![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 19, 11544-11547, May 8, 1998
,From the Department of Thrombosis and Vascular Biology, Maryland Research Laboratories, Otsuka America Pharmaceutical, Inc., Rockville, Maryland 20850
| |
ABSTRACT |
|---|
|
|
|---|
ADP is an important physiological platelet agonist. The molecular identity of the ADP receptor(s) in human platelets, however, is still unclear. Although P2T purinoceptor was believed to be the ligand-gated cation channel for ADP in human platelets, recent patch clamp studies now suggest it is P2X1 type. In the present study, we have cloned a cDNA encoding a P2X1 purinoceptor from human platelets using degenerate reverse transcription and polymerase chain reaction. Northern blotting with a P2X1-specific probe revealed a band of 1.8 kilobases in human platelets as well as in several megakaryoblastic cell lines. 1321N1 human astrocytoma cells expressing the cloned P2X1 cDNA exhibited both ATP- and ADP-stimulated Ca2+ influx that could be blocked by the purinoceptor antagonist pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin. Additionally, a polyclonal antibody raised against glutathione-S-transferase-P2X1 fusion peptide reacted with a 70-kDa band on Western blot of human platelets. It is therefore concluded that functional P2X1 purinoceptors are present in human platelets.
| |
INTRODUCTION |
|---|
|
|
|---|
Platelet activation is known to be involved in the development of atherosclerosis and restenosis after angioplasty. ADP is an important endogenous platelet agonist. Stimulation of platelets with ADP has been shown to mediate platelet shape change, aggregation, and further release of ADP and ATP from activated platelets. The ADP receptor in platelets is reported to possess a unique, pharmacologically characteristic P2T-type purinoceptor (1). Activation of the ADP receptor causes immediate activation of a non-selective cation channel that mediates calcium influx and mobilization of calcium from intracellular stores (2, 3). Membrane binding experiments have indicated the presence of both high and low affinity binding sites for ADP in platelets (4, 5). Furthermore, pharmacological and clinical studies have also suggested the presence of two types of ADP receptors (6, 7). Several platelet membrane ADP-binding proteins have been proposed as putative ADP receptor (8-10), but no peptide sequence is available for the cloning purposes. Recently, it has been shown by patch clamp techniques and intracellular calcium measurements that both ADP and ATP can activate a channel and mediate an increase in intracellular calcium concentration in human platelets. It has also been suggested that the ADP/ATP-gated non-selective cation channel resembles a P2X1 purinoceptor (11).
Extracellular ATP and ADP interact with two subgroups of P2 purinoceptors, P2X and P2Y (12, 13). Molecular cloning has identified seven members of P2X, a non-selective cation channel with two transmembrane domains; P2Y, which belongs to the seven-transmembrane domain G-protein-coupled receptor family, consists of more than seven members identified to date. Based on the effects of ADP on adenylyl cyclase, activation of phospholipase C, and intracellular calcium mobilization, we hypothesize that the P2T receptor in human platelets may consist of one P2X-like and one or more P2Y-like separate components. This hypothesis is also supported by recent demonstration of a P2Y1-type purinoceptor in human platelets (14). In the present study, P2X1 cDNA was cloned from human platelets, and its function was further characterized after heterologous expression in mammalian cells.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents and Solutions--
ATP, ADP,
,
-methylene-ATP,
aspirin, and apyrase were purchased from Sigma. ATP and ADP were
further purified by high performance liquid chromatography using a
Partisil Sax 10 µm, 250 × 4.6-mm column and a gradual elution
with 50-750 mM ammonium phosphate buffer, pH 3.5. Fura-2
acetoxymethyl ester was from Molecular Probes (Eugene, OR);
pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid
(PPADS)1 was from Calbiochem;
and suramin was from RBI (Natick, MA). HEPES-Tyrode buffer for calcium
measurement contained 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2,
10 mM glucose, and 20 mM HEPES, pH 7.4. In the
case of calcium-free solution, CaCl2 was replaced with 1 mM EGTA.
