JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bae, C. D.
Right arrow Articles by Exton, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bae, C. D.
Right arrow Articles by Exton, J. H.

J Biol Chem, Vol. 273, Issue 19, 11596-11604, May 8, 1998


Determination of Interaction Sites on the Small G Protein RhoA for Phospholipase D*

Chang Dae Bae, Do Sik Min, Ian N. Fleming, and John H. ExtonDagger

From the Howard Hughes Medical Institute and the Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Phospholipase D (PLD) has been identified as a target of small G proteins of the Rho family. The present study was directed at defining the interaction sites of RhoA with rat brain PLD in vitro using chimeric proteins between RhoA and Ha-Ras or Cdc42Hs and point mutations.

The switch I region of RhoA, which is the common effector domain of Ras-like G proteins, was a crucial interaction site for PLD. Mutations in conserved amino acids (Tyr34, Thr37, Phe39) totally abolished PLD activation, while mutations in Val38 or Tyr42 caused partial loss. Two additional sites were responsible for the differential PLD activation ability between RhoA and Cdc42Hs. Changing Asp76 in the switch II region of RhoA to the corresponding amino acid in Cdc42Hs led to partial loss of PLD activation. A chimeric protein with the N-terminal third of Cdc42Hs changed to RhoA showed enhanced PLD activation. Analysis of other Rho/Ha-Ras chimeric proteins and mutations indicated that Gln52 adjacent to the switch II region is responsible for this gain of function.

In conclusion, the present study shows that conserved amino acids in the switch I region of RhoA are major PLD interaction sites and that residues in the switch II and internal regions are responsible for the differential activation of PLD by RhoA and Cdc42Hs.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Phospholipase D (PLD)1 is present in a wide variety of organisms from bacteria to humans. It hydrolyzes membrane phosphatidylcholine into choline and phosphatidic acid, which is in turn converted to diacylglycerol (1). The biological functions of PLD have been proposed to be mediated by these lipid second messengers or by local changes in membrane composition resulting from phosphatidylcholine breakdown (see Ref. 1 and references therein).

Although many extracellular signals including growth factors, hormones, neurotransmitters, and cytokines can activate PLD (1), the intracellular signal transduction pathways leading to PLD activation are still unclear. Several intracellular PLD activators have been reported including Rho family small G proteins (2-4), protein kinase C (5-7) and ADP-ribosylation factor family small G proteins (8, 9). Among them, Rho family proteins have been suggested to mediate intracellular signaling from growth factor receptors and heterotrimeric G proteins to plasma membrane-associated PLD (1, 10, 11). Rho family proteins play a crucial role in cytoskeleton changes, including focal adhesion and stress fiber formation by Rho, membrane ruffling and lamellipodia formation by Rac, and filopodia formation by Cdc42Hs (12, 13). Besides these initial findings about the cytoskeletal effects of Rho family proteins, recent evidence suggests that these proteins play a role in growth control (14, 15), endocytosis (16) gene transcription due to activation of the Jun N-terminal kinase pathway (17), and activation of lipid metabolizing enzymes including PLD (18-20).

RhoA restores PLD activity in Rho-depleted membranes (3, 21) and also activates purified PLD directly in vitro (22, 23). The activation of PLD by RhoA can be amplified synergistically by ADP-ribosylation factor, which is also a PLD activator (3, 6, 22). On the other hand, Cdc42Hs and Rac1, which are closely related to RhoA, are less able to restore PLD activity in Rho-depleted membranes (3, 21) and to stimulate purified PLD in vitro (22).

Several findings indicate that RhoA also mediates PLD activation in vivo. When RhoA is modified by ADP-ribosylation by C3 toxin in Rat1 fibroblasts, PLD activation by lysophosphatidic acid or platelet-derived growth factor is blocked (10, 11). Glucosylation of RhoA by toxin B from Clostridium difficile also blocks activation of PLD by muscarinic cholinergic receptors in HEK cells (24). These data suggest that RhoA plays a crucial role in PLD activation in vivo by certain extracellular signals. Recent data showing that constitutively active V14 RhoA activates PLD when cotransfected with rat brain PLD (rPLD1) in COS-7 cells (25) also provide evidence for an in vivo function of RhoA in PLD activation. Although there is no available evidence that Cdc42Hs can activate PLD in vivo, there is a report indicating a role for Rac1 (10).

The molecular mechanism by which RhoA activates PLD is still obscure. The mechanism probably involves direct interaction to some extent, since RhoA can activate homogeneous PLD in vitro (22, 23). However, this does not exclude the possibility of the operation of indirect mechanisms in intact cells. For example, a cytosolic factor has been reported to be required for complete activation of PLD activity by RhoA in human neutrophil membranes (26). Moreover, many binding proteins for Rho family proteins have been discovered, including rhophilin (27) and various protein kinases such as p160ROCK, p65PAK, and protein kinase N (28-30). Thus, there is a possibility that these molecules may be involved in PLD activation by Rho proteins.

To elucidate the molecular signal transduction pathway between RhoA and PLD, we decided to delineate which amino residues in the RhoA molecule are responsible for PLD activation and to compare these with the interaction sites for other proteins that bind to RhoA. We also examined the residues responsible for the greater efficacy of RhoA compared with Cdc42Hs in activating PLD and found that a single residue was involved.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- RhoB and Rac2 cDNAs were cloned by PCR from a human placental cDNA library, and RhoA and Cdc42Hs cDNAs were kind gifts from Dr. R. Cerione (Cornell University). Ha-Ras cDNA was the kind gift of Dr. I. Macara (University of Virginia). For baculoviral expression of rPLD1, pBluebacHis2 and a transfection kit from Invitrogen were used. pBacgus2cp and a transfection kit from Novagen were used for small G protein expression in Sf9 cells. Sf9 cells, BL21-competent cells, DH5alpha -competent cells, S-protein-agarose, thrombin, and enterokinase were from Novagen. Plasmid purification kits and nickel-nitrilotriacetic acid resin were from Qiagen. Taq DNA polymerase, dNTP, [33P]ddNTP, the Thermosequenase cyclic sequencing kit, horseradish peroxidase-conjugated secondary antibody, ECL reagent, GSH-Sepharose beads, and pGEX4T1 were from Amersham Pharmacia Biotech. Pfu DNA polymerase was from Stratagene. T4 polynucleotide kinase, T4 DNA ligase, Genenase I, Factor Xa, and restriction enzymes were from New England Biolabs. Acrylamide, bisacrylamide, and polyprep columns were from Bio-Rad. The OPEC oligonucleotide purification kit was from CLONTECH. Custom oligonucleotides were from Operon. Anti-RhoA and anti-Cdc42 antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). GTPgamma S was from Boehringer Mannheim. Phosphatidylcholine, phosphatidylinositol 4,5-bisphosphate, and anti-flag antibody were from Sigma. Phosphatidylethanolamine was from Avanti. Phosphatidyl[choline-methyl-3H]choline and GTPgamma [35S] were from NEN Life Science products. Unlabeled geranylgeranyl pyrophosphate and [3H]geranylgeranyl pyrophosphate were from ARC. Other reagents were from Sigma.

