes and
that both receptors recognize several DR1s, including TAK1-RE and PPREs
of the ACOX and HD genes. However, in contrast to
PPAR
, TAK1 was unable to induce PPRE-dependent
transcriptional activation. Moreover, TAK1 inhibited the
PPRE-dependent transcriptional activation mediated by
PPAR
·RXR
heterodimers. We demonstrated that this repression did
not involve a mechanism by which TAK1 titrates out PPAR
or RXR
from PPAR
·RXR complexes but was due to competition of TAK1 with
PPAR
·RXR
for binding to PPREs and common co-activators, such as
RIP140. These results suggest an important role for TAK1 in modulating
PPAR
-controlled gene expression in the liver.
 |
EXPERIMENTAL PROCEDURES |
Plasmids--
The expression vector pGEM3Z-TAK1 encoding
hTAK1 has been described previously (14). The plasmid pcDNA3-TAK1
was created by inserting the XbaI-KpnI fragment
of pGEM3Z-TAK1 containing the full-length TAK1 into the expression
vector pcDNA3.1His (Invitrogen). The pSG5 expression vectors
encoding mRXR
and hPPAR
were gifts from Drs. P. Chambon (Institut
de Genetique et de Biologie Moleculaire et Cellulaire, Illkirch,
France) and F. J. Gonzalez (NCI, National Institutes of Health,
Bethesda) (33), respectively. The CAT reporter gene constructs
(TAK1-RE)3-tk-CAT and HD-tk-CAT were generated by inserting
three copies of consensus TAK1-RE
(GGCAGAGGTCAAAGGTCAAACGT)3 or one copy of the rat enoyl-CoA
hydratase/3-hydroxyacyl-CoA dehydrogenase (HD) gene PPRE
TGTAGGTA-ATAGTTCAATAGGTCAAAGGAGAGGTGG into the HindIII and
BamHI sites of pBLCAT5 (62). The reporter plasmid ACOX2-tk-CAT, which contains two copies of the rat peroxisomal fatty
acyl-CoA oxidase (ACOX) gene PPRE, was a gift from Dr. J. Lehmann (Glaxo Wellcome, Research Triangle Park, NC). The
pSG5-VP16-TAK1 expression plasmid encoding a fusion protein consisting
of the VP16 activation domain and the full-length coding region of
hTAK1 was created as follows. First, pBSK-TAK1-2 was created by
inserting the EclXI and BamHI fragment of
pGEM3Z-TAK1 into the Bsp120I and BamHI sites of
pBluescript II SK. pSG5-VP16-TAK1 was then obtained by inserting the
KpnI-XhoI fragment of pBSK-TAK1-2 into the same sites of pSG5-VP16. The pSG5-VP16, pSG5-Gal4(DBD)-hPPAR
, and pSG5-VP16-mRXR
plasmid were obtained from Dr. J. Lehmann (54). The
pSG5-Gal4-TAK1 chimera expression construct encodes a fusion protein
between Gal4-DBD and the ligand binding domain of TAK1 (amino acids
181-596). The expression vector pSG5-VP16-PPAR
was generated by
inserting a PPAR
fragment encoding amino acids 167-468 into the
pSG5-VP16 vector. Expression vectors encoding the VP16-mRIP140 and
VP16-mSMRT were generated by inserting the 2-kilobase pair XhoI fragment from pACT-mRIP140 into the SalI
site of the vector pVP16 (CLONTECH) or the
1.8-kilobase pair BglII fragment from pACT-mSMRT into
BamHI site of pVP16 vector,
respectively.2 The pG5CAT
reporter plasmid containing four copies of the GAL4 upstream activating
sequence was purchased from CLONTECH.
Electrophoretic Mobility Shift Assay (EMSA)--
TNT lysate
system (Promega) was used to synthesize hTAK1, mRXR
, and hPPAR
proteins from pcDNA3-TAK1, pSG5-mRXR
, and pSG5-hPPAR
plasmids. Oligonucleotide probes for EMSA were end-labeled with [
-32P]ATP by T4 polynucleotide kinase (Promega). EMSAs
were carried out as described previously (63). Unprogrammed
translations with TNT lysates were used as negative controls (not
shown).
Identification of TAK1 Binding Sites--
Identification of the
DNA binding sequences with the highest affinity for TAK1 was carried
out as described previously (63). Briefly, a mixture of 70 base pairs
of DNA fragments was synthesized by PCR using the degenerate oligomers
5'-CGCGGATCCTGCAGCTCGAGN12AGGTCAN12GTCGACAAGCTTCTAGAGCA as template and 5'-CGCGGATCCTGCAGCTCGAG and 5'-TGCTCTAGAAGCTTGTCGAC as forward and reverse primers, respectively. PCR amplification (Perkin-Elmer) was carried out using 20 pmol of oligomers, 100 pmol of
32P-end-labeled forward primer and 100 pmol of reverse
primer for three cycles under the following conditions: 1 min at
94 °C, 1 min at 55 °C, and 1 min at 72 °C for each cycle. The
double-stranded mixed DNA fragments generated were purified and
incubated with in vitro synthesized hTAK1, and complexes
were analyzed by EMSA. A band corresponding to the TAK1-RE complexes
was excised, and the DNA was eluted in TE buffer. Recovered DNA was
amplified by PCR for 15 cycles and used for EMSA analysis with hTAK1
using the conditions described above. This procedure was repeated six times. In the seventh round, PCR products were cloned into the TA
vector (Invitrogen). Inserts from individual white colonies were
amplified and used in EMSA. DNA that competed in EMSA was subjected to
sequence analysis. The sequences of 30 independent clones were
analyzed.
Transactivation Assay--
COS-7, CV-1, or Chinese hamster ovary
cells were plated at 2 × 105 cells/well 24 h
prior to transfections in 6-well dishes containing RPMI, Dulbecco's
modified Eagle's medium, or F-12 medium, respectively, containing 10%
fetal bovine serum. Cells were transfected in Opti-MEM (Life
Technologies, Inc.) with the expression vectors and the CAT/LUC
reporter constructs indicated using LipofectAMINE (Life Technologies,
Inc.) as described previously (63). The plasmid
-actin-LUC was used
as an internal control of transfection efficiency. Cells were collected
24 h after transfection, and CAT level was determined by the CAT
enzyme-linked immunosorbent assay kit (Boehringer Mannheim) according
to manufacturer's instructions. Luciferase activity was assayed with a
Luciferase kit (Promega) in a Lumat LB9501 Luminometer (Berthold).
