![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 19, 11596-11604, May 8, 1998
From the Howard Hughes Medical Institute and the Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232
| |
ABSTRACT |
|---|
|
|
|---|
Phospholipase D (PLD) has been identified as a target of small G proteins of the Rho family. The present study was directed at defining the interaction sites of RhoA with rat brain PLD in vitro using chimeric proteins between RhoA and Ha-Ras or Cdc42Hs and point mutations.
The switch I region of RhoA, which is the common effector domain of Ras-like G proteins, was a crucial interaction site for PLD. Mutations in conserved amino acids (Tyr34, Thr37, Phe39) totally abolished PLD activation, while mutations in Val38 or Tyr42 caused partial loss. Two additional sites were responsible for the differential PLD activation ability between RhoA and Cdc42Hs. Changing Asp76 in the switch II region of RhoA to the corresponding amino acid in Cdc42Hs led to partial loss of PLD activation. A chimeric protein with the N-terminal third of Cdc42Hs changed to RhoA showed enhanced PLD activation. Analysis of other Rho/Ha-Ras chimeric proteins and mutations indicated that Gln52 adjacent to the switch II region is responsible for this gain of function.
In conclusion, the present study shows that conserved amino acids in the switch I region of RhoA are major PLD interaction sites and that residues in the switch II and internal regions are responsible for the differential activation of PLD by RhoA and Cdc42Hs.
| |
INTRODUCTION |
|---|
|
|
|---|
Phospholipase D (PLD)1 is present in a wide variety of organisms from bacteria to humans. It hydrolyzes membrane phosphatidylcholine into choline and phosphatidic acid, which is in turn converted to diacylglycerol (1). The biological functions of PLD have been proposed to be mediated by these lipid second messengers or by local changes in membrane composition resulting from phosphatidylcholine breakdown (see Ref. 1 and references therein).
Although many extracellular signals including growth factors, hormones, neurotransmitters, and cytokines can activate PLD (1), the intracellular signal transduction pathways leading to PLD activation are still unclear. Several intracellular PLD activators have been reported including Rho family small G proteins (2-4), protein kinase C (5-7) and ADP-ribosylation factor family small G proteins (8, 9). Among them, Rho family proteins have been suggested to mediate intracellular signaling from growth factor receptors and heterotrimeric G proteins to plasma membrane-associated PLD (1, 10, 11). Rho family proteins play a crucial role in cytoskeleton changes, including focal adhesion and stress fiber formation by Rho, membrane ruffling and lamellipodia formation by Rac, and filopodia formation by Cdc42Hs (12, 13). Besides these initial findings about the cytoskeletal effects of Rho family proteins, recent evidence suggests that these proteins play a role in growth control (14, 15), endocytosis (16) gene transcription due to activation of the Jun N-terminal kinase pathway (17), and activation of lipid metabolizing enzymes including PLD (18-20).
RhoA restores PLD activity in Rho-depleted membranes (3, 21) and also activates purified PLD directly in vitro (22, 23). The activation of PLD by RhoA can be amplified synergistically by ADP-ribosylation factor, which is also a PLD activator (3, 6, 22). On the other hand, Cdc42Hs and Rac1, which are closely related to RhoA, are less able to restore PLD activity in Rho-depleted membranes (3, 21) and to stimulate purified PLD in vitro (22).
Several findings indicate that RhoA also mediates PLD activation in vivo. When RhoA is modified by ADP-ribosylation by C3 toxin in Rat1 fibroblasts, PLD activation by lysophosphatidic acid or platelet-derived growth factor is blocked (10, 11). Glucosylation of RhoA by toxin B from Clostridium difficile also blocks activation of PLD by muscarinic cholinergic receptors in HEK cells (24). These data suggest that RhoA plays a crucial role in PLD activation in vivo by certain extracellular signals. Recent data showing that constitutively active V14 RhoA activates PLD when cotransfected with rat brain PLD (rPLD1) in COS-7 cells (25) also provide evidence for an in vivo function of RhoA in PLD activation. Although there is no available evidence that Cdc42Hs can activate PLD in vivo, there is a report indicating a role for Rac1 (10).
