JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, B.
Right arrow Articles by Kambayashi, J.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, B.
Right arrow Articles by Kambayashi, J.-i.

J Biol Chem, Vol. 273, Issue 19, 11544-11547, May 8, 1998


P2X1 Purinoceptor in Human Platelets
MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION AFTER HETEROLOGOUS EXPRESSION*

Bing SunDagger , Jess Li, Kazuhiro Okahara, and Jun-ichi Kambayashi

From the Department of Thrombosis and Vascular Biology, Maryland Research Laboratories, Otsuka America Pharmaceutical, Inc., Rockville, Maryland 20850

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

ADP is an important physiological platelet agonist. The molecular identity of the ADP receptor(s) in human platelets, however, is still unclear. Although P2T purinoceptor was believed to be the ligand-gated cation channel for ADP in human platelets, recent patch clamp studies now suggest it is P2X1 type. In the present study, we have cloned a cDNA encoding a P2X1 purinoceptor from human platelets using degenerate reverse transcription and polymerase chain reaction. Northern blotting with a P2X1-specific probe revealed a band of 1.8 kilobases in human platelets as well as in several megakaryoblastic cell lines. 1321N1 human astrocytoma cells expressing the cloned P2X1 cDNA exhibited both ATP- and ADP-stimulated Ca2+ influx that could be blocked by the purinoceptor antagonist pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin. Additionally, a polyclonal antibody raised against glutathione-S-transferase-P2X1 fusion peptide reacted with a 70-kDa band on Western blot of human platelets. It is therefore concluded that functional P2X1 purinoceptors are present in human platelets.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

Platelet activation is known to be involved in the development of atherosclerosis and restenosis after angioplasty. ADP is an important endogenous platelet agonist. Stimulation of platelets with ADP has been shown to mediate platelet shape change, aggregation, and further release of ADP and ATP from activated platelets. The ADP receptor in platelets is reported to possess a unique, pharmacologically characteristic P2T-type purinoceptor (1). Activation of the ADP receptor causes immediate activation of a non-selective cation channel that mediates calcium influx and mobilization of calcium from intracellular stores (2, 3). Membrane binding experiments have indicated the presence of both high and low affinity binding sites for ADP in platelets (4, 5). Furthermore, pharmacological and clinical studies have also suggested the presence of two types of ADP receptors (6, 7). Several platelet membrane ADP-binding proteins have been proposed as putative ADP receptor (8-10), but no peptide sequence is available for the cloning purposes. Recently, it has been shown by patch clamp techniques and intracellular calcium measurements that both ADP and ATP can activate a channel and mediate an increase in intracellular calcium concentration in human platelets. It has also been suggested that the ADP/ATP-gated non-selective cation channel resembles a P2X1 purinoceptor (11).

Extracellular ATP and ADP interact with two subgroups of P2 purinoceptors, P2X and P2Y (12, 13). Molecular cloning has identified seven members of P2X, a non-selective cation channel with two transmembrane domains; P2Y, which belongs to the seven-transmembrane domain G-protein-coupled receptor family, consists of more than seven members identified to date. Based on the effects of ADP on adenylyl cyclase, activation of phospholipase C, and intracellular calcium mobilization, we hypothesize that the P2T receptor in human platelets may consist of one P2X-like and one or more P2Y-like separate components. This hypothesis is also supported by recent demonstration of a P2Y1-type purinoceptor in human platelets (14). In the present study, P2X1 cDNA was cloned from human platelets, and its function was further characterized after heterologous expression in mammalian cells.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

Reagents and Solutions-- ATP, ADP, alpha ,beta -methylene-ATP, aspirin, and apyrase were purchased from Sigma. ATP and ADP were further purified by high performance liquid chromatography using a Partisil Sax 10 µm, 250 × 4.6-mm column and a gradual elution with 50-750 mM ammonium phosphate buffer, pH 3.5. Fura-2 acetoxymethyl ester was from Molecular Probes (Eugene, OR); pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid (PPADS)1 was from Calbiochem; and suramin was from RBI (Natick, MA). HEPES-Tyrode buffer for calcium measurement contained 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 10 mM glucose, and 20 mM HEPES, pH 7.4. In the case of calcium-free solution, CaCl2 was replaced with 1 mM EGTA.

RNA Isolation, cDNA Synthesis, and Polymerase Chain Reaction (PCR) Amplification-- Blood was drawn from healthy volunteers and mixed with 0.1 volume of 3.8% sodium citrate followed by centrifugation at 150 × g for 20 min. Supernatant (platelet-rich plasma) was collected without disturbing buffy coat and packed red blood cells. Aspirin (1 mM) and apyrase (20 µg/ml, final concentration) were then added to prevent platelet activation by spontaneously released thromboxane and ADP, respectively (3). Contaminating leukocytes and red blood cells were removed by an additional centrifugation for 10 min at 150 × g. The pH of resultant platelet-rich plasma was lowered to 6.5 with citric acid (4 µl/ml from 1 M stock) before sedimentation of platelets at 800 × g for 15 min (4). The pellet was lysed, and RNA was extracted with RNA STAT-60 (TEL-TEST B, Inc.). Possible contamination of platelet RNA specimens with leukocyte RNA was ruled out by reverse transcription-PCR amplification (negative) of beta 2 integrin, which presents in leukocytes but not in platelets, using two specific primers. First strand complementary DNA (cDNA) was synthesized utilizing a random hexamer primer using SuperscriptTM (Life Technologies, Inc.). Degenerate primers for P2X were designed and synthesized based on the conserved regions of rat P2X1, P2X2, and P2X3. The sequence for 5' primer used was 5'-TTCACCMTYYTCATCAARAACAGCATC-3', and the 3' primer was 5'-ATRGTRGGRATGAKRYYRAAYTTSCC-3' (M = A and C, Y = C and T, R = A and G, K = T and G, S = C and G). cDNA was then amplified by PCR using a Perkin-Elmer thermocycler 480. Cloned cDNA fragments in pCR2.1 plasmid (Invitrogen) were sequenced manually using Sequenase V2.0 (Amersham Pharmacia Biotech) or automatically using an ABI Prism 377 DNA sequencer. To obtain the full-length cDNA, rapid amplification of 5' cDNA ends (5'-RACE) and 3'-RACE (Life Technologies) were used to amplify 5' and 3' termini of the P2X1 cDNA, respectively.

Heterologous Expression-- The full-length P2X1 coding region was amplified from human platelets and cloned into a mammalian expression vector pcDNA3 (Invitrogen). The expression was driven by a cytomegalovirus early promoter. Transfection into 1321N1 human astrocytoma cells (a kind gift from Dr. Toews, Nebraska University Medical Center) that are deficient in purinergic receptors (15) was carried out using calcium phosphate precipitation. Stable transfectants were selected using G418 at the concentration of 500 µg/ml for 12 days.

Intracellular Calcium ([Ca2+]i) Measurement-- 1321N1 astrocytoma cells grown on glass coverslips were loaded with Fura-2-acetoxymethyl ester (1 µM) for 30 min at room temperature. After washing with HEPES-Tyrode buffer, changes in Fura-2 fluorescence were measured in a SPEX spectrofluorometer (Floromax-2). [Ca2+]i was calculated from the 340/380 ratio as described by Grynkiewicz et al. (16).

Northern Blotting-- a cDNA fragment containing the 5'-terminal 958-base pair coding region of P2X1 cDNA from human platelets was labeled with 32P by nick translation and used as probe. Total RNA was extracted from pooled, fresh human platelets, cultured Meg-01, K562, and CMK11-5 cells and run on a 1% denatured formaldehyde-agarose gel. After blotting and fixing on a nylon membrane, the membrane was incubated with the probe and allowed to hybridize at 42 °C overnight. The membrane was then washed three times with 1× SSC (150 mM NaCl and 15 mM sodium citrate) plus 0.1% SDS. Before exposing to x-ray film, the membrane was washed once with 0.2× SSC containing 0.1% SDS.

Western Blotting-- The full-length P2X1 coding region from human platelets was recombined into plasmid vector pGEX-2T (Amersham) and overexpressed as a GST fusion protein. The GST-P2X1 fusion protein was purified from the cell lysates by affinity chromatography on glutathione-immobilized-Sepharose beads followed by elution with glutathione. The eluted fusion product was dialyzed three times against Tris-buffered saline (150 mM NaCl, 10 mM Tris, pH 7.4) and used to raise polyclonal antibodies in rabbits by Animal Pharm Services, Inc. (Healdsburg, CA). IgG was purified by affinity chromatography on Protein A-Sepharose. The specificity of the IgG was confirmed; the antibody recognized the Gst-P2X1 fusion protein but not GST alone.

Human platelets and cultured cells were lysed in radioimmune precipitation assay buffer (phosphate-buffered saline plus 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM dithiothreitol, 1 mM EDTA, and 0.5% digitonin) for 60 min on ice. After centrifugation at 5,000 rpm in an Eppendorf centrifuge for 10 min, the supernatants were mixed with loading buffer and denatured for 5 min at 95 °C, and components were resolved on 12% SDS-polyacrylamide gel electrophorsis. Resolved proteins were transferred onto nitrocellulose using a Bio-Rad trans-blot electrophoretic system. After blocking nonspecific binding sites with nonfat dry milk (5% in phosphate-buffered saline plus 0.5% Tween 20) overnight, the membrane was probed with anti GST-P2X1 IgG (1:2,500) for 60 min at room temperature. Horseradish peroxidase-conjugated anti-rabbit IgG was used as secondary antibody. Finally, the immunoreactive bands were visualized by ECL (Amersham).

    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

A single band of cDNA was amplified from human platelet RNA preparations as well as from three megakaryoblastic cell lines (Meg-01, K562, and CMK11-5) using degenerate primers for the P2X purinoceptor. Subsequent DNA sequencing confirmed that the sequence of this fragment was identical to a region of cloned human urinary bladder smooth muscle P2X1 receptor (17). To detect any less homologous subtypes, we have attempted to use very low annealing temperatures for the PCR amplification (down to 30 °C), but no additional homologous clones were obtained. To obtain the full-length platelet P2X1 cDNA, 5'-RACE and 3'-RACE protocols were used to clone the 5' and 3' terminals of the cDNA, respectively. Several clones for the 5'-terminal and 3'-terminal regions of P2X1 in human platelets were amplified and subsequently cloned into pCR2.1 vectors. After complete two-directional DNA sequencing, it was found that the total length of cDNA for P2X1 in human platelets is 1861 base pairs. In comparison to the human urinary bladder P2X1 clone, the P2X1 cDNA in human platelets is 885 base pairs shorter at the 3' terminus of the noncoding region. At the 5' terminus there are 103 additional bases in the platelet cDNA. The sequence is 5'-AGGGGAATTTATTTGTCCATGGGCGAGGCTGGCCTGCAGTCTGTTGCCTTCCAGGGGCCAAGAGCTGCTCTGATCACCCAGGGATTCTCTCTCCAACCCAAGT-3'. The region from base 57 to 100 of the platelet cDNA shows a high homology (84%) to the rat P2X1 cDNA 5' terminus (base 1-44). The difference between platelet and bladder smooth muscle at the 5' terminus together with the truncated 3' terminal suggests that the transcription of P2X1 in human megakaryocyte may be regulated by a different promoter or that post-transcriptionally it undergoes a different splicing process (see discussion). The coding region, however, is identical between the platelet and bladder smooth muscle P2X1 cDNA. Therefore, the P2X purinoceptor expressed in human platelets is the P2X1 subtype, a nonselective cation channel with 399 amino acids and two hydrophobic domains as predicted from the cDNA sequence.

To characterize the function of the platelet P2X1 channel, we overexpressed the platelet P2X1 cDNA in 1321N1 human astrocytoma cells, which have been reported to be unresponsive to ATP or ADP (15). Intracellular free calcium was measured to monitor the channel activity after stimulation. After selection with G418, 14 stably transfected cell lines were tested, and among those, two responded to ATP stimulation. All subsequent experiments were carried out with these two cell lines using nontransfected cells as the negative control. It was found that both ATP and ADP caused intracellular calcium to increase dose-dependently followed by a slightly elevated plateau (Fig. 1). In calcium-free buffers (in the presence of 1 mM EGTA) as shown in Fig. 1e, no [Ca2+]i increase was observed upon ATP or ADP addition, indicating that the calcium increase seen in the presence of extracellular calcium was solely due to extracellular calcium influx through the expressed P2X1 channel. Furthermore, ATP/ADP-induced [Ca2+]i increase was inhibited by the purinoceptor type 2-specific antagonists PPADS (100 µM, Fig. 1d) and suramin (100 µM, data not shown). Desensitization of the channel was also observed. Applying either ATP or ADP (up to 100 µM) 3 min after the first dose (1 or 10 µM) caused little or no further [Ca2+]i elevation (data not shown). Similar results have been reported in human platelets by monitoring ATP-activated ion channel activity using patch clamp techniques (11). Even at low temperatures ATP slowly hydrolyzes to ADP. To accurately estimate the potency of different agonists of the platelet P2X1 channel, ATP and ADP were purified by ion exchange chromatography. It was found that ATP was contaminated with ADP by less than 1%. No difference was observed between purified and nonpurified ATP or ADP in calcium influx amplitude. As shown in Fig. 1, the order of potency in mediating the [Ca2+]i increase in the transfected cells was alpha ,beta -methylene-ATP > ATP > ADP. This order is different from that of human bladder smooth muscle (17) and that of rat vas deferens P2X1 purinoceptor overexpressed in oocytes (18), where alpha ,beta -methylene-ATP was slightly less potent than ATP. This discrepancy may be due to the different expression vehicles employed (mammalian cell versus Xenopus oocyte) and different detection systems (intracellular calcium versus ion current by patch clamp). However, the potency of alpha ,beta -methylene-ATP > ATP reported in the present study for platelet P2X1 channel correlates well with the higher potency of alpha ,beta -methylene-ATP in whole tissue studies (19). The EC50 for ATP and ADP for the platelet P2X1 channel was estimated to be 3.4 and 10.1 µM, respectively (Fig. 1g). ATP and ADP reached equal potency at about 30 µM, probably as a result of fast desensitization induced by ATP. It was noticed that ADP-mediated [Ca2+]i increased with a slow onset at a concentration of 10 µM or below, as tested (Fig. 1, b and c).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Intracellular calcium recorded with Fura-2 in platelet P2X1 cDNA-transfected 1321N1 astrocytoma cells. a-e, typical calcium traces after stimulation with 3 µM alpha ,beta -methylene-ATP (alpha beta -meATP) (a), 3 µM ATP (b), 3 µM ADP (c) in the presence of 2 mM CaCl2; 10 µM ATP in the presence of 100 µM PPADS and 2 mM CaCl2 (d); and 10 µM ATP in the presence of 1 mM EGTA (e). Arrows indicate the time when agonists were added. f, comparison of peak [Ca2+]i increase induced by alpha beta -methylene-ATP, ATP, and ADP at the concentration of 3 µM (n = 10 each). g, dose-dependent increase in peak [Ca2+]i by ATP (bullet ) and ADP (square ). The amplitude of [Ca2+]i increase is normalized to that caused by 30 µM ATP. Each point is mean ± S.E. of 3-10 measurements.

Previously, it has been reported that several different size bands for P2X1 purinoceptor were present in many tissues by Northern blotting, with a principal band at 2.6 kb. A 1.8-kb band was also detected in HL60 cells, human spleen, and lung (17). The expression of P2X1 purinoceptor in human platelets was confirmed in the present study by Northern blot analysis as well. A single 1.8-kb band was detected in an RNA extract from human platelets as well as in the RNA extracts from Meg-01, K562, and CMK11-5 cells (Fig. 2). Using the same probe, several bands were detected in 12-O-tetradecanoylphorbol-13-acetate-treated HL60 cells with two major bands at 2.6 and 1.8 kb, similar to previous findings from another laboratory (17) (Fig. 2, lane 6). The short form (1.8 kb) in platelets may be due to a truncated, untranslated 3' terminus, as confirmed by the cDNA sequence. The single short band pattern further suggests that the expression of P2X1 purinoceptor in megakaryocytes and platelets is regulated by a different promotor or post-transcriptional processing.


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 2.   RNA blot analysis of P2X1 purinoceptor expression. 8 µg of total RNA was loaded in lanes 1-5 and 10 µg in lane 6. Molecular masses (kb) for standard markers are labeled on the left. Lane 1, human umbilical vein endothelial cells (negative control); lane 2, Meg-01 cells; lane 3, K562 cells; lane 4, human platelets; lane 5, CMK11-5 cells; and lane 6, HL60 cells, 12-O-tetradecanoylphorbol-13-acetate (0.1 µM) treatment for 24 h.

Polyclonal antibodies were raised against the human platelet P2X1 purinoceptor using purified GST-P2X1 fusion protein overexpressed in Escherichia coli. Anti P2X1 antibody recognized a single band of 70 kDa on Western blots of P2X1-transfected 1321N1 astrocytoma cells but not of nontransfected control cells (Fig. 3). A corresponding band was also recognized in human platelets. In addition, two other large faint bands (~95 and 120 kDa) were also detected in human platelets after longer exposure, which remains unexplained at the moment. It may be due to nonspecific binding of the polyclonal antibody. Subsequent immunoprecipitation assay would help to rule out this possibility. On the basis of obtained cDNA sequence, a 45-kDa peptide was predicted for human P2X1 purinoceptor. The high molecular mass of the band detected in human platelets indicates possibly a significant glycosylation of the receptor in the extracellular domain. This size is different from the previously reported ADP-binding proteins in human platelets using photo-affinity labeling (43 kDa) (8), solubilization (61 kDa) (9), or covalent labeling with FSBA (100 kDa) (10).


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 3.   Western blot analysis of P2X1 purinoceptor expression. 5 µg of protein was loaded in each lane. The membrane was exposed to x-ray film for 2 min for detection by ECL. Molecular masses (kDa) for standard markers are labeled on the right. Lane 1, nontransfected human 1321N1 astrocytoma cells (control); lane 2, 1321N1 astrocytoma cells stably transfected with platelet P2X1 cDNA; and lane 3, human platelets.

The number of ADP-activated channels was estimated in the range of 13-130/platelet (3, 11). It has been suggested that P2X1 may be involved in ADP-induced platelet shape change (20). However, alpha beta -methylene-ATP, which is a selective agonist for P2X1 purinoceptor and is independent of phospholipase C activation (12), did not induce any platelet shape change (6, 7), although it caused calcium influx in human platelets (11, 20). Ligand binding studies have shown that at least two binding sites for ADP exist in human platelets (4, 5, 21). Expression of the P2Y1 purinoceptor has been reported in human platelets recently (14). P2Y2 was also detected by reverse transcription-PCR in human platelets2 and in Meg-01 cells (22). Expression of P2Y7 was found in another megakaryoblastic cell line HEL (20). It is now established that all P2Y purinoceptors cloned so far are coupled to G-proteins, which mediate phospholipase C activation/adenylyl cyclase activity change (13). In human platelets, there are at least five isoforms of phospholipase C; they are involved in G-protein-coupled or tyrosine kinase-linked signal transduction to generate inositol 1,4,5-trisphosphate (23). All isoforms of phospholipase C contain a C2 domain that requires calcium for its function; all phospholipase Cs are activated by calcium in vitro (24). Watson et al. (25) have reported that the elevation of intracellular calcium regulates agonist-induced activation of phospholipase C in human platelets. ADP has been shown to raise the intracellular concentration of calcium in platelets by two sequential mechanisms, the opening of nonselective cation channels (P2X1) in 20 ms to allow calcium influx followed by mobilization of calcium from the intracellular stores with a delay of 200 ms through the activation of G-protein-coupled receptor (2, 3). Although the initial small calcium elevation alone is not able to mediate any detectable physiological effects, the increased intracellular calcium concentration may prime or enhance the activation of some components in the signal transduction cascade, such as phospholipase C, for subsequent receptor-mediated signal transduction.

In summary, we have presented data showing that a P2X1 purinoceptor, a ligand-gated cation channel, is present in human platelets. It has an apparent molecular mass of 70 kDa as judged by SDS-polyacrylamide gel electrophorsis. Activation of this channel by ATP and ADP results in calcium influx. The physiological function of P2X1 channel in human platelets remains to be established.

    ACKNOWLEDGEMENTS

We would like to thank Dr. N. N. Tandon and S. Lockyer for their suggestions and comments. We thank N. Banerjee and M. Guertin for the purification of ATP and ADP.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF020498.

Dagger To whom correspondence should be addressed: Maryland Research Laboratories, 9900 Medical Center Dr., Rockville, MD 20850. Tel.: 301-424-9055 (ext. 2303); Fax: 301-424-9054; E-mail: bings{at}mrl.oapi.com.

1 The abbreviations used are: PPADS, pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid; PCR, polymerase chain reaction; GST, glutathione-S-transferase; FSBA, 5'-p-fluorosulfonylbenzoyladenosine; kb, kilobase(s); RACE, rapid amplification of cDNA ends.

2 B. Sun and J. Li, unpublished observations.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References

  1. Hourani, S. M. O., and Hall, D. A. (1994) Trends Pharmacol. Sci. 15, 103-108[CrossRef][Medline] [Order article via Infotrieve]
  2. Sage, S. O., and Rink, T. J. (1987) J. Biol. Chem. 262, 16364-16369[Abstract/Free Full Text]
  3. Mahaut-Smith, M. P., Sage, S. O., and Rink, T. J. (1992) J. Biol. Chem. 267, 3060-3065[Abstract/Free Full Text]
  4. Greco, N. J., Tandon, N. N., Jackson, B. W., and Jamieson, G. A. (1992) J. Biol. Chem. 267, 2966-2970[Abstract/Free Full Text]
  5. Savi, P., Laplace, M. C. L., and Herbert, J. M. (1994) Thromb. Res. 76, 157-169[CrossRef][Medline] [Order article via Infotrieve]
  6. Gachet, C., Cattaneo, M., Ohlmann, P., Lecchi, A., Hechler, B., Chevalier, J., Cassel, D., Mannucci, P. M., and Cazenave, J. P. (1995) Br. J. Haematol. 91, 434-444[Medline] [Order article via Infotrieve]
  7. Cattaneo, M., Lecchi, A., Randi, A. M., McGregor, J. L., and Mannuci, P. M. (1992) Blood 80, 2787-2796[Abstract/Free Full Text]
  8. Cristalli, G., and Mills, D. C (1993) Biochem. J. 291, 875-881
  9. Adler, J. R., and Handin, R. I. (1979) J. Biol. Chem. 254, 3866-3872[Abstract/Free Full Text]
  10. Figures, W. R., Niewiarowski, S., Morinelli, T. A., Colman, R. F., and Colman, R. W. (1981) J. Biol. Chem. 256, 7789-7795[Abstract/Free Full Text]
  11. MacKenzie, A. B., Mahaut-Smith, M. P., and Sage, S. O. (1996) J. Biol. Chem. 271, 2879-2881[Abstract/Free Full Text]
  12. Surprenant, A., Buell, G., and North, R. A. (1995) Trends Neurosci. 18, 224-229[CrossRef][Medline] [Order article via Infotrieve]
  13. Burnstock, G., and King, B. F. (1996) Drug Dev. Res. 38, 67-71
  14. Leon, C., Hechler, B., Vial, C., Cazenave, J. P., and Gachet, C. (1997) FEBS Lett. 403, 26-30[CrossRef][Medline] [Order article via Infotrieve]
  15. Filtz, T. M., Li, Q., Boyer, J. L., Nicholas, R. A., and Harden, T. K. (1994) Mol. Pharmacol. 46, 8-14[Abstract]
  16. Grynkiewicz, G., Poenie, M., and Tsien, R. Y. (1985) J. Biol. Chem. 260, 3440-3450[Abstract/Free Full Text]
  17. Valera, S., Talabot, F., Evans, R., Gos, A., Antonarakis, S. E., Morris, M. A., and Buell, G. N. (1995) Recept. Channels 3, 283-289[Medline] [Order article via Infotrieve]
  18. Valera, S., Hussy, N., Evans, R. J., Adami, N., North, R. A., Surprenant, A., and Buell, G. (1994) Nature 371, 516-519[CrossRef][Medline] [Order article via Infotrieve]
  19. Burnstock, G., and Kennedy, C. (1985) Gen. Pharmacol. 16, 433-440[Medline] [Order article via Infotrieve]
  20. Gachet, C., Hechler, B., Leon, C., Vial, C., Leray, C., Ohlmann, P., and Cazenave, J. (1997) Thromb. Haemostasis 78, 271-275[Medline] [Order article via Infotrieve]
  21. Mills, D. C. B. (1996) Thromb. Haemostasis 76, 835-856[Medline] [Order article via Infotrieve]
  22. Hechler, B., Cazenave, J. P., Hanau, D., and Gachet, C. (1995) Nouv. Rev. Fr. Hematol. 37, 231-240
  23. Nozawa, Y., Banno, Y., and Nagata, K. (1993) in Mechanism of Platelet Activation and Control (Authi, K. S., Watson, S. P., and Kakkar, V. V., eds), pp. 37-47, Plenum Publishing Corp., New York
  24. Rhee, S. G., and Bae, Y. S. (1997) J. Biol. Chem. 272, 15045-15048[Free Full Text]
  25. Watson, S. P., Poole, A., and Asselin, J. (1995) Mol. Pharmacol. 47, 823-830[Abstract]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
Mol. Cell. ProteomicsHome page
U. Lewandrowski, R. P. Zahedi, J. Moebius, U. Walter, and A. Sickmann
Enhanced N-Glycosylation Site Analysis of Sialoglycopeptides by Strong Cation Exchange Prefractionation Applied to Platelet Plasma Membranes
Mol. Cell. Proteomics, November 1, 2007; 6(11): 1933 - 1941.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S.-L. Xia, L. Wang, M. N. Cash, X. Teng, R. A. Schwalbe, and C. S. Wingo
Extracellular ATP-induced calcium signaling in mIMCD-3 cells requires both P2X and P2Y purinoceptors
Am J Physiol Renal Physiol, August 1, 2004; 287(2): F204 - F214.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Toth-Zsamboki, C. Oury, H. Cornelissen, R. De Vos, J. Vermylen, and M. F Hoylaerts
P2X1-mediated ERK2 Activation Amplifies the Collagen-induced Platelet Secretion by Enhancing Myosin Light Chain Kinase Activation
J. Biol. Chem., November 21, 2003; 278(47): 46661 - 46667.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. A. North
Molecular Physiology of P2X Receptors
Physiol Rev, October 1, 2002; 82(4): 1013 - 1067.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Hechler, P. Toselli, C. Ravanat, C. Gachet, and K. Ravid
Mpl Ligand Increases P2Y1 Receptor Gene Expression in Megakaryocytes with No Concomitant Change in Platelet Response to ADP
Mol. Pharmacol., November 1, 2001; 60(5): 1112 - 1120.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. J. Greco, G. Tonon, W. Chen, X. Luo, R. Dalal, and G. A. Jamieson
Novel structurally altered P2X1 receptor is preferentially activated by adenosine diphosphate in platelets and megakaryocytic cells
Blood, July 1, 2001; 98(1): 100 - 107.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Di Virgilio, P. Chiozzi, D. Ferrari, S. Falzoni, J. M. Sanz, A. Morelli, M. Torboli, G. Bolognesi, and O. R. Baricordi
Nucleotide receptors: an emerging family of regulatory molecules in blood cells
Blood, February 1, 2001; 97(3): 587 - 600.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D.-M. Zhao, H.-H. Xue, K. Chida, T. Suda, Y. Oki, M. Kanai, C. Uchida, A. Ichiyama, and H. Nakamura
Effect of erythromycin on ATP-induced intracellular calcium response in A549 cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2000; 278(4): L726 - L736.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. J. Quinn and D. J. Fitzgerald
Ticlopidine and Clopidogrel
Circulation, October 12, 1999; 100(15): 1667 - 1672.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, B.
Right arrow Articles by Kambayashi, J.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, B.
Right arrow Articles by Kambayashi, J.-i.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.