Generally, transfections involving PPAR
were done in medium
containing delipidized serum (Sigma). After transfection, cells were
treated for 24 h with 1 µM 8(S)-HETE or
the RXR-selective retinoid SR 11217. The RXR-selective retinoid was
obtained from Dr. M. Dawson, SRI, Menlo Park, CA.
Isolation of Hepatocytes and Northern Analysis--
Isolation
and culture of rat hepatocytes was done as described previously (64).
Cultures were treated with 10 µM Wy-14643 or
Me2SO (0.1%) for 24 h. Total RNA was isolated using
TriReagent (Sigma) according to manufacturer's directions. RNA (25 µg) was separated on a 1.2% formaldehyde agarose gel, blotted to
Nytran membrane (Schleicher & Schuell), and hybridized to
32P-labeled probes for TAK1, PPAR
, RIP-140, ACOX, or
glyceraldehyde-3-phosphate dehydrogenase as described previously (65).
Hybridizations were performed for 1-2 h at 68 °C using
QuikHybTM reagent (Stratagene); blots were subsequently
washed once with 2× SSC, 0.05% SDS at room temperature for 30 min,
and then with 0.5 × SSC, 0.1% SDS at 65 °C for 30 min.
Autoradiography was performed using with Hyperfilm-MP (Amersham
Pharmacia Biotech) at
70 °C with double intensifying screens.
 |
RESULTS |
Identification of the Consensus DNA Binding Sequence for
TAK1--
Although previous studies showed that TAK1 can bind a
variety of direct repeat response elements (DR1-5) (14), the precise requirements for optimal binding of TAK1 had not been determined. To
identify the consensus sequence of the response elements that bind TAK1
with the greatest affinity, a DNA-binding site selection strategy was
employed based on a combination of PCR and EMSA. A mixture of
degenerate oligonucleotides consisting of the fixed core motif AGGTCA,
flanked upstream and downstream by 12 random nucleotides, was used in
the initial PCR and EMSA (Fig.
1A). After six rounds of
selection with in vitro synthesized TAK1 protein, a strong
radiolabeled band consisting of TAK1-oligonucleotide complexes was
observed by EMSA. The PCR products generated after the seventh
selection were cloned into the TA vector and the sequences of 30 independent clones analyzed (Fig. 1A). Sequence analysis showed that in 23 clones the consensus sequence was determined by the
nucleotides upstream from the fixed AGGTCA core motif, whereas in 7 clones, it was determined by nucleotides downstream of AGGTCA. The
consensus sequence was calculated from these two sets of flanking
sequences (Fig. 1B). This analysis demonstrated that DR1 is
strongly preferred by TAK1 for high affinity binding. Both the
upstream and downstream sequences yielded as consensus AGGTCA.
The two bases of the 5'-flanking region of DR1 at positions
7 and
8
showed a slight preference for G and A, respectively. Adenosine was the
preferred nucleotide spacing the two core motifs.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 1.
Identification of the consensus sequence
TAK1-RE. A DNA-binding site selection strategy based on a
combination of PCR and EMSA was used as described under "Experimental
Procedures." A, sequences of the 30-nucleotide-long
fragments that bound TAK1 with high affinity identified in 30 independent clones. N12AGGTCAN12 are the
degenerate oligonucleotides used at the start of the selection. The
sequences within the boxes are the fixed core motif AGGTCA.
B, calculation of the consensus TAK1-RE (CON.
RE). The consensus sequence of the 7 nucleotides 5' of the fixed
core motif was calculated from the first 23 sequences; those of the
3'-flanking sequence were calculated from the remaining seven
sequences. The consensus further upstream and downstream (positions 7
to 11 and +7 to +11, respectively) was calculated from all 30 sequences. Numbers indicate frequency (percent) of a
particular nucleotide at a given position. N indicates no
strong requirement for a specific nucleotide.
|
|
Based on the sequence analysis detailed above, we synthesized the
consensus TAK1 response element
GGCAGAGGTCAAAGGTCAAACGT (named TAK1-RE) as well
as a DR0, DR2, and DR3 with the same flanking sequences (Fig.
2A) and analyzed their ability
to compete with 32P-TAK1-RE for TAK1 binding in EMSA. As
shown in Fig. 2B, unlabeled TAK1-RE competed effectively
with 32P-TAK1-RE for binding of TAK1. The DR0, DR2, and DR3
oligonucleotides exhibited reduced ability to compete with
32P-TAK1-RE for TAK1 binding, supporting the conclusion
that TAK1 binds most strongly to DR1 response elements.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of TAK1 binding to several DR
elements. A, sequence of TAK1-RE, DR0, DR2, and DR3 used in
EMSA. B, EMSA analysis using in vitro translated
TAK1 and 32P-TAK1-RE as a probe and the unlabeled REs
listed in A as competitors. Competitors were used at 5-, 25-, and 100-fold excess. EMSA was performed as described under
"Experimental Procedures." Shifted bands were quantitated by
phosphorimaging analysis, and the relative level was plotted below each
lane. Results are representative of two independent experiments.
|
|
To analyze further the requirements for high affinity TAK1 binding,
several mutations in the TAK1-RE sequence were made (Fig. 3A), and the ability of these
oligonucleotides to compete with 32P-TAK1-RE for TAK1
binding was examined by EMSA. The oligonucleotides M1 and M4, in which
the 5'-flanking sequence was altered, did not compete as well as did
TAK1-RE (Fig. 3B). Mutation of the nucleotide between the
two core motifs from A to C also slightly reduced the binding affinity
of TAK1. These results indicated that although these nucleotides were
preferred for optimal binding by TAK1, these positions are not critical
for TAK1 binding. The nucleotide M3, which contains only one core
motif, was a very weak competitor, suggesting that TAK1 has a very low
affinity for REs containing a single core motif.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of various TAK1-RE mutations on TAK1
binding. A, sequences of mutated TAK1-REs. Arrows
indicate the mutated positions in TAK1-RE. B, EMSA analysis
of the ability of mutated TAK1-REs to compete with
32P-TAK1-RE for TAK1 binding. Competitors were used at 5-, 25-, and 100-fold excess. Shifted bands were quantitated by
phosphorimaging analysis, and the relative level was plotted
below each lane. Results are representative of two
independent experiments.