The molecular mechanism by which RhoA activates PLD is still obscure. The mechanism probably involves direct interaction to some extent, since RhoA can activate homogeneous PLD in vitro (22, 23). However, this does not exclude the possibility of the operation of indirect mechanisms in intact cells. For example, a cytosolic factor has been reported to be required for complete activation of PLD activity by RhoA in human neutrophil membranes (26). Moreover, many binding proteins for Rho family proteins have been discovered, including rhophilin (27) and various protein kinases such as p160ROCK, p65PAK, and protein kinase N (28-30). Thus, there is a possibility that these molecules may be involved in PLD activation by Rho proteins.
To elucidate the molecular signal transduction pathway between RhoA and PLD, we decided to delineate which amino residues in the RhoA molecule are responsible for PLD activation and to compare these with the interaction sites for other proteins that bind to RhoA. We also examined the residues responsible for the greater efficacy of RhoA compared with Cdc42Hs in activating PLD and found that a single residue was involved.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials--
RhoB and Rac2 cDNAs were cloned by PCR from a
human placental cDNA library, and RhoA and Cdc42Hs cDNAs were
kind gifts from Dr. R. Cerione (Cornell University). Ha-Ras cDNA
was the kind gift of Dr. I. Macara (University of Virginia). For
baculoviral expression of rPLD1, pBluebacHis2 and a transfection kit
from Invitrogen were used. pBacgus2cp and a transfection kit from
Novagen were used for small G protein expression in Sf9 cells.
Sf9 cells, BL21-competent cells, DH5
-competent cells,
S-protein-agarose, thrombin, and enterokinase were from Novagen.
Plasmid purification kits and nickel-nitrilotriacetic acid resin were
from Qiagen. Taq DNA polymerase, dNTP,
[33P]ddNTP, the Thermosequenase cyclic sequencing kit,
horseradish peroxidase-conjugated secondary antibody, ECL reagent,
GSH-Sepharose beads, and pGEX4T1 were from Amersham Pharmacia Biotech.
Pfu DNA polymerase was from Stratagene. T4 polynucleotide
kinase, T4 DNA ligase, Genenase I, Factor Xa, and restriction enzymes
were from New England Biolabs. Acrylamide, bisacrylamide, and polyprep
columns were from Bio-Rad. The OPEC oligonucleotide purification kit
was from CLONTECH. Custom oligonucleotides were
from Operon. Anti-RhoA and anti-Cdc42 antibodies were from Santa Cruz
Biotechnology, Inc. (Santa Cruz, CA). GTP
S was from Boehringer
Mannheim. Phosphatidylcholine, phosphatidylinositol 4,5-bisphosphate,
and anti-flag antibody were from Sigma. Phosphatidylethanolamine
was from Avanti.
Phosphatidyl[choline-methyl-3H]choline and
GTP
[35S] were from NEN Life Science products.
Unlabeled geranylgeranyl pyrophosphate and
[3H]geranylgeranyl pyrophosphate were from ARC. Other
reagents were from Sigma.
Preparation of Chimeric and Mutated cDNA Constructs for Bacterial Expression-- GST fusion protein expression was used to facilitate purification and subsequent protease digestion for producing free small G proteins. In some cases, the G proteins were prepared without any N-terminal additional amino acids by introducing the recognition sequence of the proteases at the N-terminal end of the G protein using PCR with Pfu polymerase. The lower primers contained the protease recognition sequences DDDDK(GATGACGACGACAAG) for enterokinase, PGAAHY(CCAGGAGCAGCACACTAC) for genenase I (New England Biolabs), and IEGK(ATCGAAGGAAAG) for factor Xa attached to the BamHI site of pGEX4T1, and the upper primer contained the EcoRI site of pGEX4T1. The resulting modified pGEX4T1 had an additional protease recognition sequence at the C-terminal side of the original thrombin digestion site. For subcloning in these modified vectors, RhoA, Cdc42Hs and Ha-Ras cDNA were modified by PCR so that the 5'-end of cDNA started from the ATG codon, while the 3'-end had an EcoRI site right after the termination codon. The 5'-end of the amplified small G protein cDNA was blunt end-ligated to the introduced protease site of the modified pGEX4T1, while the 3'-end was ligated to the EcoRI site of the vector. All primers for blunt end ligation were gel-purified, and the resulting expression constructs were sequenced to ensure that the cDNA insert was ligated in frame to GST.