RNA Isolation, cDNA Synthesis, and Polymerase Chain Reaction
(PCR) Amplification--
Blood was drawn from healthy volunteers and
mixed with 0.1 volume of 3.8% sodium citrate followed by
centrifugation at 150 × g for 20 min. Supernatant
(platelet-rich plasma) was collected without disturbing buffy coat and
packed red blood cells. Aspirin (1 mM) and apyrase (20 µg/ml, final concentration) were then added to prevent platelet
activation by spontaneously released thromboxane and ADP, respectively
(3). Contaminating leukocytes and red blood cells were removed by an
additional centrifugation for 10 min at 150 × g. The
pH of resultant platelet-rich plasma was lowered to 6.5 with citric
acid (4 µl/ml from 1 M stock) before sedimentation of
platelets at 800 × g for 15 min (4). The pellet was
lysed, and RNA was extracted with RNA STAT-60 (TEL-TEST B, Inc.).
Possible contamination of platelet RNA specimens with leukocyte RNA was ruled out by reverse transcription-PCR amplification (negative) of
2
integrin, which presents in leukocytes but not in platelets, using two
specific primers. First strand complementary DNA (cDNA) was
synthesized utilizing a random hexamer primer using
SuperscriptTM (Life Technologies, Inc.). Degenerate primers
for P2X were designed and synthesized based on the conserved regions of
rat P2X1, P2X2, and P2X3. The
sequence for 5' primer used was 5'-TTCACCMTYYTCATCAARAACAGCATC-3', and
the 3' primer was 5'-ATRGTRGGRATGAKRYYRAAYTTSCC-3' (M = A and C,
Y = C and T, R = A and G, K = T and G, S = C and
G). cDNA was then amplified by PCR using a Perkin-Elmer
thermocycler 480. Cloned cDNA fragments in pCR2.1 plasmid
(Invitrogen) were sequenced manually using Sequenase V2.0 (Amersham
Pharmacia Biotech) or automatically using an ABI Prism 377 DNA
sequencer. To obtain the full-length cDNA, rapid amplification of
5' cDNA ends (5'-RACE) and 3'-RACE (Life Technologies) were used to
amplify 5' and 3' termini of the P2X1 cDNA,
respectively.
Heterologous Expression-- The full-length P2X1 coding region was amplified from human platelets and cloned into a mammalian expression vector pcDNA3 (Invitrogen). The expression was driven by a cytomegalovirus early promoter. Transfection into 1321N1 human astrocytoma cells (a kind gift from Dr. Toews, Nebraska University Medical Center) that are deficient in purinergic receptors (15) was carried out using calcium phosphate precipitation. Stable transfectants were selected using G418 at the concentration of 500 µg/ml for 12 days.
Intracellular Calcium ([Ca2+]i) Measurement-- 1321N1 astrocytoma cells grown on glass coverslips were loaded with Fura-2-acetoxymethyl ester (1 µM) for 30 min at room temperature. After washing with HEPES-Tyrode buffer, changes in Fura-2 fluorescence were measured in a SPEX spectrofluorometer (Floromax-2). [Ca2+]i was calculated from the 340/380 ratio as described by Grynkiewicz et al. (16).
Northern Blotting-- a cDNA fragment containing the 5'-terminal 958-base pair coding region of P2X1 cDNA from human platelets was labeled with 32P by nick translation and used as probe. Total RNA was extracted from pooled, fresh human platelets, cultured Meg-01, K562, and CMK11-5 cells and run on a 1% denatured formaldehyde-agarose gel. After blotting and fixing on a nylon membrane, the membrane was incubated with the probe and allowed to hybridize at 42 °C overnight. The membrane was then washed three times with 1× SSC (150 mM NaCl and 15 mM sodium citrate) plus 0.1% SDS. Before exposing to x-ray film, the membrane was washed once with 0.2× SSC containing 0.1% SDS.
Western Blotting-- The full-length P2X1 coding region from human platelets was recombined into plasmid vector pGEX-2T (Amersham) and overexpressed as a GST fusion protein. The GST-P2X1 fusion protein was purified from the cell lysates by affinity chromatography on glutathione-immobilized-Sepharose beads followed by elution with glutathione. The eluted fusion product was dialyzed three times against Tris-buffered saline (150 mM NaCl, 10 mM Tris, pH 7.4) and used to raise polyclonal antibodies in rabbits by Animal Pharm Services, Inc. (Healdsburg, CA). IgG was purified by affinity chromatography on Protein A-Sepharose. The specificity of the IgG was confirmed; the antibody recognized the Gst-P2X1 fusion protein but not GST alone.