Preparation of Chimeric and Mutated cDNA Constructs for Bacterial Expression-- GST fusion protein expression was used to facilitate purification and subsequent protease digestion for producing free small G proteins. In some cases, the G proteins were prepared without any N-terminal additional amino acids by introducing the recognition sequence of the proteases at the N-terminal end of the G protein using PCR with Pfu polymerase. The lower primers contained the protease recognition sequences DDDDK(GATGACGACGACAAG) for enterokinase, PGAAHY(CCAGGAGCAGCACACTAC) for genenase I (New England Biolabs), and IEGK(ATCGAAGGAAAG) for factor Xa attached to the BamHI site of pGEX4T1, and the upper primer contained the EcoRI site of pGEX4T1. The resulting modified pGEX4T1 had an additional protease recognition sequence at the C-terminal side of the original thrombin digestion site. For subcloning in these modified vectors, RhoA, Cdc42Hs and Ha-Ras cDNA were modified by PCR so that the 5'-end of cDNA started from the ATG codon, while the 3'-end had an EcoRI site right after the termination codon. The 5'-end of the amplified small G protein cDNA was blunt end-ligated to the introduced protease site of the modified pGEX4T1, while the 3'-end was ligated to the EcoRI site of the vector. All primers for blunt end ligation were gel-purified, and the resulting expression constructs were sequenced to ensure that the cDNA insert was ligated in frame to GST.

Point mutations were introduced into RhoA in a similar manner. For example, the F39A mutation was introduced in a lower primer (Val35-Tyr42, ATAGTTCTCGGCCACTGTGGGCAC (mutation underlined)). The RhoA cDNA fragment down to Tyr42 was amplified by Pfu DNA polymerase using the phosphorylated mutated lower primer and an upper primer containing the DDDK sequence (GATGACGACGACAAGATGGCTGGCCATCCGGAAG). The remaining part of RhoA cDNA (Val43 to the end) was obtained by PCR using a phosphorylated upper primer (Val43-Val48; GTGGCAGATATCGAGGTG) and a lower primer containing the termination codon (underlined) and an EcoRI site (Gly189 to the end; CCGGAATTCTCACAAGACAAGGCACCCAGATTT). These two amplified RhoA cDNA fragments were ligated for 2 h at 16 °C. The final F39A RhoA cDNA was prepared by PCR using the ligation product as the template in which the upper primer contained a flag sequence and BamHI site (CGGGATCCATGGACTACTTTGATGACGACGACAAGATG) and the lower primer was same as for PCR of the RhoA cDNA fragment (Val43 to the end).

A similar strategy to that described above was employed for the expression of chimeric small G proteins except for the introduction of the flag tag sequence (MDYFDDDDK), which has an enterokinase recognition sequence. Blunt end ligation of cDNA fragments generated by PCR, using either gel-purified or high pressure liquid chromatography-purified primers, was used for constructing chimeric cDNA. The corresponding parts of chimeric cDNA were generated by PCR, in which the primers for N-terminal ends had the DDDDK sequence upstream to the initiation codon, while the primers for ligation sites were phosphorylated by T4 polynucleotide kinase at 37 °C for 1 h to ensure correctly oriented ligation. The corresponding PCR fragment pairs were purified by agarose gel electrophoresis and ligated by T4 DNA ligase at 16 °C for 2 h. Final chimeric cDNA constructs were produced by PCR using the ligated PCR fragments as templates. The upper primers had both the flag tag sequence and the BamHI site, while the lower primers had the EcoRI site. In case of the Ha-Ras lower primer, the C-terminal sequence was mutated to CVLL for in vitro geranylgeranylation. After gel purification, the final chimeric cDNA was ligated into the BamHI and EcoRI sites of pGEX4T1. The DNA sequence of each chimera and mutant was checked by sequencing.

Preparation of cDNA Constructs for Baculoviral Expression-- Since the isoprenyl moiety of Rho family small G proteins is required for the activation of PLD in vitro (26), we also expressed geranylgeranylated RhoA, Cdc42Hs, and chimeras between them using the baculovirus system. In this case, we used the pBacgus2cp vector, which contains both N-terminal S-tag and His tag and an enterokinase digestion site upstream to the ATG codon of the inserted sequence.

Expression of Small G Proteins in Escherichia coli-- Each construct was introduced into the BL21 or DH5alpha E. coli strain. Overnight bacterial culture was seeded into a 100× volume of LB/ampicillin and cultured for 2 h (BL21) or 4 h (DH5alpha ) at 37 °C. Bacteria were induced by adding isopropylthioglucoside to a final concentration of 0.2 mM and further cultivated for 3 h. In the case of low expression of soluble protein, induction was done at 16 °C for 12-16 h. After centrifugation, the bacterial pellet was resuspended in sonication buffer (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 10 µM phenylmethylsulfonyl fluoride) and lysed by sonication. After centrifugation at 10,000 × g for 30 min, 150 µl of GSH beads was added to the supernatant and incubated at 4 °C for 2 h with continuous rocking. The beads were then transferred to a Polyprep column and washed 4 times with 10 ml of 50 mM Tris, pH 7.5, 500 mM NaCl, 5 mM MgCl2, 1 mM EDTA solution. The GST fusion proteins were eluted by 10 mM GSH in 50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA. The GSH in the eluate was removed by dialysis against 20 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA solution. Purified GST fusion proteins were analyzed by SDS-polyacrylamide gel electrophoresis and Coomassie Blue staining. The GST portion of the fusion protein was removed by thrombin digestion. In those cases where no additional amino acid at the N terminus was required, the G protein portion was directly released from the GST fusion protein using the appropriate protease. In all protease digestion reactions, 1 unit of protease was used for digestion of 50 µg of protein, and the digestion procedure was monitored by SDS-polyacrylamide gel electrophoresis.

Expression and Purification of Small G Proteins in Sf9 Cells-- Recombinant baculoviruses were prepared using the method recommended by manufacturer. Briefly, each expression construct was co-transfected with baculoviral genomic DNA into Sf9 cells. After staining with X-gluc, three blue plaques were selected. Each viral preparation from positive plaques was reinfected into Sf9 cells independently. At 3 days postinfection, the medium was saved for the viral stock, and the remaining infected cells were subjected to Western blot analysis using anti-RhoA or anti-Cdc42Hs antibodies. The recombinant viruses were infected into 5 × 107 Sf9 cells in 10-fold excess. At 3 days postinfection, cells were collected and resuspended in a 10× volume of the lysis buffer (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 10 µM phenylmethylsulfonyl fluoride). Expressed small G proteins were purified from cytosol or crude membranes, respectively. Cells were lysed by passing through a 25-gauge needle 10 times. After unlysed cells were removed by centrifuging at 500 × g for 10 min, the supernatant was centrifuged at 100,000 × g for 1 h. The crude membrane fraction was dissolved in a 10× volume of the lysis buffer containing 1% octylglucoside. Nickel-nitrilotriacetic acid resin (300 µl) was added to the cytosolic or membrane fractions and incubated at 4 °C for 2 h with continuous rocking. The resin was transferred to a column and washed three times with 10 ml of lysis buffer without detergent. The column was further washed five times with 5 ml of a wash buffer (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 20 mM imidazole). The small G protein was eluted with an elution buffer (50 mM Tris, pH 7.5, 50 mM, NaCl, 5 mM MgCl2, 1 mM EDTA, 100 mM imidazole) in seven 0.5-ml fractions. Each fraction was subjected to SDS-polyacrylamide gel electrophoresis and Coomassie staining to check size and purity. In the case of nontagged versions of RhoA, the G protein was released directly from the tagged protein bound to S-protein-agarose (Novagen) by enterokinase digestion.

GTPgamma S Binding Assay-- The amounts of active small G proteins were determined by GTPgamma [35S] binding. The purified small G proteins were incubated on ice for 10 min with 5 mM EDTA for stripping of bound guanine nucleotides. GTPgamma [35S]binding was performed as described (31). MgCl2 was added to a final concentration of 10 mM for stopping the reaction after a 10-min incubation at 37 °C. GTPgamma [35S] bound to small G proteins was recovered by filtration through nitrocellulose filters, and the radioactivity was measured by a scintillation spectrometry.

In Vitro Geranylgeranylation of Bacterially Expressed Small G Proteins-- Small G proteins (60 pmol) were incubated with geranylgeranyl transferase at 37 °C for 30 min as described (32). The total reaction volume was 50 µl and contained 20 mM Tris-Cl, pH 7.7, 20 mM KCl, 1 mM dithiothreitol, 5 mM MgCl2, 5 µM ZnCl2, and 10 µM geranylgeranyl pyrophosphate. The modified small G proteins were directly used for in vitro PLD assay or stored at -70 °C. To check the efficiency of geranylgeranylation, a parallel reaction containing 1 µCi of [1-3H]geranylgeranyl pyrophosphate was run for 30 min. The reaction was stopped by adding SDS to a final concentration of 4%, and the radioactivity in the geranylgeranylated small G protein precipitated by 15% trichloracetic acid was measured by scintillation spectrometry.

Expression of rPLD1 in Sf9 Cells-- rPLD1 was expressed as a hexahistidine-tagged protein in Sf9 cells and purified by Ni2+-agarose affinity chromatography as described by Min et al. (23). It was quantified by the Bio-Rad protein microassay.

In Vitro PLD Assay-- Geranylgeranylated small G proteins (60 pmol) were incubated with 5 mM EDTA on ice for 10 min and then with 0.5 mM GTPgamma S at 37 °C for 10 min. At the end of the incubation, MgCl2 was added to a final concentration of 10 mM. The GTPgamma S-loaded G proteins were added directly to an in vitro PLD assay mixture consisting of 20 ng of rPLD1 and phospholipid vesicles (phosphatidylethanolamine/phosphatidylinositol 4,5-P2/phosphatidylcholine; 16:1.4:1) containing 0.5 µCi of [choline-methyl-3H]phosphatidylcholine. The assay was performed at 37 °C for 30 min or 1 h as described (33) except for the following modifications. Dithiothreitol was added to a final concentration of 2.5 mM, and all incubations contained 0.25 µM GTPgamma S. At the end of the incubation, lipids were precipitated by 5.6% trichloroacetic acid with 0.28% bovine serum albumin as carrier and removed by centrifugation. The activity of PLD was determined by the radioactivity ([3H]choline) in 300 µl of the supernatant.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Effects of Various Small G Protein Preparations on rPLD1 Activity-- We tested both the bacterial and insect cell expression systems for setting up a fast and efficient system for the production of small G proteins. As expected, geranylgeranylated RhoA expressed in Sf9 cells activated purified rPLD1 about 15-fold, while unmodified RhoA expressed in E. coli activated it only 4-fold (Fig. 1A). Initial results indicated that the GST portion needed to be removed for activation of rPLD1 in the case of GST fusion proteins expressed in bacteria (data not shown). However, the presence of a short N-terminal tag (flag tag or S-tag) had little effect on rPLD1 activation by either prenylated (Sf9) or unmodified (E. coli) RhoA (Fig. 1A). rPLD1 activation by Sf9 RhoA was maximal with 0.1-0.2 µM bound GTPgamma S, whereas activation of rPLD1 by unmodified RhoA required over 1 µM bound GTPgamma S. Cdc42Hs, a G protein closely related to RhoA, also needed geranylgeranylation for significant rPLD1 activation (Fig. 1B). No activation of rPLD1 was observed with the G proteins in the absence of GTPgamma S (data not shown). These data show that isoprenyl modification of Rho family proteins enhances their potency and efficacy for activation of rPLD1 in vitro.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of RhoA and Cdc42Hs prepared in E. coli or Sf9 cells. PLD activity was measured with the indicated concentrations of GTPgamma S-liganded RhoA or Cdc42Hs and 20 ng of purified rPLD1 as described under "Experimental Procedures." RhoA and Cdc42Hs were prepared in E. coli or Sf9 cells as unmodified, modified (geranylgeranylated), S-tagged, or flag-tagged forms as described under "Experimental Procedures." The concentration of each G protein was expressed as that of the GTPgamma S-bound form. The results in each panel are representative of three experiments.

We next tested in vitro geranylgeranylation of RhoA expressed in E. coli. The in vitro geranylgeranylation reaction was proportional to the concentration of RhoA and Cdc42Hs added. However, the average efficiency of in vitro geranylgeranylation of RhoA was 30%, while that of Cdc42Hs was 20%. When geranylgeranylated RhoA from E. coli was compared with RhoA expressed in Sf9 cells, the two forms showed almost the same rPLD1 activation efficacy (Fig. 1C). Because we could monitor the extent of in vitro geranylgeranylation of the G proteins expressed in bacteria, we utilized these prenylated proteins for the rest of the experiments. In these studies, the concentrations of the G proteins, including chimeras, were routinely expressed as the concentrations of the geranylgeranylated GTPgamma S-bound species. In these experiments, 0.03 and 0.06 µM GTPgamma S-bound geranylgeranylated G proteins were used, since these concentrations produced maximal or nearly maximal stimulation of rPLD1 (Figs. 2-6).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2.   PLD activation by small G proteins. G proteins were expressed in E. coli and geranylgeranylated as described under "Experimental Procedures." Using a 0.03 µM (gray bars) or 0.06 µM (black bars) concentration of these modified GTPgamma S-bound G proteins, rPLD1 activity was measured for 30 min as described under "Experimental Procedures." The results are representative of three experiments.

We compared rPLD1 activation capabilities among RhoA, RhoB, Cdc42Hs, Rac2, and Ha-Ras.2 RhoA and RhoB were equally efficacious, and Cdc42Hs and Rac2 showed about one-third the activation of rPLD1 produced by RhoA, while Ha-Ras had no effect on rPLD1 (Fig. 2). Based on these results, we selected Cdc42Hs and Ha-Ras as partners for chimeric constructs with RhoA to explore the PLD-interacting sites on RhoA in vitro. Because the amino acid sequence homology between RhoA and Ha-Ras is limited, especially in the C-terminal two-thirds of RhoA, the possibility that chimeras between these two proteins might have significant conformational differences was considered. Thus, we tested both RhoA/Ha-Ras and RhoA/Cdc42Hs chimeric proteins.

Determination of the Major rPLD1 Interaction Regions of RhoA-- We initially made four different RhoA/Cdc42Hs chimeric proteins. Chimera CRR, in which the N-terminal 58 amino acids of RhoA including the switch I region were substituted with the corresponding region of Cdc42Hs (Fig. 3A), significantly, lost rPLD1 activation ability (Fig. 3B). However, chimera RCC, made by replacing the N-terminal 56 amino acids of Cdc42Hs with the corresponding region of RhoA (Fig. 3A), showed significantly greater rPLD1 activation than wild type Cdc42Hs (Fig. 3B). These data indicate that the N-terminal region of RhoA, including the switch I region, contains a rPLD1-interacting site. Chimera RCR in which an internal sequence (Asp59-Met157) of RhoA, including the switch II region and inserted helix, was changed to the corresponding region of Cdc42Hs (Fig. 3A) also showed a decreased rPLD1 activation that was similar to that of chimera RCC (Fig. 3B). This result indicates that this region also contains a rPLD1 interaction site (Fig. 3B). However, the fact that the decrease in rPLD1 activation by chimera CRR was greater than that by chimera RCR suggests that the N-terminal region of RhoA contains the major interaction site with rPLD1.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   Determination of the PLD interaction region of RhoA using RhoA/Cdc42 or RhoA/Ras chimeras. A, diagram of RhoA/Cdc42Hs or RhoA/Ha-Ras chimeras. B and C, the activity of rPLD1 was measured in the presence or absence of a 0.03 µM (gray) or 0.06 µM (black) concentration of each modified (geranylgeranylated) GTPgamma S-bound chimeric or intact G protein. Each panel is representative of three experiments.

To reinforce this point, we made a chimeric protein (SRR) in which the N-terminal 58 amino acids of RhoA were replaced by those of Ha-Ras (Fig. 3A). This chimera showed total loss of rPLD1 activation ability (Fig. 3C), supporting the view that the N-terminal one-third of RhoA, including the switch I region, is critical for interaction with rPLD1 in vitro. The idea that this region plus the region of RhoA (residues 59-157) including switch II, are required for interaction with rPLD1 in vitro was supported by the findings with chimera CCR in which the first 157 amino acids of RhoA are replaced by the corresponding residues of Cdc42Hs. This chimera showed a greatly reduced ability to activate rPLD1 (Fig. 3B). These data also indicate that the C-terminal 36 residues of RhoA play little role in rPLD1 activation, although this region includes the site of geranylgeranylation.

Locating rPLD1 Interaction Sites in the N-terminal Third of RhoA-- We further investigated the rPLD1 interaction sites of RhoA using chimeric proteins between RhoA and Ha-Ras. We made nine different RhoA/Ha-Ras chimeric proteins, which covered the entire N-terminal third of RhoA (Fig. 4A). Some chimeras (A-E, G, and I) showed no significant loss of function (Fig. 4, B and C). Chimera F, in which the switch I region of RhoA (Tyr34-Tyr42) was swapped with that of Ha-Ras, totally failed to activate rPLD1 (Fig. 4B). However, chimera H, made by substituting Lys51-Glu54 of RhoA with the corresponding amino acids of Ha-Ras, showed decreased rPLD1 activation (Fig. 4C). Taken together, these data confirm that the switch I region, which is known as an effector region of Ras superfamily G proteins, is a major interaction site with rPLD1 and indicate that there is an additional interaction site in the N-terminal third of RhoA.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Localizing the PLD interaction site in the N-terminal third of RhoA. A, diagram of RhoA/Ha-Ras chimeras. B and C, rPLD1 activity measured with a 0.03 µM (gray) or 0.06 µM (black) concentration of each modified GTPgamma S-bound chimera. Each panel is representative of three experiments.

Determination of the Amino Acid Residues in the N-terminal Region of RhoA That Interact with rPLD1 in Vitro-- We next introduced point mutations at Phe39 and Tyr42 in the switch I region (Fig. 5A), since these two amino acids have been reported to be crucial in the specificity of downstream signal transduction in Rac and Cdc42Hs (34). As shown in Fig. 5B, rPLD1 activation induced by the Y42C RhoA mutant was much less than that caused by wild type RhoA, and the F39A mutation totally abolished rPLD1 activation.3 In contrast, the N41A mutation introduced at the closely located Asn showed no effect (Fig. 5B). We analyzed other amino acid residues in the switch I region because Phe39 and Tyr42 are highly conserved in Rho family proteins (Fig. 5A), and many amino acids in this region are highly conserved in Ha-Ras (Fig. 5A) and other members of the Ras superfamily (35). The Y34C, V35E, T37N, V38S, and E40Q point mutations were made in RhoA.4 Both the Y34C and T37N mutations rendered RhoA inactive in rPLD1 activation, while the V35E or E40Q mutations showed no effects (Fig. 5C). The V38S mutation showed reduced rPLD1 activation, as observed for the Y42C mutation (Fig. 5C). Taken together, these findings support the conclusion that a major interaction of RhoA with rPLD1 is mediated through specific amino acid residues in the switch I region.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 5.   The amino acid residues of the N-terminal third of RhoA that interact with PLD. A, comparison of the switch I regions and adjacent sequences of G proteins. B, Phe39 and Tyr42 were mutated to Ala and Cys, respectively, as reported (39). Asn41, which is the site of ADP-ribosylation by C3 exoenzyme was mutated to Ala. rPLD1 activity was measured with a 0.03 µM (gray) or 0.06 µM (black) concentration of each modified GTPgamma S-bound mutated RhoA. C, Tyr34 was mutated to Cys as for Tyr42, Val35 was mutated to Glu to introduce a charged group, Thr37 was mutated to Asn as for dominant negative N19 RhoA, Glu40 was mutated to Gln to alter the charge, Val38 was mutated to Ser to introduce an OH group, and Pro36 was not mutated to avoid structural changes. rPLD1 activity was measured as described for panel B. D, each residue in chimera H was mutated to the corresponding amino acid in Cdc42Hs. Mutants of Gln52 were not tested, since they were not geranylgeranylated. rPLD1 activity was measured as described for panel B. The results of panels B-D are each representative of three experiments.

Several amino acid residues in the switch I region that are required for rPLD1 activation (Tyr34, Thr37, and Tyr42) are highly conserved in the Ras superfamily of G proteins (Fig. 5B). Other amino acid residues participating in interaction with rPLD1 (Val38 and Phe39) are also highly conserved among Rho family proteins (Fig. 5A). Therefore, these amino acid residues alone cannot explain the difference on rPLD1 activation abilities between RhoA and Cdc42Hs. Since chimera H, in which Lys51-Glu754 was substituted, showed decreased rPLD1 activation (Fig. 4B), we carried out further mutations to see if this region might be responsible for the difference. Each amino acid in this region of RhoA was mutated to the corresponding amino acid of Ha-Ras. The K51E, V53C, and E54L mutations showed no effects (Fig. 5D), which strongly suggested that Gln52 might play a role in rPLD1 activation. However, Q52T RhoA was not geranylgeranylated in vitro, so the effect of this mutation could not be tested directly.

Determination of Additional rPLD1 Interaction Sites of RhoA-- The chimera RCR showed impaired rPLD1 activation (Fig. 3B), indicating that there might be additional interaction sites in the internal region of RhoA. Two additional RhoA/Cdc42Hs chimeric proteins were made, namely SH and S, in order to define the site more closely., Chimera SH was made by substituting the RhoA region spanning from Asp65 to Pro141 with the corresponding Cdc42Hs region, while chimera S was made by substituting the RhoA region from Asp65 to Leu92 with the corresponding Cdc42Hs region (Fig. 3A). Chimera SH included both the switch II region and insertion helix, which are common characteristics of Rho family proteins (36, 37), whereas chimera S included only the switch II region. When tested for rPLD1 activation, chimera SH showed similar efficacy to chimeras S although it had the additional RhoA sequence Asp93-Pro141 (Fig. 6A). Chimera SH also acted similarly to chimera RCR, although RCR had the additional RhoA sequence Asp142-Met157. Based on these data, we conclude that the absence of the RhoA region from Asp65 to Leu92, including the switch II region, is responsible for the decreased rPLD1 activation ability of the chimeras. These data imply that an additional rPLD1 interacting site is in this sequence of RhoA.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6.   Defining an additional interaction site on RhoA that is responsible for differential PLD activation. A, chimeras SH and S were constructed as described under "Experimental Procedures" to contain the switch II regions alone (S) or plus the inserted helix region (SH). rPLD1 activity was measured with a 0.03 µM (gray) or 0.06 µM (black) concentration of each modified GTPgamma S-bound chimera. B, sequences of G proteins corresponding to Asp65-Leu72 in RhoA. C, residues in RhoA that differed from Cdc42Hs in the Asp65-Leu92 sequence were mutated to the corresponding residues in Cdc42Hs. rPLD1 activity was measured as described above. The results of panels A and C are each representative of two experiments that showed similar results.

Next we investigated the Asp65-Leu92 sequence for the residues involved in PLD activation. This region is well conserved among Rho family proteins, since only six amino acid residues are different between RhoA and Cdc42Hs (Fig. 6B). We substituted these six amino acid residues in RhoA with the corresponding residues in Cdc42Hs. The I80F, M82V, D87V, D90A, and L92F mutations had little effect on rPLD1 activation (Fig. 6C). However, the D76Q mutation in the switch II region caused diminished rPLD1 activation. These data indicate that Asp76 is also responsible for the difference in the rPLD1 activation ability of RhoA compared with Cdc42Hs.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Activation of rPLD1 by RhoA-- As expected from previous studies (26), unprenylated RhoA expressed in E. coli showed little ability to activate rPLD1. However, the potency of RhoA expressed in E. coli and then geranylgeranylated in vitro was very similar to that of RhoA expressed in Sf9 cells, indicating that geranylgeranylation was the functionally important post-translational modification. Because the extent of geranylgeranylation of RhoA from Sf9 cytosol could not be readily measured, whereas that of E. coli could be accurately determined, the in vitro modified G proteins were used for the studies with chimeras and point mutations.5

We verified the active confirmation of the chimeric and point-mutated proteins by measuring GTPgamma S binding, and those proteins that showed low binding were not used. Furthermore, the use of a nonhydrolyzable GTP analogue eliminated any possible differences in GTPase activity. Any variations in geranylgeranylation were solved by using same amount of geranylgeranylated form of GTPgamma S-bound proteins. Since PLD activation is totally dependent on both GTPgamma S binding and geranylgeranyl modification at the G protein concentrations used in the study (<0.5 µM), the effect of the presence of unmodified or GDP-bound small G proteins was probably negligible.

Interaction Sites of RhoA with rPLD1-- The amino acid sequence divergency among Rho family small G proteins is greater in the C-terminal half. Since RhoA showed greater PLD activation than most Rho family proteins, this region may be expected to be an interaction site with PLD. However, our data show that the switch I and II regions are interaction sites with rPLD1 in vitro. Ironically, these regions are well conserved. As illustrated in Table I, the switch I region is also crucial for interaction of Rho family G proteins with other effectors (34, 38-43). Moreover, the amino acid sequence of this region is highly conserved among Rho family proteins, and the crystal structures of Rho family proteins show that the switch I regions have essentially the same structure (36-38). These considerations make it unlikely that the switch I region alone is a determinant of the specificity of effector interaction. Rather switch I seems to serve as a common docking site for regulators and effectors.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Residues required for interaction of Rho family proteins with their effectors
RhoA is the G protein, except where indicated. Data are from the present study and Refs. 39-46. Weak interaction is designated by (+).

The Tyr34, Pro36, and Thr37 residues are critical in stress fiber formation induced by RhoA (39), while for the interaction of RhoA with Lbc, Lys27, Tyr34, Thr37, and Phe39, but not Tyr42, are critical (41) (Table I). For interaction of RhoA with p190RhoGAP, Tyr34 and Thr37 residues are critical and Phe39 is a weaker interacting site, but Lys27 and Tyr42 are not important (41) (Table I). As shown in Fig. 5, B and C, the Tyr34, Thr37, and Phe39 residues of RhoA are also critical interacting sites with rPLD1, and Val38 and Tyr42 show weaker interactions, while Lys27 does not participate (Fig. 4C). All of these data indicate that Tyr34, Thr37, and Phe39 are common interacting sites of RhoA with many effectors, and it seems reasonable to propose that the switch I region serves as a common docking site. Although it could be claimed that these residues are so critical to structure that their mutation disrupts the well ordered structure of the switch I region with loss of binding, Table I illustrates that some interactions are preserved when these residues are mutated in other Rho family proteins. In particular, Rac1 interactions with p65PAK and p67PHOX are not affected by mutation of Phe37 corresponding to Phe39 in RhoA (34, 38). The interaction of Cdc42Hs with p50RhoGAP, p65PAK or the Wiskott-Aldrich syndrome protein is also unaffected by changing this residue (34). Furthermore, the interaction of RhoA with p190RhoGAP is only partially affected by mutation of Phe39 (41).

Although the switch I region of Rho family small G proteins is undoubtedly very important for interaction with effectors, Table I indicates that its specificity is not high. On the other hand, the region covering the switch II region and inserted helix is important to the specificity of effector binding to Rho family small G proteins. Asp76 in the switch II region of RhoA is critical to interaction with Lbc, while Glu116 near the inserted helix is important for Cdc42Hs binding to Cdc24 (40), and Asp90 adjacent to the switch II region of RhoA is critical to p190RhoGAP binding (41). Asp76 is also important to determine differential interaction of rPLD1 between RhoA and Cdc42Hs as shown in Fig. 6C. The role of the inserted helix itself seems negligible. Chimera SH, in which both switch II and the inserted helix region are swapped with the corresponding region of Cdc42Hs, showed similar PLD activation as chimera S, which was made by swapping switch II and adjacent sequence up to Asp90 with the corresponding region of Cdc42Hs. Furthermore, RhoB, which has almost an identical amino acid sequence to RhoA except for the inserted helix and adjacent region, showed the same PLD activation. We also made a Rho/Ras chimera by switching the intervening region between switch II and the inserted helix with the corresponding region of Ha-Ras. This chimera showed similar activation of rPLD1 as wild-type RhoA (data not shown). These data indicate that the inserted helix and adjacent area are not important for interaction with rPLD1 in vitro. This is in contrast to the situation with Cdc42Hs, where the insert region mediates the interaction with RhoGDI (44). In the case of Rac1, this region is also implicated in the activation of p67PHOX (45, 46).

In addition to Asp76, the sequence between Lys51 and Asp54 is important for RhoA binding to rPLD1, with Gln52 being the probable residue involved (Fig. 5D). This conclusion is supported by the studies with chimeras between RhoA and Cdc42Hs (Fig. 3B). Furthermore, comparison of the sequences of RhoA, Cdc42Hs, and Rac1 reveals four regions of great divergence, including the Lys51-Asp54 sequence of RhoA. Although the N-terminal third of RhoA shows other large differences in amino acid sequence compared with Cdc42Hs and Rac1, the findings with chimeras between RhoA and Ha-Ras encompassing this region (Fig. 4, B and C) only indicated the switch I region and the Lys51-Asp45 sequence as being important for rPLDl activation.

In conclusion, our study shows that certain conserved amino acid residues (Tyr34, Thr37, Phe39) in the switch I region of RhoA that are important for other interactions of the G proteins (Table I) are also critical for rPLD1 activation in vitro. Another residue in the switch I region (Tyr42), which is not involved in other Rho effects, also participates in rPLD1 activation. In addition, Asp76 in the switch II region and Glu52 in the adjacent region determine the relative ability of Rho family small G proteins to activate PLD, whereas the inserted helix region does not participate.

    ACKNOWLEDGEMENTS

We thank Dr. Patrick Casey (Duke University) for supplying the cDNA for geranylgeranyltransferase, Dr. Richard Cerione (Cornell University) for giving the cDNAs for RhoA and Cdc42Hs, and Dr. Ian Macara (University of Virginia) for supplying the cDNA for Ha-Ras. We also are grateful to Judy Childs for help in the preparation of this manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Investigator of the Howard Hughes Medical Institute. To whom all correspondence should be addressed. Tel.: 615-322-6494; Fax: 615-322-4381; E-mail: john.exton{at}mcmail.vanderbilt.edu.

1 The abbreviations used are: PLD, phospholipase D; GTPgamma S, guanosine 5'-O-(3-thiotriphosphate); GST, glutathione S-transferase; PCR, polymerase chain reaction.

2 Rac1 was not tested because the bacterially expressed protein was not geranylgeranylated efficiently.

3 The mutations were designed to reproduce those in the literature (34).

4 Pro36 was not mutated, since mutations in this amino acid customarily produce structural changes.

5 RhoA expressed in the membranes of Sf9 cells was probably mostly geranylated, but the detergent used to extract the protein interfered with the PLD assay.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Exton, J. H. (1997) Physiol. Rev. 77, 303-320[Abstract/Free Full Text]
  2. Bowman, E. P., Uhlinger, D. J., and Lambeth, J. D. (1993) J. Biol. Chem. 268, 21509-21512[Abstract/Free Full Text]
  3. Siddiqi, A. R., Smith, J. L., Ross, A. H., Qiu, R-G., Symons, M., and Exton, J. H. (1995) J. Biol. Chem. 270, 8466-8473[Abstract/Free Full Text]
  4. Kuribara, H., Tago, K., Yokozeki, T., Sasaki, T., Takai, Y., Morii, N., Narumiya, S., Katada, T., and Kanaho, Y. (1995) J. Biol. Chem. 270, 25667-25671[Abstract/Free Full Text]
  5. Conricode, K. M., Brewer, K. A., and Exton, J. H. (1992) J. Biol. Chem. 267, 7199-7202[Abstract/Free Full Text]
  6. Singer, W. D., Brown, H. A., Jiang, X., and Sternweis, P. C. (1996) J. Biol. Chem. 271, 4504-4510[Abstract/Free Full Text]
  7. Ohguchi, K., Banno, Y., Nakashima, S., and Nozawa, Y. (1996) J. Biol. Chem. 271, 4366-4372[Abstract/Free Full Text]
  8. Brown, H. A, Gutowski, S., Moomaw, C. R., Slaughter, C., and Sternweis, P. C. (1993) Cell 75, 1137-1144[CrossRef][Medline] [Order article via Infotrieve]
  9. Cockcroft, S., Thomas, G. M., Fensome, A., Geny, B., Cunningham, E., Goutm, I., Hiles, I., Totty, N. F., Truong, I., and Hsuan, J. J. (1994) Science 263, 523-526[Abstract/Free Full Text]
  10. Hess, J. A., Ross, A. H., Qiu, R.-G., Symons, M., and Exton, J. H. (1997) J. Biol. Chem. 272, 1615-1620[Abstract/Free Full Text]
  11. Malcolm, K. C., Elliott, C. M., and Exton, J. H. (1996) J. Biol. Chem. 271, 13135-13139[Abstract/Free Full Text]
  12. Machesky, L. M., and Hall, A. (1996) Trends Cell Biol. 6, 304-310[CrossRef][Medline] [Order article via Infotrieve]
  13. Ridley, A. J. (1996) Curr. Biol. 6, 1256-1264[CrossRef][Medline] [Order article via Infotrieve]
  14. Olson, M. F., Ashworth, A., and Hall, A. (1995) Science 269, 1270-1272[Abstract/Free Full Text]
  15. Chou, M. M., and Blenis, J. (1996) Cell 85, 573-583[CrossRef][Medline] [Order article via Infotrieve]
  16. Lamaze, C., Chuang, T. H., Terlecky, L. J., Bokoch, G. M., and Schmid, S. L. (1996) Nature 362, 177-179
  17. Minden, A., Lin, A., Claret, F. X., Abo, A., and Karin, M. (1995) Cell 81, 1147-1157[CrossRef][Medline] [Order article via Infotrieve]
  18. Chong, L. D., Traynor-Kaplan, A., Bokoch, G. M., and Schwartz, M. D. (1994) Cell 79, 507-513[CrossRef][Medline] [Order article via Infotrieve]
  19. Zheng, Y., Bagrodia, S., and Cerione, R. A. (1994) J. Biol. Chem. 269, 18727-18730[Abstract/Free Full Text]
  20. Bokoch, G. M., Vlahos, C. J., Wang, Y., Knaus, U. G., and Traynor-Kaplan, A. E. (1996) Biochem. J. 315, 775-779
  21. Malcolm, K. C., Ross, A. H., Qiu, R-G, Symons, M., and Exton, J. H. (1994) J. Biol. Chem. 269, 25951-25954[Abstract/Free Full Text]
  22. Hammond, S. M., Jenco, J. M., Nakashima, S., Cadwallader, K., Gu, Q., Cook, S., Nozawa, Y., Prestwich, G. D., Frohman, M. A., and Morris, A. J. (1997) J. Biol. Chem. 272, 3860-3868[Abstract/Free Full Text]
  23. Min, D-S., Park, S.-K., and Exton, J. H. (1998) J. Biol. Chem. 273, 7044-7051[Abstract/Free Full Text]
  24. Schmidt, M., Rumenapp, U., Bienek, C., Keller, J., von Eichel-Streiber, C., and Jakobs, K. H. (1996) J. Biol. Chem. 271, 2422-2426[Abstract/Free Full Text]
  25. Park, S-K., Provost, J. P., Bae, C. D., Ho, W-T., and Exton, J. H. (1997) J. Biol. Chem. 272, 29263-29271[Abstract/Free Full Text]
  26. Kwak, J. Y., Lopez, I., Uhlinger, D. J., Ryu, S. H., and Lambeth, J. D. (1995) J. Biol. Chem. 270, 27093-27098[Abstract/Free Full Text]
  27. Fujisawa, K., Fujita, A., Ishizaki, T., Saito, Y., and Narumiya, S,. (1996) J. Biol. Chem. 271, 23022-23028[Abstract/Free Full Text]
  28. Nakagawa, O., Fujisawa, K., Ishizaki, T., Saito, Y., Nakao, K., and Narumiya, S. (1996) FEBS Lett. 392, 189-193[CrossRef][Medline] [Order article via Infotrieve]
  29. Manser, E., Leung, T., Salihuddin, H., Zhao, Z-S., and Lim, L. (1994) Nature 367, 40-46[CrossRef][Medline] [Order article via Infotrieve]
  30. Watanabe, G., Saito, Y., Madaule, P., Ishizakim, T., Fujisawa, K., Morii, N., Mukai, H., Ono, Y., Kakizuka, A., and Narumiya, S. (1996) Science 271, 645-648[Abstract]
  31. Zheng, Y, Hart, M. J., and Cerione, R. A. (1995) Methods Enzymol. 256, 77-84[Medline] [Order article via Infotrieve]
  32. Zhang, F. L., Diehl, R. E., Kohl, N. E., Gibbs, J. B., Giros, B., Casey, P. J., and Omer, C. A. (1994) J. Biol. Chem. 269, 3175-3180[Abstract/Free Full Text]
  33. Hammond, S. M., Altshuller, Y. M., Sung, T-C., Rudge, S. A., Rose, K., Engebrecht, J., Morris, A. J., and Frohman, M. A. (1995) J. Biol. Chem. 270, 29640-29643[Abstract/Free Full Text]
  34. Lamarche, N., Tapon, N., Stowers, L., Burbelo, P. D., Aspenstrom, P., Bridges, T., Chant, J., and Hall, A. (1996) Cell 87, 519-529[CrossRef][Medline] [Order article via Infotrieve]
  35. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) Nature 349, 117-127[CrossRef][Medline] [Order article via Infotrieve]
  36. Wei, Y., Zhang, Y., Derewenda, U., Liu, X., Minor, W., Nakamoto, R. K., Somlyo, A. B., Somlyo, A. P., and Derewenda, Z. S. (1997) Nat. Struct. Biol. 4, 699-703[CrossRef][Medline] [Order article via Infotrieve]
  37. Hirshberg, M., Stockley, R. W., Dodson, G., and Webb, M. R. (1997) Nat. Struct. Biol. 4, 147-152[CrossRef][Medline] [Order article via Infotrieve]
  38. Rittinger, K., Walker, P. A., Eccleston, J. F., Smerdo, S. J., and Gamblin, S. J. (1997) Nature 389, 758-762[CrossRef][Medline] [Order article via Infotrieve]
  39. Self, A., Paterson, H. F., and Hall, A. (1993) Oncogene 8, 655-661[Medline] [Order article via Infotrieve]
  40. Li, R., and Zheng, Y. (1997) J. Biol. Chem. 272, 4671-4679[Abstract/Free Full Text]
  41. Li, R., Zhang, B., and Zheng, Y. (1997) J. Biol. Chem. 272, 32830-32835[Abstract/Free Full Text]
  42. Diekmann, D., Nobes, C. D., Burbelo, P. D., Abo, A., and Hall, A. (1995) EMBO J. 21, 5297-5305
  43. Xu, X., Barry, D. C., Settleman, J., Schwartz, M. A., and Bokoch, G. M. (1994) J. Biol. Chem. 269, 23569-23574[Abstract/Free Full Text]
  44. Wu, W.-J., Leonard, D. A., Cerione, R. A., and Manor, D. (1997) J. Biol. Chem. 272, 26153-26158[Abstract/Free Full Text]
  45. Freeman, J. L., Abo, A., and Lambeth, J. D. (1996) J. Biol. Chem. 271, 19794-19801[Abstract/Free Full Text]
  46. Nisimoto, Y., Freeman, J. L. R., Motalebi, S. A., Hirshberg, M., and Lambeth, J. D. (1997) J. Biol. Chem. 272, 18834-18841[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Pasvolsky, V. Grabovsky, C. Giagulli, Z. Shulman, R. Shamri, S. W. Feigelson, C. Laudanna, and R. Alon
RhoA Is Involved in LFA-1 Extension Triggered by CXCL12 but Not in a Novel Outside-In LFA-1 Activation Facilitated by CXCL9
J. Immunol., March 1, 2008; 180(5): 2815 - 2823.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. E. Comer, C. L. Galindo, A. K. Chopra, and J. W. Peterson
GeneChip Analyses of Global Transcriptional Responses of Murine Macrophages to the Lethal Toxin of Bacillus anthracis
Infect. Immun., March 1, 2005; 73(3): 1879 - 1885.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. S. Choi, T. Hiragun, J. H. Lee, Y. M. Kim, H.-P. Kim, A. Chahdi, E. Her, J. W. Han, and M. A. Beaven
Activation of RBL-2H3 Mast Cells Is Dependent on Tyrosine Phosphorylation of Phospholipase D2 by Fyn and Fgr
Mol. Cell. Biol., August 15, 2004; 24(16): 6980 - 6992.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Chahdi, W. S. Choi, Y. M. Kim, and M. A. Beaven
Mastoparan Selectively Activates Phospholipase D2 in Cell Membranes
J. Biol. Chem., March 28, 2003; 278(14): 12039 - 12045.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. Cao, K. M. Harnett, J. Behar, and P. Biancani
PGF2alpha -induced contraction of cat esophageal and lower esophageal sphincter circular smooth muscle
Am J Physiol Gastrointest Liver Physiol, August 1, 2002; 283(2): G282 - G291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Walker and H. A. Brown
Specificity of Rho Insert-mediated Activation of Phospholipase D1
J. Biol. Chem., July 12, 2002; 277(29): 26260 - 26267.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. S. Choi, Y. M. Kim, C. Combs, M. A. Frohman, and M. A. Beaven
Phospholipases D1 and D2 Regulate Different Phases of Exocytosis in Mast Cells
J. Immunol., June 1, 2002; 168(11): 5682 - 5689.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Spoerner, C. Herrmann, I. R. Vetter, H. R. Kalbitzer, and A. Wittinghofer
Dynamic properties of the Ras switch I region and its importance for binding to effectors
PNAS, April 24, 2001; 98(9): 4944 - 4949.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
J. H. EXTON
Phospholipase D
Ann. N.Y. Acad. Sci., April 1, 2000; 905(1): 61 - 68.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. M. Muthalif, J.-H. Parmentier, I. F. Benter, N. Karzoun, A. Ahmed, Z. Khandekar, M. Z. Adl, S. Bourgoin, and K. U. Malik
Ras/Mitogen-Activated Protein Kinase Mediates Norepinephrine-Induced Phospholipase D Activation in Rabbit Aortic Smooth Muscle Cells by a Phosphorylation-Dependent Mechanism
J. Pharmacol. Exp. Ther., April 1, 2000; 293(1): 268 - 274.
[Abstract] [Full Text]


Home page
J. Biol. Chem.