Point mutations were introduced into RhoA in a similar manner. For example, the F39A mutation was introduced in a lower primer (Val35-Tyr42, ATAGTTCTCGGCCACTGTGGGCAC (mutation underlined)). The RhoA cDNA fragment down to Tyr42 was amplified by Pfu DNA polymerase using the phosphorylated mutated lower primer and an upper primer containing the DDDK sequence (GATGACGACGACAAGATGGCTGGCCATCCGGAAG). The remaining part of RhoA cDNA (Val43 to the end) was obtained by PCR using a phosphorylated upper primer (Val43-Val48; GTGGCAGATATCGAGGTG) and a lower primer containing the termination codon (underlined) and an EcoRI site (Gly189 to the end; CCGGAATTCTCACAAGACAAGGCACCCAGATTT). These two amplified RhoA cDNA fragments were ligated for 2 h at 16 °C. The final F39A RhoA cDNA was prepared by PCR using the ligation product as the template in which the upper primer contained a flag sequence and BamHI site (CGGGATCCATGGACTACTTTGATGACGACGACAAGATG) and the lower primer was same as for PCR of the RhoA cDNA fragment (Val43 to the end). A similar strategy to that described above was employed for the expression of chimeric small G proteins except for the introduction of the flag tag sequence (MDYFDDDDK), which has an enterokinase recognition sequence. Blunt end ligation of cDNA fragments generated by PCR, using either gel-purified or high pressure liquid chromatography-purified primers, was used for constructing chimeric cDNA. The corresponding parts of chimeric cDNA were generated by PCR, in which the primers for N-terminal ends had the DDDDK sequence upstream to the initiation codon, while the primers for ligation sites were phosphorylated by T4 polynucleotide kinase at 37 °C for 1 h to ensure correctly oriented ligation. The corresponding PCR fragment pairs were purified by agarose gel electrophoresis and ligated by T4 DNA ligase at 16 °C for 2 h. Final chimeric cDNA constructs were produced by PCR using the ligated PCR fragments as templates. The upper primers had both the flag tag sequence and the BamHI site, while the lower primers had the EcoRI site. In case of the Ha-Ras lower primer, the C-terminal sequence was mutated to CVLL for in vitro geranylgeranylation. After gel purification, the final chimeric cDNA was ligated into the BamHI and EcoRI sites of pGEX4T1. The DNA sequence of each chimera and mutant was checked by sequencing.Preparation of cDNA Constructs for Baculoviral Expression-- Since the isoprenyl moiety of Rho family small G proteins is required for the activation of PLD in vitro (26), we also expressed geranylgeranylated RhoA, Cdc42Hs, and chimeras between them using the baculovirus system. In this case, we used the pBacgus2cp vector, which contains both N-terminal S-tag and His tag and an enterokinase digestion site upstream to the ATG codon of the inserted sequence.
Expression of Small G Proteins in Escherichia coli--
Each
construct was introduced into the BL21 or DH5
E. coli
strain. Overnight bacterial culture was seeded into a 100× volume of
LB/ampicillin and cultured for 2 h (BL21) or 4 h
(DH5
) at 37 °C. Bacteria were induced by adding
isopropylthioglucoside to a final concentration of 0.2 mM
and further cultivated for 3 h. In the case of low expression of
soluble protein, induction was done at 16 °C for 12-16 h. After
centrifugation, the bacterial pellet was resuspended in sonication
buffer (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 10 µM phenylmethylsulfonyl fluoride) and lysed by
sonication. After centrifugation at 10,000 × g for 30 min, 150 µl of GSH beads was added to the supernatant and incubated
at 4 °C for 2 h with continuous rocking. The beads were then
transferred to a Polyprep column and washed 4 times with 10 ml of 50 mM Tris, pH 7.5, 500 mM NaCl, 5 mM
MgCl2, 1 mM EDTA solution. The GST fusion
proteins were eluted by 10 mM GSH in 50 mM
Tris, pH 7.5, 50 mM NaCl, 5 mM
MgCl2, 1 mM EDTA. The GSH in the eluate was
removed by dialysis against 20 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA solution. Purified GST fusion proteins were
analyzed by SDS-polyacrylamide gel electrophoresis and Coomassie Blue
staining. The GST portion of the fusion protein was removed by thrombin
digestion. In those cases where no additional amino acid at the N
terminus was required, the G protein portion was directly released from
the GST fusion protein using the appropriate protease. In all protease
digestion reactions, 1 unit of protease was used for digestion of 50 µg of protein, and the digestion procedure was monitored by
SDS-polyacrylamide gel electrophoresis.
Expression and Purification of Small G Proteins in Sf9 Cells-- Recombinant baculoviruses were prepared using the method recommended by manufacturer. Briefly, each expression construct was co-transfected with baculoviral genomic DNA into Sf9 cells. After staining with X-gluc, three blue plaques were selected. Each viral preparation from positive plaques was reinfected into Sf9 cells independently. At 3 days postinfection, the medium was saved for the viral stock, and the remaining infected cells were subjected to Western blot analysis using anti-RhoA or anti-Cdc42Hs antibodies. The recombinant viruses were infected into 5 × 107 Sf9 cells in 10-fold excess. At 3 days postinfection, cells were collected and resuspended in a 10× volume of the lysis buffer (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 10 µM phenylmethylsulfonyl fluoride). Expressed small G proteins were purified from cytosol or crude membranes, respectively. Cells were lysed by passing through a 25-gauge needle 10 times. After unlysed cells were removed by centrifuging at 500 × g for 10 min, the supernatant was centrifuged at 100,000 × g for 1 h. The crude membrane fraction was dissolved in a 10× volume of the lysis buffer containing 1% octylglucoside. Nickel-nitrilotriacetic acid resin (300 µl) was added to the cytosolic or membrane fractions and incubated at 4 °C for 2 h with continuous rocking. The resin was transferred to a column and washed three times with 10 ml of lysis buffer without detergent. The column was further washed five times with 5 ml of a wash buffer (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 20 mM imidazole). The small G protein was eluted with an elution buffer (50 mM Tris, pH 7.5, 50 mM, NaCl, 5 mM MgCl2, 1 mM EDTA, 100 mM imidazole) in seven 0.5-ml fractions. Each fraction was subjected to SDS-polyacrylamide gel electrophoresis and Coomassie staining to check size and purity. In the case of nontagged versions of RhoA, the G protein was released directly from the tagged protein bound to S-protein-agarose (Novagen) by enterokinase digestion.
GTP
S Binding Assay--
The amounts of active small G
proteins were determined by GTP
[35S] binding. The
purified small G proteins were incubated on ice for 10 min with 5 mM EDTA for stripping of bound guanine nucleotides. GTP
[35S]binding was performed as described (31).
MgCl2 was added to a final concentration of 10 mM for stopping the reaction after a 10-min incubation at
37 °C. GTP
[35S] bound to small G proteins was
recovered by filtration through nitrocellulose filters, and the
radioactivity was measured by a scintillation spectrometry.
In Vitro Geranylgeranylation of Bacterially Expressed Small G
Proteins--
Small G proteins (60 pmol) were incubated with
geranylgeranyl transferase at 37 °C for 30 min as described (32).
The total reaction volume was 50 µl and contained 20 mM
Tris-Cl, pH 7.7, 20 mM KCl, 1 mM
dithiothreitol, 5 mM MgCl2, 5 µM
ZnCl2, and 10 µM geranylgeranyl
pyrophosphate. The modified small G proteins were directly used for
in vitro PLD assay or stored at
70 °C. To check the
efficiency of geranylgeranylation, a parallel reaction containing 1 µCi of [1-3H]geranylgeranyl pyrophosphate was run for
30 min. The reaction was stopped by adding SDS to a final concentration
of 4%, and the radioactivity in the geranylgeranylated small G protein
precipitated by 15% trichloracetic acid was measured by scintillation
spectrometry.
Expression of rPLD1 in Sf9 Cells-- rPLD1 was expressed as a hexahistidine-tagged protein in Sf9 cells and purified by Ni2+-agarose affinity chromatography as described by Min et al. (23). It was quantified by the Bio-Rad protein microassay.
In Vitro PLD Assay--
Geranylgeranylated small G proteins (60 pmol) were incubated with 5 mM EDTA on ice for 10 min and
then with 0.5 mM GTP
S at 37 °C for 10 min. At the end
of the incubation, MgCl2 was added to a final concentration
of 10 mM. The GTP
S-loaded G proteins were added directly
to an in vitro PLD assay mixture consisting of 20 ng of
rPLD1 and phospholipid vesicles
(phosphatidylethanolamine/phosphatidylinositol 4,5-P2/phosphatidylcholine; 16:1.4:1) containing 0.5 µCi
of [choline-methyl-3H]phosphatidylcholine. The
assay was performed at 37 °C for 30 min or 1 h as described
(33) except for the following modifications. Dithiothreitol was added
to a final concentration of 2.5 mM, and all incubations
contained 0.25 µM GTP
S. At the end of the incubation, lipids were precipitated by 5.6% trichloroacetic acid with 0.28% bovine serum albumin as carrier and removed by centrifugation. The
activity of PLD was determined by the radioactivity
([3H]choline) in 300 µl of the supernatant.
| |
RESULTS |
|---|
|
|
|---|
Effects of Various Small G Protein Preparations on rPLD1
Activity--
We tested both the bacterial and insect cell expression
systems for setting up a fast and efficient system for the production of small G proteins. As expected, geranylgeranylated RhoA expressed in
Sf9 cells activated purified rPLD1 about 15-fold, while
unmodified RhoA expressed in E. coli activated it only
4-fold (Fig. 1A). Initial
results indicated that the GST portion needed to be removed for
activation of rPLD1 in the case of GST fusion proteins expressed in
bacteria (data not shown). However, the presence of a short N-terminal
tag (flag tag or S-tag) had little effect on rPLD1 activation by either
prenylated (Sf9) or unmodified (E. coli) RhoA (Fig.
1A). rPLD1 activation by Sf9 RhoA was maximal with 0.1-0.2 µM bound GTP
S, whereas activation of rPLD1 by
unmodified RhoA required over 1 µM bound GTP
S.
Cdc42Hs, a G protein closely related to RhoA, also needed
geranylgeranylation for significant rPLD1 activation (Fig.
1B). No activation of rPLD1 was observed with the G proteins
in the absence of GTP
S (data not shown). These data show that
isoprenyl modification of Rho family proteins enhances their potency
and efficacy for activation of rPLD1 in vitro.
|
S-bound species. In these experiments, 0.03 and 0.06 µM
GTP
S-bound geranylgeranylated G proteins were used, since these
concentrations produced maximal or nearly maximal stimulation of rPLD1
(Figs. 2-6).
|
Determination of the Major rPLD1 Interaction Regions of RhoA-- We initially made four different RhoA/Cdc42Hs chimeric proteins. Chimera CRR, in which the N-terminal 58 amino acids of RhoA including the switch I region were substituted with the corresponding region of Cdc42Hs (Fig. 3A), significantly, lost rPLD1 activation ability (Fig. 3B). However, chimera RCC, made by replacing the N-terminal 56 amino acids of Cdc42Hs with the corresponding region of RhoA (Fig. 3A), showed significantly greater rPLD1 activation than wild type Cdc42Hs (Fig. 3B). These data indicate that the N-terminal region of RhoA, including the switch I region, contains a rPLD1-interacting site. Chimera RCR in which an internal sequence (Asp59-Met157) of RhoA, including the switch II region and inserted helix, was changed to the corresponding region of Cdc42Hs (Fig. 3A) also showed a decreased rPLD1 activation that was similar to that of chimera RCC (Fig. 3B). This result indicates that this region also contains a rPLD1 interaction site (Fig. 3B). However, the fact that the decrease in rPLD1 activation by chimera CRR was greater than that by chimera RCR suggests that the N-terminal region of RhoA contains the major interaction site with rPLD1.
|
Locating rPLD1 Interaction Sites in the N-terminal Third of RhoA-- We further investigated the rPLD1 interaction sites of RhoA using chimeric proteins between RhoA and Ha-Ras. We made nine different RhoA/Ha-Ras chimeric proteins, which covered the entire N-terminal third of RhoA (Fig. 4A). Some chimeras (A-E, G, and I) showed no significant loss of function (Fig. 4, B and C). Chimera F, in which the switch I region of RhoA (Tyr34-Tyr42) was swapped with that of Ha-Ras, totally failed to activate rPLD1 (Fig. 4B). However, chimera H, made by substituting Lys51-Glu54 of RhoA with the corresponding amino acids of Ha-Ras, showed decreased rPLD1 activation (Fig. 4C). Taken together, these data confirm that the switch I region, which is known as an effector region of Ras superfamily G proteins, is a major interaction site with rPLD1 and indicate that there is an additional interaction site in the N-terminal third of RhoA.
|
Determination of the Amino Acid Residues in the N-terminal Region of RhoA That Interact with rPLD1 in Vitro-- We next introduced point mutations at Phe39 and Tyr42 in the switch I region (Fig. 5A), since these two amino acids have been reported to be crucial in the specificity of downstream signal transduction in Rac and Cdc42Hs (34). As shown in Fig. 5B, rPLD1 activation induced by the Y42C RhoA mutant was much less than that caused by wild type RhoA, and the F39A mutation totally abolished rPLD1 activation.3 In contrast, the N41A mutation introduced at the closely located Asn showed no effect (Fig. 5B). We analyzed other amino acid residues in the switch I region because Phe39 and Tyr42 are highly conserved in Rho family proteins (Fig. 5A), and many amino acids in this region are highly conserved in Ha-Ras (Fig. 5A) and other members of the Ras superfamily (35). The Y34C, V35E, T37N, V38S, and E40Q point mutations were made in RhoA.4 Both the Y34C and T37N mutations rendered RhoA inactive in rPLD1 activation, while the V35E or E40Q mutations showed no effects (Fig. 5C). The V38S mutation showed reduced rPLD1 activation, as observed for the Y42C mutation (Fig. 5C). Taken together, these findings support the conclusion that a major interaction of RhoA with rPLD1 is mediated through specific amino acid residues in the switch I region.
|
Determination of Additional rPLD1 Interaction Sites of RhoA-- The chimera RCR showed impaired rPLD1 activation (Fig. 3B), indicating that there might be additional interaction sites in the internal region of RhoA. Two additional RhoA/Cdc42Hs chimeric proteins were made, namely SH and S, in order to define the site more closely., Chimera SH was made by substituting the RhoA region spanning from Asp65 to Pro141 with the corresponding Cdc42Hs region, while chimera S was made by substituting the RhoA region from Asp65 to Leu92 with the corresponding Cdc42Hs region (Fig. 3A). Chimera SH included both the switch II region and insertion helix, which are common characteristics of Rho family proteins (36, 37), whereas chimera S included only the switch II region. When tested for rPLD1 activation, chimera SH showed similar efficacy to chimeras S although it had the additional RhoA sequence Asp93-Pro141 (Fig. 6A). Chimera SH also acted similarly to chimera RCR, although RCR had the additional RhoA sequence Asp142-Met157. Based on these data, we conclude that the absence of the RhoA region from Asp65 to Leu92, including the switch II region, is responsible for the decreased rPLD1 activation ability of the chimeras. These data imply that an additional rPLD1 interacting site is in this sequence of RhoA.
|
| |
DISCUSSION |
|---|
|
|
|---|
Activation of rPLD1 by RhoA-- As expected from previous studies (26), unprenylated RhoA expressed in E. coli showed little ability to activate rPLD1. However, the potency of RhoA expressed in E. coli and then geranylgeranylated in vitro was very similar to that of RhoA expressed in Sf9 cells, indicating that geranylgeranylation was the functionally important post-translational modification. Because the extent of geranylgeranylation of RhoA from Sf9 cytosol could not be readily measured, whereas that of E. coli could be accurately determined, the in vitro modified G proteins were used for the studies with chimeras and point mutations.5
We verified the active confirmation of the chimeric and point-mutated proteins by measuring GTP
S binding, and those proteins that showed
low binding were not used. Furthermore, the use of a nonhydrolyzable
GTP analogue eliminated any possible differences in GTPase activity.
Any variations in geranylgeranylation were solved by using same amount
of geranylgeranylated form of GTP
S-bound proteins. Since PLD
activation is totally dependent on both GTP
S binding and
geranylgeranyl modification at the G protein concentrations used in the
study (<0.5 µM), the effect of the presence of
unmodified or GDP-bound small G proteins was probably negligible.
Interaction Sites of RhoA with rPLD1-- The amino acid sequence divergency among Rho family small G proteins is greater in the C-terminal half. Since RhoA showed greater PLD activation than most Rho family proteins, this region may be expected to be an interaction site with PLD. However, our data show that the switch I and II regions are interaction sites with rPLD1 in vitro. Ironically, these regions are well conserved. As illustrated in Table I, the switch I region is also crucial for interaction of Rho family G proteins with other effectors (34, 38-43). Moreover, the amino acid sequence of this region is highly conserved among Rho family proteins, and the crystal structures of Rho family proteins show that the switch I regions have essentially the same structure (36-38). These considerations make it unlikely that the switch I region alone is a determinant of the specificity of effector interaction. Rather switch I seems to serve as a common docking site for regulators and effectors.
|
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Patrick Casey (Duke University) for supplying the cDNA for geranylgeranyltransferase, Dr. Richard Cerione (Cornell University) for giving the cDNAs for RhoA and Cdc42Hs, and Dr. Ian Macara (University of Virginia) for supplying the cDNA for Ha-Ras. We also are grateful to Judy Childs for help in the preparation of this manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Investigator of the Howard Hughes Medical Institute. To whom all
correspondence should be addressed. Tel.: 615-322-6494; Fax: 615-322-4381; E-mail: john.exton{at}mcmail.vanderbilt.edu.
1
The abbreviations used are: PLD, phospholipase
D; GTP
S, guanosine 5'-O-(3-thiotriphosphate); GST,
glutathione S-transferase; PCR, polymerase chain
reaction.
2 Rac1 was not tested because the bacterially expressed protein was not geranylgeranylated efficiently.
3 The mutations were designed to reproduce those in the literature (34).
4 Pro36 was not mutated, since mutations in this amino acid customarily produce structural changes.
5 RhoA expressed in the membranes of Sf9 cells was probably mostly geranylated, but the detergent used to extract the protein interfered with the PLD assay.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Pasvolsky, V. Grabovsky, C. Giagulli, Z. Shulman, R. Shamri, S. W. Feigelson, C. Laudanna, and R. Alon RhoA Is Involved in LFA-1 Extension Triggered by CXCL12 but Not in a Novel Outside-In LFA-1 Activation Facilitated by CXCL9 J. Immunol., March 1, 2008; 180(5): 2815 - 2823. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Comer, C. L. Galindo, A. K. Chopra, and J. W. Peterson GeneChip Analyses of Global Transcriptional Responses of Murine Macrophages to the Lethal Toxin of Bacillus anthracis Infect. Immun., March 1, 2005; 73(3): 1879 - 1885. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Choi, T. Hiragun, J. H. Lee, Y. M. Kim, H.-P. Kim, A. Chahdi, E. Her, J. W. Han, and M. A. Beaven Activation of RBL-2H3 Mast Cells Is Dependent on Tyrosine Phosphorylation of Phospholipase D2 by Fyn and Fgr Mol. Cell. Biol., August 15, 2004; 24(16): 6980 - 6992. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chahdi, W. S. Choi, Y. M. Kim, and M. A. Beaven Mastoparan Selectively Activates Phospholipase D2 in Cell Membranes J. Biol. Chem., March 28, 2003; 278(14): 12039 - 12045. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cao, K. M. Harnett, J. Behar, and P. Biancani PGF2alpha -induced contraction of cat esophageal and lower esophageal sphincter circular smooth muscle Am J Physiol Gastrointest Liver Physiol, August 1, 2002; 283(2): G282 - G291. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Walker and H. A. Brown Specificity of Rho Insert-mediated Activation of Phospholipase D1 J. Biol. Chem., July 12, 2002; 277(29): 26260 - 26267. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Choi, Y. M. Kim, C. Combs, M. A. Frohman, and M. A. Beaven Phospholipases D1 and D2 Regulate Different Phases of Exocytosis in Mast Cells J. Immunol., June 1, 2002; 168(11): 5682 - 5689. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Spoerner, C. Herrmann, I. R. Vetter, H. R. Kalbitzer, and A. Wittinghofer Dynamic properties of the Ras switch I region and its importance for binding to effectors PNAS, April 24, 2001; 98(9): 4944 - 4949. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. EXTON Phospholipase D Ann. N.Y. Acad. Sci., April 1, 2000; 905(1): 61 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Muthalif, J.-H. Parmentier, I. F. Benter, N. Karzoun, A. Ahmed, Z. Khandekar, M. Z. Adl, S. Bourgoin, and K. U. Malik Ras/Mitogen-Activated Protein Kinase Mediates Norepinephrine-Induced Phospholipase D Activation in Rabbit Aortic Smooth Muscle Cells by a Phosphorylation-Dependent Mechanism J. Pharmacol. Exp. Ther., April 1, 2000; 293(1): 268 - 274. [Abstract] [Full Text] |
||||
![]() |
|