Human platelets and cultured cells were lysed in radioimmune precipitation assay buffer (phosphate-buffered saline plus 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM dithiothreitol, 1 mM EDTA, and 0.5% digitonin) for 60 min on ice. After centrifugation at 5,000 rpm in an Eppendorf centrifuge for 10 min, the supernatants were mixed with loading buffer and denatured for 5 min at 95 °C, and components were resolved on 12% SDS-polyacrylamide gel electrophorsis. Resolved proteins were transferred onto nitrocellulose using a Bio-Rad trans-blot electrophoretic system. After blocking nonspecific binding sites with nonfat dry milk (5% in phosphate-buffered saline plus 0.5% Tween 20) overnight, the membrane was probed with anti GST-P2X1 IgG (1:2,500) for 60 min at room temperature. Horseradish peroxidase-conjugated anti-rabbit IgG was used as secondary antibody. Finally, the immunoreactive bands were visualized by ECL (Amersham).| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
A single band of cDNA was amplified from human platelet RNA preparations as well as from three megakaryoblastic cell lines (Meg-01, K562, and CMK11-5) using degenerate primers for the P2X purinoceptor. Subsequent DNA sequencing confirmed that the sequence of this fragment was identical to a region of cloned human urinary bladder smooth muscle P2X1 receptor (17). To detect any less homologous subtypes, we have attempted to use very low annealing temperatures for the PCR amplification (down to 30 °C), but no additional homologous clones were obtained. To obtain the full-length platelet P2X1 cDNA, 5'-RACE and 3'-RACE protocols were used to clone the 5' and 3' terminals of the cDNA, respectively. Several clones for the 5'-terminal and 3'-terminal regions of P2X1 in human platelets were amplified and subsequently cloned into pCR2.1 vectors. After complete two-directional DNA sequencing, it was found that the total length of cDNA for P2X1 in human platelets is 1861 base pairs. In comparison to the human urinary bladder P2X1 clone, the P2X1 cDNA in human platelets is 885 base pairs shorter at the 3' terminus of the noncoding region. At the 5' terminus there are 103 additional bases in the platelet cDNA. The sequence is 5'-AGGGGAATTTATTTGTCCATGGGCGAGGCTGGCCTGCAGTCTGTTGCCTTCCAGGGGCCAAGAGCTGCTCTGATCACCCAGGGATTCTCTCTCCAACCCAAGT-3'. The region from base 57 to 100 of the platelet cDNA shows a high homology (84%) to the rat P2X1 cDNA 5' terminus (base 1-44). The difference between platelet and bladder smooth muscle at the 5' terminus together with the truncated 3' terminal suggests that the transcription of P2X1 in human megakaryocyte may be regulated by a different promoter or that post-transcriptionally it undergoes a different splicing process (see discussion). The coding region, however, is identical between the platelet and bladder smooth muscle P2X1 cDNA. Therefore, the P2X purinoceptor expressed in human platelets is the P2X1 subtype, a nonselective cation channel with 399 amino acids and two hydrophobic domains as predicted from the cDNA sequence.
To characterize the function of the platelet P2X1 channel,
we overexpressed the platelet P2X1 cDNA in 1321N1 human
astrocytoma cells, which have been reported to be unresponsive to ATP
or ADP (15). Intracellular free calcium was measured to monitor the channel activity after stimulation. After selection with G418, 14 stably transfected cell lines were tested, and among those, two
responded to ATP stimulation. All subsequent experiments were carried
out with these two cell lines using nontransfected cells as the
negative control. It was found that both ATP and ADP caused intracellular calcium to increase dose-dependently followed
by a slightly elevated plateau (Fig. 1).
In calcium-free buffers (in the presence of 1 mM EGTA) as
shown in Fig. 1e, no [Ca2+]i
increase was observed upon ATP or ADP addition, indicating that the
calcium increase seen in the presence of extracellular calcium was
solely due to extracellular calcium influx through the expressed
P2X1 channel. Furthermore, ATP/ADP-induced
[Ca2+]i increase was inhibited by the
purinoceptor type 2-specific antagonists PPADS (100 µM,
Fig. 1d) and suramin (100 µM, data not shown).
Desensitization of the channel was also observed. Applying either ATP
or ADP (up to 100 µM) 3 min after the first dose (1 or 10 µM) caused little or no further
[Ca2+]i elevation (data not shown). Similar
results have been reported in human platelets by monitoring
ATP-activated ion channel activity using patch clamp techniques (11).