|
|
TAK1-RE-dependent Transcriptional Activation by
TAK1--
To examine whether TAK1 could induce
TAK1-RE-dependent transactivation, the TAK1 expression
vector pcDNA3-TAK1 and the (TAK1-RE)3-tk-CAT reporter
plasmid were transfected into COS-7 cells and 24 h later assayed
for CAT enzyme levels. A consistent 2-3-fold increase in CAT
expression was measured compared with cells transfected with
(TAK1-RE)3-tk-CAT reporter DNA only, indicating that TAK1 was a weak inducer of TAK1-RE-dependent transactivation
(Fig. 4). Similar levels of
transactivation were observed when cells were grown in delipidized
serum indicating that serum lipids did not influence transactivation
mediated by TAK1. Transfection with VP16-TAK1, encoding the activation
domain of VP16 fused to the full coding region of TAK1, induced a
dramatic increase in CAT expression through
(TAK1-RE)3-tk-CAT in cells that were grown in either normal
or delipidized serum. This suggests that the weak transactivation
mediated by TAK1 was not due to its inability to bind to the TAK1-RE in
cells (Fig. 4).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of the transactivation activity of
TAK1 and VP16-TAK1. COS-7 cells were transfected with the reporter
plasmid (TAK1-RE)3-tk-CAT (0.5 µg) and expression vectors
pSG5-VP16-TAK1, pSG5-VP16 (0.5 µg), or pcDNA3-TAK1 (0.25, 0.5, or
1.0 µg). -Actin-LUC DNA (0.1 µg) served as an internal control.
After 24 h cells were collected and assayed for CAT and LUC
activity. The relative CAT activity was calculated and plotted.
Solid bars, COS-7 grown in regular serum; hatched
bars, cells grown in delipidized serum were plotted.
1st and 7th bars represent the basal activity of
(TAK1-RE)3-tk-CAT reporter in regular and delipidated serum
transfection, respectively. Results are representative of three
independent experiments.
|
|
Co-expression of TAK1 and PPAR
in Rat Hepatocytes--
Previous
studies revealed that TAK1 is highly expressed in liver (8, 26).
Northern blot analysis with RNA isolated from rat hepatocytes showed
that TAK1 and PPAR
are co-expressed in these cells (Fig.
5). Activation of PPAR
, which plays an
important role in the regulation of many genes in the liver, by the
peroxisome proliferator Wy-14643 increased the expression of both
PPAR
and ACOX mRNA as has been shown previously (41-42). The
level of TAK1 mRNA was not altered by Wy-14643, suggesting that
TAK1 expression is not controlled by PPAR
in these cells.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 5.
Co-expression of TAK1, PPAR , and RIP-140
in rat hepatocytes. Total RNA was isolated from primary rat
hepatocytes treated for 24 h with 10 µM Wy-14643
(WY) or Me2SO (DMSO) (0.1%). RNA (25 µg) was examined by Northern blot analysis using radiolabeled probes
for TAK1, PPAR , ACOX, RIP-140, and glyceraldehyde-3-phosphate
dehydrogenase (GPDH).
|
|
Interaction of TAK1 with PPREs--
Since TAK1 and PPAR
are
co-expressed in hepatocytes and the action of both receptors on target
gene expression is mediated by DR1-like response elements (8, 28-29),
we were interested in examining interactions between these two receptor
signaling pathways. To identify a possible role for TAK1 in modulating
the transcriptional activation by the PPAR
signaling pathway, the binding of TAK1 to PPREs present in the promoter of two PPAR
target
genes, ACOX and HD, was analyzed. As shown in
Fig. 6B, ACOX-PPRE and HD-PPRE
were able to compete with 32P-TAK1-RE for TAK1 binding in
EMSA; however, both PPREs demonstrated a lower affinity for TAK1 than
did TAK1-RE. Fig. 6C shows a comparison between the binding
of TAK1 and RXR
homodimers and PPAR
·RXR
heterodimers to
radiolabeled TAK1-RE, ACOX-PPRE, and HD-PPRE. In contrast to TAK1
homodimers and PPAR
·RXR
heterodimers, which bound to all three
REs, RXR homodimers bound effectively only to TAK1-RE. The two bands
observed in the EMSA performed with PPAR
, RXR
, and
32P-TAK1-RE (Fig. 6C, lane 4) represented the
RXR
homodimer (upper band) and the PPAR
·RXR
complex (lower band). These results show that TAK1 and
PPAR
·RXR
can recognize similar REs.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Comparison of TAK1, PPAR , and RXR
binding to TAK1-RE, ACOX-PPRE, and HD-PPRE. A, comparison of
TAK1-RE, ACOX-PPRE, and HD-PPRE. Underlined nucleotides
indicate core motifs. B, EMSA analysis of the ability of
TAK1-RE, ACOX-PPRE, and HD-PPRE to compete with 32P-TAK1-RE
for TAK1 binding. Unlabeled oligonucleotides were added at 25-, 50-, and 100-fold excess. Shifted bands were quantitated by phosphorimaging
analysis, and the relative level was plotted below each lane.
C, comparison of the binding of TAK1 homodimers, RXR
homodimers, and PPAR ·RXR heterodimers to
32P-TAK1-RE (lanes 1, 4, and 7),
32P-ACOX-PPRE (lanes 2, 5, and 6),
and 32P-HD-PPRE (lanes 3, 6, and
9).
|
|
We next compared the transactivation potential of TAK1 and
PPAR
·RXR
using CAT reporter plasmids controlled by the PPREs described above (Fig. 7). TAK1, which was
a weak inducer of TAK1-RE-dependent transactivation, did
not induce ACOX-PPRE- or HD-PPRE-dependent transactivation
in COS-7 cells. In contrast, a VP16-TAK1 fusion protein was able to
increase TAK-1-RE, ACOX-PPRE-, and HD-PPRE-dependent transactivation 18-, 7-, and 15-fold, respectively, confirming TAK1
binding to these PPREs. The PPAR
ligand 8(S)-HETE induced TAK1-RE-, ACOX-PPRE-, and HD-PPRE-dependent transactivation
of the CAT reporter by PPAR
·RXR
heterodimers about 10-, 18-, and 10-fold, respectively. The highest transactivation by
PPAR
·RXR
was observed with ACOX-PPRE, whereas transactivation
by TAK1-VP16 was greatest with TAK-1-RE and HD-PPRE. These results
indicate that the relative level of transactivation induced by
TAK1-VP16 and PPAR
·RXR
through these three elements are not
equivalent and may reflect differences in the relative affinity of TAK1
and PPAR
·RXR complexes for these elements.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of the transcriptional activation
by TAK1, VP16-TAK1, and PPAR ·RXR through TAK1-RE, ACOX-PPRE, or
HD-PPRE. COS-7 cells were transfected with a CAT reporter under
the control of either TAK1-RE, ACOX-PPRE, or HD-PPRE and expression
vector plasmid DNA encoding TAK1, VP16-TAK1, VP16, PPAR , or RXR ,
as indicated in the Fig. After 24 h, cells were collected and
analyzed for CAT/LUC activity, and relative CAT activity was
plotted. Cells transfected with PPAR were treated with 1 µM 8(S)-HETE. Results are representative of
two independent experiments. DR1-CAT,
(TAK1-RE)3-tk-CAT; ACOX-CAT, (ACOX)2-tk-CAT;
HD-CAT, HD-tk-CAT.
|
|
Inhibition of PPAR
-mediated Transactivation by TAK1--
To
determine if TAK1 could interfere with the regulation of gene
expression mediated by PPAR
, we analyzed the effect of TAK1 on
TAK1-RE-, ACOX-PPRE-, and HD-PPRE-dependent transactivation of the CAT reporter gene by PPAR
·RXR
. Co-transfection of
expression plasmids encoding TAK1 and PPAR
·RXR
into COS-7 (Fig.
8) showed that TAK1 was able to
effectively antagonize PPAR
-mediated transactivation. The induction
of TAK1-RE-, ACOX-PPRE- and HD-PPRE-dependent
transactivation of CAT by PPAR
·RXR
was repressed by TAK1 in a
dose-dependent manner.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8.
Inhibition of PPAR -mediated
transcriptional activation by TAK1. COS-7 cells were transfected
with the reporter plasmids (TAK1-RE)3-tk-CAT (DR1-CAT),
(ACOX)2-tk-CAT (ACOX-CAT), or HD-tk-CAT (HD-CAT) and the
expression vectors encoding PPAR , RXR , and TAK1, as indicated in
the figure. After transfection 1 µM 8(S)-HETE
was added, and 24 h later cells were collected and assayed for CAT
and LUC activity. TAK1 was co-transfected as a competitor to
PPAR ·RXR at 0.4, 0.8, and 1.2 µg. Relative CAT activity was
plotted. Results are representative of two independent
experiments.
|
|
TAK1 Forms Homodimers and Does Not Heterodimerize with RXR
or PPAR
--
Cross-talk between the TAK1 and PPAR
pathways may
occur at several levels of the receptor signaling cascade. To determine whether the antagonistic action of TAK1 was related to competition for
RXR
or PPAR
binding, we examined by two-hybrid analysis whether
TAK1 formed heterodimeric complexes with RXR
or PPAR
. The
expression vector Gal4-TAK1, encoding the fusion protein
Gal4(DBD)-TAK1, was co-transfected with the pG5CAT reporter plasmid and
either RXR
-VP16(AD), PPAR
-VP16(AD), or TAK1-VP16(AD) into COS-7
cells, and the transactivation of CAT was analyzed. As shown in Fig. 9, cells transfected with Gal4-TAK1 and
pG5CAT exhibited levels of CAT similar to that seen in cells
transfected with pG5CAT only. Cells co-transfected with RXR
-VP16(AD)
or PPAR
-VP16(AD) also did not increase CAT above control levels. The
presence of the RXR-selective ligand SR11217 or the PPAR
ligand
8(S)-HETE had little effect on CAT levels. In contrast,
co-transfection with TAK1-VP16(AD) increased CAT activity about 9-fold.
These results showed that TAK1 does not form a heterodimer with RXR
or PPAR
and confirmed the ability of TAK1 to form homodimers.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 9.
TAK1 homodimerizes and is unable to form
heterodimeric complexes with RXR or PPAR . The ability of the
fusion protein Gal4-TAK1, comprising the ligand-binding domain of TAK1
and the DNA-binding domain of Gal4, to interact with the ligand-binding
domain of TAK1, RXR , or PPAR fused to the activation domain of
VP16, was examined in COS-7 cells by determining the level of CAT
activity from the reporter plasmid pG5-CAT. After transfection, cells
transfected with PPAR or RXR were treated with 1 µM
8(S)-HETE or 1 µM of the RXR -selective
ligand SR11217, respectively, as indicated. Results shown are
representative of three independent experiments.
|
|
TAK1 Competes with PPAR
for Binding of Co-activators--
The
results described thus far suggest that the inhibition of
PPAR
·RXR
-mediated transactivation by TAK1 is due at least in
part to competition of TAK1 with PPAR
·RXR
for PPRE binding. However, gene regulation by nuclear receptors involves interactions with a number of other nuclear proteins, including co-repressors and
co-activators (16). Competition of receptors for binding to these
nuclear proteins is one mechanism by which nuclear receptor pathways
interfere with one another (24). To examine whether such a mechanism
applies to the antagonism between the TAK1 and PPAR
signaling
pathways, we first analyzed the interactions of TAK1 and PPAR
with
the co-repressor, SMRT (20), and the co-activator, RIP-140 (22, 66),
using the mammalian two-hybrid system. In Fig. 5, we demonstrate that
RIP-140, as TAK1 and PPAR
, was expressed with TAK1 and PPAR
in
hepatocytes. The results in Fig. 10
show that TAK1 interacted with the co-activator RIP-140 but not with the co-repressor SMRT, whereas PPAR
interacted with both RIP-140 or
SMRT. In the absence of exogenous ligand, cells transfected with pG5CAT
reporter plasmid plus Gal4-PPAR
exhibited a low level of CAT
expression, while co-transfection with VP16-RIP-140 increased CAT
levels about 4-fold. Addition of 8(S)-HETE further increased the transactivation in these cells about 14-fold (Fig. 10B,
3rd and 4th bars). It is likely that the increase in
transactivation by VP16-RIP-140 in the absence of exogenous ligand was
due to the presence of low levels of ligand either synthesized by the cells or still remaining in the delipidized serum. Addition of 8(S)-HETE reduced CAT levels in cells co-transfected with
Gal4-PPAR
and VP16-SMRT (Fig. 10B, 5th and 6th
bars) to levels similar to that of cells transfected with
Gal4-PPAR
only (Fig. 10B, 2nd bar). These results
indicate that ligand binding promoted PPAR
interaction with RIP-140
and inhibited PPAR
binding to SMRT. To determine whether TAK1 was
able to interfere with PPAR
-mediated transactivation through
squelching of RIP-140 activity, cells were co-transfected with the
pG5-CAT reporter plasmid, Gal4-PPAR
, VP16-RIP-140, and increasing
amounts of TAK1. As shown in Fig. 10C, TAK1 inhibited the
PPAR
/VP16-RIP-140-mediated transactivation in a
dose-dependent manner (4th and 5th
bars) suggesting that TAK1 competes with PPAR
for RIP-140
binding.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 10.
Interaction of TAK1 and PPAR with RIP-140
and SMRT. A, interaction of Gal4-TAK1 fusion protein with
the C-terminal portion of RIP-140 or SMRT fused to the activating
domain of VP16 was examined in Chinese hamster ovary, CV-1, and COS-7
cells by determining the (GAL4 upstream activating
sequence)4-dependent transactivation of the CAT
reporter (pG5-CAT), as indicated by +/ . 1st three bars
represent the basal activity of pG5-CAT as a control. B,
two-hybrid analysis of the interaction of Gal4-PPAR fusion protein
with VP16-RIP-140 and VP16-SMRT in CV-1 cells in the presence or
absence of 1 µM 8(S)-HETE. C,
squelching of the interaction between Gal4-PPAR and VP16-RIP-140 by
TAK1 in CV-1 cells. The plasmid pcDNA3-TAK1 (0.2 or 0.5 µg) was
co-transfected with Gal4-PPAR and VP16-RIP-140 plasmids (0.5 µg
each). Results are representative for two independent
experiments.
|
|
 |
DISCUSSION |
In this study, we identified and characterized the consensus
response element for the nuclear orphan receptor TAK1 (TAK1-RE) and the
mechanisms by which TAK1 antagonizes PPAR
-mediated transcriptional activation. Our results demonstrate that TAK1 has the greatest affinity
for a DR1 repeat consisting of the consensus sequence GGCAGAGGTCAAAGGTCAAACGT (TAK1-RE). TAK1 can
also bind response elements containing a direct repeat of the core
motif interspaced by 0, 2, or 3 nucleotides (DR0, DR2, or DR3,
respectively) but with a lower affinity than DR1 and does not bind well
to a single core motif. Previous studies have demonstrated that TAK1
can also bind DR4 and DR5 response elements (14). Thus TAK1 can
interact with a wide variety of response elements containing direct
repeats and, in this regard, resembles COUP-TF which also has highest affinity for DR1 (4, 68). However, in contrast to COUP-TF, TAK1 does
not interact with palindromic response elements (4, 14). Another
characteristic TAK1 and COUP-TF have in common is that both can act as
negative and positive regulators of transcription (14, 30-31,
66-70).
Previous studies showed that TAK1 is highly expressed in many tissues,
including liver (8, 26, 28-29). In this study, we demonstrated that
TAK1 is expressed in rat hepatocytes. These cells have been reported to
express a variety of other nuclear receptors, including PPAR
, RXR,
COUP-TF, and HNF-4 (4, 6, 32-35, 40, 71). Several of these receptors
bind either as a homodimer or as a heterodimeric complex with RXR to
response elements containing DR1 motifs. This has instigated studies
examining cross-talk between different nuclear receptor signaling
pathways (14, 69-70, 72-73). Such interactions could take place at
different levels of the receptor signaling cascade as follows: at the
level of binding to common hormone response elements, at the level of
receptor dimerization, or at the level of interactions with other
nuclear proteins involved in transcriptional control. In this study, we analyzed the cross-talk between TAK1 and PPAR
signaling
pathways.
In liver, PPAR
, in complex with RXR, regulates the transcription of
many genes encoding various enzymes important in the microsomal
-hydroxylation and peroxisomal
-oxidation pathways (6, 38-40).
In this study, we show that TAK1 and PPAR
, which are co-expressed in
hepatocytes, can bind common PPREs, including those present in the
PPAR
target genes ACOX and HD. However, in
contrast to PPAR
, TAK1 was unable to induce transactivation through
these PPREs and strongly repressed PPAR
-mediated transactivation through the ACOX- and HD-PPREs. Our results demonstrate that
competition between TAK1 and PPAR
for PPRE binding is one mechanism
by which TAK1 can repress PPAR
-mediated transactivation. Such a
mechanism has also been implicated in the antagonism between TAK1 and
RXR (14) and between COUP-TF and PPAR
(69-70). Because an AT-rich 5'-flanking region in PPREs contributes to optimal binding of PPAR
·RXR (46), but not of TAK1 (Fig. 1 and 2) or RXR homodimers, TAK1 and RXR bind well to TAK1-REs but not very effectively to ACOX-PPREs or HD-PPREs in agreement with a previous study (46). Therefore, the extent and specificity by which
PPRE-dependent transcription is suppressed by TAK1 will
depend on the difference between the affinity of TAK1 and PPAR
·RXR
for a particular PPRE and the levels of TAK1 and PPAR
expressed
in the cell.
Many nuclear receptors, including PPAR
, form a heterodimeric complex
with RXR (49-50, 52-53). TAK1 could suppress PPAR
·RXR-mediated transactivation by recruiting either RXR or PPAR
into an inactive complex. Such an interplay has been reported to exist between the
thyroid hormone receptor T3R and PPAR
signaling pathways (74).
Thyroid hormone inhibits PPRE-dependent transactivation of
the LUC reporter by ciprofibrate as well the induction of several genes
involved in peroxisomal
-oxidation. This inhibition is related to
competition of T3R with PPAR
for RXR binding (squelching). Increased
RXR has been shown to relieve this suppression of PPAR-mediated transactivation by T3R (74). Our results indicate that this mechanism
is not implicated in the antagonism between TAK1 and PPAR
since
two-hybrid analysis showed that TAK1 was unable to interact with either
PPAR
or RXR whether the ligands for RXR or PPAR
were present or
not.
Regulation of gene transcription nuclear receptors involves interaction
with the basal transcription machinery through many intermediary
proteins. Such proteins can act as co-repressors, co-activators, or
integrators (16-18, 21-23). As shown for several nuclear receptors,
the absence of ligand stimulates the association of receptor with
co-repressors, such as N-CoR or SMRT (18, 20), whereas the presence of
ligand induces dissociation of the co-repressor and promotes
interaction with co-activators, such as SRC-1, PBP, and RIP-140
(21-22, 76), as well as integrators such as CREB-binding protein (24).
It is likely that nuclear receptors compete with each other for binding
to these proteins. To examine whether such a mechanism could be
involved in the antagonism between the TAK1 and the PPAR
signaling
pathways, the interactions of TAK1 and PPAR
with the co-activator
RIP-140 and co-repressor SMRT were examined. We show that PPAR
is
able to bind to both RIP-140 and SMRT, whereas TAK1 is only able to
bind RIP-140. The PPAR
ligand 8(S)-HETE inhibited
interaction of PPAR
with SMRT and increased interaction with
RIP-140. Our results suggest that ligand binding, probably through a
conformational change in PPAR
, induces dissociation of the
PPAR
·co-repressor complex and promotes interaction of PPAR
with
co-activators that leads to transcriptional activation of PPAR
target genes. In addition, we show that TAK1 inhibits transactivation
mediated through Gal4-PPAR
and RIP-140-VP16, indicating that
competition for co-activators is a valid mechanism by which TAK1
antagonizes the regulation of gene expression by PPAR
. Recently a
novel co-activator PBP was identified that interacts with PPARs in a
ligand-dependent manner (75). Whether modulation of
PPAR
-mediated transcription by TAK1 also involves competition for
this co-activator has to be determined.
Transcriptional regulation by nuclear receptors is complex
involving not only interaction with many co-repressors and
co-activators but also competition between receptors for the binding of
REs and these transcription intermediary proteins. In addition, the transcriptional activity of nuclear receptors depends on the type of
RE, promoter architecture, and cell context. Characterization of the
functional domains of TAK1 will be required to more completely understand the molecular mechanisms underlying transcriptional repression by TAK1.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Jürgen Lehmann
(Glaxo-Wellcome) for providing plasmids and technical suggestions
regarding CV-1 cell transfections and Drs. D. Swope, D. Zhu, and S. Dou
for their comments on the manuscript.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
919-541-2768; Fax: 919-541-4133; E-mail: jetten{at}niehs.nih.gov.
1
The abbreviations used are: DR, direct repeat;
PPAR
, proliferator-activated receptor
; RE, response element(s);
PPRE, peroxisome proliferator response elements; HD, enoyl-CoA
hydratase; ACOX, fatty acyl-CoA oxidase; EMSA, electrophoretic mobility
shift assay; RXR, retinoid X receptor; LUC, luciferase; CAT,
chloramphenicol acetyltransferase; 8(S)-HETE,
8(S)-hydroxyeicosatetraenoic acid; COUP-TF, chicken
ovalbumin upstream promoter-transcription factor; T3R, thyroid hormone
receptor; m, mouse; h, human; PCR, polymerase chain reaction; CREB,
cAMP response element binding protein.
2
J. L. Staudinger, manuscript in
preparation.
 |
REFERENCES |
-
De Luca, L. M.
(1991)
FASEB J.
5,
2924-2933[Abstract]
-
Giguère, V.
(1994)
Endocr. Rev.
15,
61-79[CrossRef][Medline]
[Order article via Infotrieve]
-
Kastner, P.,
Mark, M.,
and Chambon, P.
(1995)
Cell
83,
859-869[CrossRef][Medline]
[Order article via Infotrieve]
-
Qui, Y.,
Tsai, S. Y.,
and Tsai, M.-J.
(1994)
Trends Endocrinol. Metab.
5,
234-239[Medline]
[Order article via Infotrieve]
-
Tontonoz, P.,
Hu, E.,
and Spiegelman, B. M.
(1994)
Cell
79,
1147-1156[CrossRef][Medline]
[Order article via Infotrieve]
-
Schoonjans, K.,
Staels, B.,
and Auwerx, J.
(1996)
Biochim. Biophys. Acta
1302,
93-109[Medline]
[Order article via Infotrieve]
-
Evans, R. M.
(1988)
Science
240,
889-895[Abstract/Free Full Text]
-
Hirose, T.,
Fujimoto, W.,
Yamaai, T.,
Kim, K. H.,
Matsuura, H.,
and Jetten, A. M.
(1994)
Mol. Endocrinol.
8,
1667-1680[Abstract]
-
Laudet, V.,
Hanni, C.,
Coll, J.,
Catzeflis, F.,
and Stehelin, D.
(1992)
EMBO J.
11,
1003-1013[Medline]
[Order article via Infotrieve]
-
Escriva, H.,
Safi, R.,
Hanni, C.,
Langlois, M.-C.,
Saumitou-Laprade, P.,
Stehelin, D.,
Capron, A.,
Pierce, R.,
and Laudet, V.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6803-6808[Abstract/Free Full Text]
-
Ribeiro, R. C. J.,
Kusher, P. J.,
and Baxter, J. D.
(1995)
Annu. Rev. Med.
46,
443-453[CrossRef][Medline]
[Order article via Infotrieve]
-
Glass, C. K.
(1994)
Endocr. Rev.
15,
391-407[CrossRef][Medline]
[Order article via Infotrieve]
-
Truss, M.,
and Beato, M.
(1993)
Endocr. Rev.
14,
459-479[Abstract]
-
Hirose, T.,
Apfel, R.,
Pfahl, M.,
and Jetten, A. M.
(1995)
Biochem. Biophys. Res. Commun.
211,
83-91[CrossRef][Medline]
[Order article via Infotrieve]
-
Mangelsdorf, D. J.,
and Evans, R. M.
(1995)
Cell
83,
841-850[CrossRef][Medline]
[Order article via Infotrieve]
-
Horwitz, K. B.,
Jackson, T. A.,
Bain, D. L.,
Richer, J. K.,
Takimoto, G. S.,
and Tung, L.
(1996)
Mol. Endocrinol.
10,
1167-1177[Abstract]
-
Le Douarin, B.,
Nielsen, A. L.,
Garnier, J.-M.,
Ichinose, H.,
Jeanmougin, F.,
Losson, R.,
and Chambon, P.
(1996)
EMBO J.
15,
6701-6715[Medline]
[Order article via Infotrieve]
-
Hörlein, A. J.,
Näär, A. M.,
Heinzel, T.,
Torchia, J.,
Gloss, B.,
Kurokawa, R.,
Ryan, A.,
Kamei, Y.,
Söderström, M.,
Glass, C. K.,
and Rosenfeld, M. G.
(1995)
Nature
377,
397-404[CrossRef][Medline]
[Order article via Infotrieve]
-
Kurokawa, R.,
Soderstrom, M.,
Horlein, A.,
Halachmi, S.,
Brown, M.,
Rosenfeld, M. G.,
and Glass, C. K.
(1995)
Nature
377,
451-454[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, J. D.,
and Evans, R. M.
(1995)
Nature
377,
454-457[CrossRef][Medline]
[Order article via Infotrieve]
-
Onate, S. A.,
Tsai, S. Y.,
Tsai, M.-J.,
and O'Malley, B. W.
(1995)
Science
270,
1354-1357[Abstract/Free Full Text]
-
Cavailles, V.,
Dauvois, S.,
L'Illorset, F.,
Lopex, G.,
Hoarc, S.,
Kushner, P. J.,
and Parker, M. G.
(1995)
EMBO J.
14,
3741-3751[Medline]
[Order article via Infotrieve]
-
Hanstein, B.,
Eckner, R.,
DiRenzo, J.,
Halachmi, S.,
Liu, H.,
Searcy, B.,
Kurokawa, R.,
and Brown, M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
91,
10009-10013[Abstract/Free Full Text]
-
Kamei, Y.,
Xu, L.,
Heinzel, T.,
Torchia, J.,
Kurokawa, R.,
Gloss, B.,
Lin, S.-C.,
Heyman, R.,
Rose, D.,
Glass, C.,
and Rosenfeld, M.
(1996)
Cell
85,
1-12[CrossRef][Medline]
[Order article via Infotrieve]
-
Chakravarti, D.,
LaMorte, V. J.,
Nelson, M. C.,
Nakajima, T.,
Schulman, I. G.,
Juguilon, H.,
Montminy, M.,
and Evans, R. M.
(1996)
Nature
383,
99-103[CrossRef][Medline]
[Order article via Infotrieve]
-
Chang, C.,
Lopes da Silva, S.,
Ideta, R.,
Lee, Y.,
Yeh, S.,
and Burbach, J. P. H.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
6040-6044[Abstract/Free Full Text]
-
Hirose, T.,
O'Brien, D. A.,
and Jetten, A. M.
(1995)
Gene (Amst.)
163,
239-242[CrossRef][Medline]
[Order article via Infotrieve]
-
Yoshikawa, T.,
DuPont, B. R.,
Leach, R. J.,
and Detera-Wadleigh, S. D.
(1996)
Genomics
35,
361-366[CrossRef][Medline]
[Order article via Infotrieve]
-
Yoshikawa, T.,
Makino, S.,
Gao, X.,
Xing, G.,
Chuang, D.,
and Detera-Wadleigh, S. D.
(1996)
Endocrinology
137,
1562-1571[Abstract]
-
Lee, H.,
Lee, Y.,
Burbach, J. P. H.,
and Chang, C.
(1995)
J. Biol. Chem.
270,
30129-30133[Abstract/Free Full Text]
-
Young, W. J.,
Smith, S. M.,
and Chang, C.
(1997)
J. Biol. Chem.
272,
3109-3116[Abstract/Free Full Text]
-
Keller, H.,
Dreyer, C.,
Medin, J.,
Mahfoudi, A.,
Ozato, K.,
and Wahli, W.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2160-2164[Abstract/Free Full Text]
-
Sher, T.,
Yi, H.-F.,
McBride, O. W.,
and Gonzalez, F. J.
(1993)
Biochemistry
32,
5598-5604[CrossRef][Medline]
[Order article via Infotrieve]
-
Issemann, I.,
and Green, S.
(1990)
Nature
347,
645-650[CrossRef][Medline]
[Order article via Infotrieve]
-
Braissant, O.,
Foufelle, F.,
Scotto, C.,
Dauca, M.,
and Wahli, W.
(1996)
Endocrinology
137,
354-366[Abstract]
-
Zhu, Y.,
Alvarez, K.,
Huang, Q.,
Rao, S. M.,
and Reddy, J. K.
(1993)
J. Biol. Chem.
268,
26817-26820[Abstract/Free Full Text]
-
Gonzalez, F. J.
(1997)
Biochimie (Paris)
79,
139-144[Medline]
[Order article via Infotrieve]
-
Desvergne, B.,
and Wahli, W.
(1995)
in
Inducible Gene Expression (Baeuerle, P., ed), Vol. 1, pp. 142-176, Birkhäuser, Boston
-
Wahli, W.,
Braissant, O.,
and Desvergne, B.
(1995)
Chem. Biol.
2,
261-266[CrossRef][Medline]
[Order article via Infotrieve]
-
Reddy, J. K.,
and Mannaerts, G. P.
(1994)
Annu. Rev. Nutr.
14,
343-370[CrossRef][Medline]
[Order article via Infotrieve]
-
Dreyer, C.,
Krey, G.,
Keller, H.,
Givel, F.,
Helftenbein, G.,
and Wahli, W.
(1992)
Cell
68,
879-887[CrossRef][Medline]
[Order article via Infotrieve]
-
Tugwood, J. D.,
Issemann, I.,
Anderson, R. G.,
Bundell, K. R.,
McPheat, W. L.,
and Green, S.
(1992)
EMBO J.
11,
433-439[Medline]
[Order article via Infotrieve]
-
Zhang, B.,
Marcus, S. L.,
Sajjadi, F. G.,
Alvares, K.,
Reddy, J. K.,
Subramani, S.,
Rachubinski, R. A.,
and Capone, J. P.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7541-7545[Abstract/Free Full Text]
-
Zhang, B.,
Marcus, S. L.,
Miyata, K. S.,
Subramani, S.,
Capone, J. P.,
and Rachubinski, R. A.
(1993)
J. Biol. Chem.
268,
12939-12945[Abstract/Free Full Text]
-
Muerhoff, A. S.,
Griffin, K. J.,
and Johnson, E. F.
(1992)
J. Biol. Chem.
267,
19051-19053[Abstract/Free Full Text]
-
Palmer, C. N. A.,
Hsu, M.-H.,
Muerhoff, A. S.,
Griffin, K. J.,
and Johnson, E. F.
(1994)
J. Biol. Chem.
269,
18083-18089[Abstract/Free Full Text]
-
Varanasi, U.,
Chu, R.,
Huang, Q.,
Castellon, R.,
Yeldandi, A. V.,
and Reddy, J. K.
(1996)
J. Biol. Chem.
271,
2147-2155[Abstract/Free Full Text]
-
Krey, G.,
Mahfoudi, A.,
and Wahli, W.
(1995)
Mol. Endocrinol.
9,
219-231[Abstract]
-
Kliewer, S. A.,
Forman, B. M.,
Blumberg, B.,
Ong, E. S.,
Borgmeyer, U.,
Mangelsdorf, D. J.,
and Evans, R. M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
7355-7359[Abstract/Free Full Text]
-
Marcus, S. L.,
Miyata, K. S.,
Zhang, B.,
Rachubinski, R. A.,
and Capone, J. P.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5723-5727[Abstract/Free Full Text]
-
Palmer, C. N. A.,
Hsu, M.-H.,
Griffin, K. J.,
and Johnson, E. F.
(1995)
J. Biol. Chem.
270,
16114-16121[Abstract/Free Full Text]
-
Chu, R.,
Lin, Y.,
Rao, M. S.,
and Reddy, J. K.
(1995)
J. Biol. Chem.
270,
29636-29639[Abstract/Free Full Text]
-
Gearing, K. L.,
Gottlicher, M.,
Teboul, M.,
Widmark, E.,
and Gustafsson, J.-A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1440-1444[Abstract/Free Full Text]
-
Lehmann, J. M.,
Moore, L. B.,
Smith-Oliver, T. A.,
Wilkison, W. O.,
Willson, T. M.,
and Kliewer, S. A.
(1995)
J. Biol. Chem.
270,
12953-12956[Abstract/Free Full Text]
-
Forman, B. M.,
Chen, J.,
and Evans, R. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
4312-4317[Abstract/Free Full Text]
-
Kliewer, S. A.,
Sundseth, S. S.,
Jones, S. A.,
Brown, P. J.,
Wisely, G. B.,
Koble, C. S.,
Devchand, P.,
Wahli, W.,
Willson, T. M.,
Lenhard, J. M.,
and Lehmann, J. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
4318-4323[Abstract/Free Full Text]
-
Martin, G.,
Schoonjans, K.,
Lefebvre, A.-M.,
Staels, B.,
and Auwerx, J.
(1997)
J. Biol. Chem.
272,
28210-28217[Abstract/Free Full Text]
-
Göttlicher, M.,
Widmark, E.,
Li, Q.,
and Gustafsson, J.-A.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4653-4657[Abstract/Free Full Text]
-
Keller, H.,
and Wahli, W.
(1993)
Trends Endocrinol. Metab.
4,
291-296
-
Bocos, C.,
Gottlicher, M.,
Gearing, K.,
Banner, C.,
Enmark, E.,
Teboul, M.,
Crickmore, A.,
and Gustafsson, J.-A.
(1995)
J. Steroid Biochem. Mol. Biol.
53,
467-473[CrossRef][Medline]
[Order article via Infotrieve]
-
Krey, G.,
Braissant, O.,
L'Horset, F.,
Kalkhoven, E.,
Perroud, M.,
Parker, M. G.,
and Wahli, W.
(1997)
Mol. Endocrinol.
11,
779-791[Abstract/Free Full Text]
-
Boshart, M.,
Klüppel, M.,
Schmidt, A.,
Schütz, G.,
and Luckow, B.
(1992)
Gene (Amst.)
110,
129-130[CrossRef][Medline]
[Order article via Infotrieve]
-
Yan, Z. H.,
Medvedev, A.,
Hirose, T.,
Gotoh, H.,
and Jetten, A. M.
(1997)
J. Biol. Chem.
272,
10565-10572[Abstract/Free Full Text]
-
Karam, W. G.,
and Ghanayem, B. I.
(1997)
Carcinogenesis
18,
2077-2083[Abstract/Free Full Text]
-
Adachi, H.,
Dawson, M. I.,
and Jetten, A. M.
(1996)
Mol. Cell. Differ.
4,
365-381
-
Joyeux, A.,
Cavailles, V.,
Balaguer, P.,
and Nicolas, J. C.
(1997)
Mol. Endocrinol.
11,
193-202[Abstract/Free Full Text]