Even at low temperatures ATP slowly hydrolyzes to ADP. To accurately
estimate the potency of different agonists of the platelet
P2X1 channel, ATP and ADP were purified by ion exchange
chromatography. It was found that ATP was contaminated with ADP by less
than 1%. No difference was observed between purified and nonpurified
ATP or ADP in calcium influx amplitude. As shown in Fig. 1, the order
of potency in mediating the [Ca2+]i increase
in the transfected cells was
,
-methylene-ATP > ATP > ADP. This order is different from that of human bladder smooth muscle
(17) and that of rat vas deferens P2X1 purinoceptor
overexpressed in oocytes (18), where
,
-methylene-ATP was slightly
less potent than ATP. This discrepancy may be due to the different
expression vehicles employed (mammalian cell versus Xenopus
oocyte) and different detection systems (intracellular calcium
versus ion current by patch clamp). However, the potency of
,
-methylene-ATP > ATP reported in the present study for
platelet P2X1 channel correlates well with the higher
potency of
,
-methylene-ATP in whole tissue studies (19). The
EC50 for ATP and ADP for the platelet P2X1 channel was estimated to be 3.4 and 10.1 µM, respectively
(Fig. 1g). ATP and ADP reached equal potency at about 30 µM, probably as a result of fast desensitization induced
by ATP. It was noticed that ADP-mediated
[Ca2+]i increased with a slow onset at a
concentration of 10 µM or below, as tested (Fig. 1,
b and c).
|
Previously, it has been reported that several different size bands for P2X1 purinoceptor were present in many tissues by Northern blotting, with a principal band at 2.6 kb. A 1.8-kb band was also detected in HL60 cells, human spleen, and lung (17). The expression of P2X1 purinoceptor in human platelets was confirmed in the present study by Northern blot analysis as well. A single 1.8-kb band was detected in an RNA extract from human platelets as well as in the RNA extracts from Meg-01, K562, and CMK11-5 cells (Fig. 2). Using the same probe, several bands were detected in 12-O-tetradecanoylphorbol-13-acetate-treated HL60 cells with two major bands at 2.6 and 1.8 kb, similar to previous findings from another laboratory (17) (Fig. 2, lane 6). The short form (1.8 kb) in platelets may be due to a truncated, untranslated 3' terminus, as confirmed by the cDNA sequence. The single short band pattern further suggests that the expression of P2X1 purinoceptor in megakaryocytes and platelets is regulated by a different promotor or post-transcriptional processing.
|
Polyclonal antibodies were raised against the human platelet P2X1 purinoceptor using purified GST-P2X1 fusion protein overexpressed in Escherichia coli. Anti P2X1 antibody recognized a single band of 70 kDa on Western blots of P2X1-transfected 1321N1 astrocytoma cells but not of nontransfected control cells (Fig. 3). A corresponding band was also recognized in human platelets. In addition, two other large faint bands (~95 and 120 kDa) were also detected in human platelets after longer exposure, which remains unexplained at the moment. It may be due to nonspecific binding of the polyclonal antibody. Subsequent immunoprecipitation assay would help to rule out this possibility. On the basis of obtained cDNA sequence, a 45-kDa peptide was predicted for human P2X1 purinoceptor. The high molecular mass of the band detected in human platelets indicates possibly a significant glycosylation of the receptor in the extracellular domain. This size is different from the previously reported ADP-binding proteins in human platelets using photo-affinity labeling (43 kDa) (8), solubilization (61 kDa) (9), or covalent labeling with FSBA (100 kDa) (10).
|
The number of ADP-activated channels was estimated in the range of
13-130/platelet (3, 11). It has been suggested that P2X1
may be involved in ADP-induced platelet shape change (20). However,

-methylene-ATP, which is a selective agonist for P2X1 purinoceptor and is independent of phospholipase C activation (12), did
not induce any platelet shape change (6, 7), although it caused calcium
influx in human platelets (11, 20). Ligand binding studies have shown
that at least two binding sites for ADP exist in human platelets (4, 5,
21). Expression of the P2Y1 purinoceptor has been reported
in human platelets recently (14). P2Y2 was also detected by
reverse transcription-PCR in human
platelets2 and in
Meg-01 cells (22). Expression of P2Y7 was found in another megakaryoblastic cell line HEL (20). It is now established that all P2Y
purinoceptors cloned so far are coupled to G-proteins, which mediate
phospholipase C activation/adenylyl cyclase activity change (13). In
human platelets, there are at least five isoforms of phospholipase C;
they are involved in G-protein-coupled or tyrosine kinase-linked signal
transduction to generate inositol 1,4,5-trisphosphate (23). All
isoforms of phospholipase C contain a C2 domain that requires calcium
for its function; all phospholipase Cs are activated by calcium
in vitro (24). Watson et al. (25) have reported
that the elevation of intracellular calcium regulates agonist-induced
activation of phospholipase C in human platelets. ADP has been shown to
raise the intracellular concentration of calcium in platelets by two
sequential mechanisms, the opening of nonselective cation channels
(P2X1) in 20 ms to allow calcium influx followed by
mobilization of calcium from the intracellular stores with a delay of
200 ms through the activation of G-protein-coupled receptor (2, 3).
Although the initial small calcium elevation alone is not able to
mediate any detectable physiological effects, the increased
intracellular calcium concentration may prime or enhance the activation
of some components in the signal transduction cascade, such as
phospholipase C, for subsequent receptor-mediated signal
transduction.
In summary, we have presented data showing that a P2X1 purinoceptor, a ligand-gated cation channel, is present in human platelets. It has an apparent molecular mass of 70 kDa as judged by SDS-polyacrylamide gel electrophorsis. Activation of this channel by ATP and ADP results in calcium influx. The physiological function of P2X1 channel in human platelets remains to be established.
| |
ACKNOWLEDGEMENTS |
|---|
We would like to thank Dr. N. N. Tandon and S. Lockyer for their suggestions and comments. We thank N. Banerjee and M. Guertin for the purification of ATP and ADP.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF020498.
To whom correspondence should be addressed: Maryland Research
Laboratories, 9900 Medical Center Dr., Rockville, MD 20850. Tel.:
301-424-9055 (ext. 2303); Fax: 301-424-9054; E-mail: bings{at}mrl.oapi.com.
1 The abbreviations used are: PPADS, pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid; PCR, polymerase chain reaction; GST, glutathione-S-transferase; FSBA, 5'-p-fluorosulfonylbenzoyladenosine; kb, kilobase(s); RACE, rapid amplification of cDNA ends.
2 B. Sun and J. Li, unpublished observations.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
U. Lewandrowski, R. P. Zahedi, J. Moebius, U. Walter, and A. Sickmann Enhanced N-Glycosylation Site Analysis of Sialoglycopeptides by Strong Cation Exchange Prefractionation Applied to Platelet Plasma Membranes Mol. Cell. Proteomics, November 1, 2007; 6(11): 1933 - 1941. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-L. Xia, L. Wang, M. N. Cash, X. Teng, R. A. Schwalbe, and C. S. Wingo Extracellular ATP-induced calcium signaling in mIMCD-3 cells requires both P2X and P2Y purinoceptors Am J Physiol Renal Physiol, August 1, 2004; 287(2): F204 - F214. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Toth-Zsamboki, C. Oury, H. Cornelissen, R. De Vos, J. Vermylen, and M. F Hoylaerts P2X1-mediated ERK2 Activation Amplifies the Collagen-induced Platelet Secretion by Enhancing Myosin Light Chain Kinase Activation J. Biol. Chem., November 21, 2003; 278(47): 46661 - 46667. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. North Molecular Physiology of P2X Receptors Physiol Rev, October 1, 2002; 82(4): 1013 - 1067. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hechler, P. Toselli, C. Ravanat, C. Gachet, and K. Ravid Mpl Ligand Increases P2Y1 Receptor Gene Expression in Megakaryocytes with No Concomitant Change in Platelet Response to ADP Mol. Pharmacol., November 1, 2001; 60(5): 1112 - 1120. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Greco, G. Tonon, W. Chen, X. Luo, R. Dalal, and G. A. Jamieson Novel structurally altered P2X1 receptor is preferentially activated by adenosine diphosphate in platelets and megakaryocytic cells Blood, July 1, 2001; 98(1): 100 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Di Virgilio, P. Chiozzi, D. Ferrari, S. Falzoni, J. M. Sanz, A. Morelli, M. Torboli, G. Bolognesi, and O. R. Baricordi Nucleotide receptors: an emerging family of regulatory molecules in blood cells Blood, February 1, 2001; 97(3): 587 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-M. Zhao, H.-H. Xue, K. Chida, T. Suda, Y. Oki, M. Kanai, C. Uchida, A. Ichiyama, and H. Nakamura Effect of erythromycin on ATP-induced intracellular calcium response in A549 cells Am J Physiol Lung Cell Mol Physiol, April 1, 2000; 278(4): L726 - L736. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Quinn and D. J. Fitzgerald Ticlopidine and Clopidogrel Circulation, October 12, 1999; 100(15): 1667 - 1672. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |