|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J Biol Chem, Vol. 273, Issue 19, 11611-11618, May 8, 1998
From the § Program of Molecular Pharmacology and
Therapeutics, Thymidylate synthase plays an essential role in
the synthesis of DNA. Recently, several new and specific thymidylate
synthase inhibitors that occupy the folate binding site, including
Tomudex®, BW1843U89, and Thymitaq, have demonstrated therapeutic
activity in patients with advanced cancer. In order to find
drug-resistant forms of human thymidylate synthase for gene therapy
applications, human sarcoma HT1080 cells were exposed to ethyl
methanesulfonate and Thymitaq selection. Thymitaq-resistant clonal
derived sublines were established, and analysis indicated that both
gene amplification and point mutations contributed to drug resistance.
Eight mutant cDNAs that were identified from Thymitaq-resistant
sublines were generated by site-directed mutagenesis and transfected
into thymidylate synthase-negative cells. Only K47E, D49G, or G52S
mutants retain enzyme activity. Moreover, cytotoxicity studies
demonstrated that D49G and G52S transfected cells, besides displaying
resistance to Thymitaq with IC50 values 40- and
12-fold greater than wild-type enzyme transfected cells, respectively,
also lead to fluorodeoxyuridine resistance (26- and 97-fold in
IC50 values, respectively) but not to Tomudex or BW1843U89.
Characterization of the purified altered enzymes obtained from
expression in Escherichia coli is consistent with the cell
growth inhibition results. We postulate that the D49G or G52S mutation
leads to the structural perturbation of the highly conserved
Arg50 loop, decreasing the binding of thymidylate synthase
to the inhibitors, Thymitaq and fluorodeoxyuridylate.
Thymidylate synthase
(TS,1 EC 2.1.1.45) catalyzes
the de novo biosynthesis of thymidylate, which is necessary
for DNA synthesis and repair (1). The mechanism of TS activity involves
the reductive methylation of the substrate, 2'-deoxyuridine
5'-monophosphate (dUMP) by transfer of a methylene group from the
cofactor, 5,10-methylene-5,6,7,8-tetrahydrofolate (CH2H4folate), to generate 2'-deoxythymidine
5'-monophosphate (dTMP) and 7,8-dihydrofolate. Human TS has been
sequenced (2), purified (3, 4), and crystallized (5). As an attractive target for anti-cancer drug design, since the 1950s, many TS analogues of both the substrate, dUMP, and the cofactor,
CH2H4folate, have been synthesized and tested
as potential anti-cancer therapeutics. Until recently, 5-fluorouracil
and fluorodeoxyuridine (FdUrd) were the sole TS-targeted drugs approved
for clinical application. In vivo, 5-fluorouracil and FdUrd
are metabolized to 5-fluoro-2-deoxyuridylate (FdUMP), a compound that
subsequently occupies the pyrimidine binding site forming a ternary
complex with TS and the folate cofactor, resulting in inhibition of
enzyme function. The recent determination of the three-dimensional
structure of human TS has allowed the design of highly specific
inhibitors, leading to the emergence of novel folate analogues, such as
Tomudex (ZD1694), BW1843U89, and Thymitaq (AG337) (Fig.
1) (6). These promising compounds have
entered clinical trials in recent years (7).
Previous studies have attempted to correlate enzyme structure and
function using mutagenesis. To date, a large number of mutations have
been made in Lactobacillus. casei and Escherichia
coli TS (1, 8, 9). In most reports, the procedures included the following two steps: generated mutants were first screened for their
enzyme activity by genetic complementation in a TS-deficient E. coli host in the absence of thymine, and kinetic characterizations in vitro were subsequently performed for functional mutants.
A few mutants of human TS and their expressed enzymes in mammalian cells have been studied (10-14). The Y33H human TS mutant, the only
mutation in TS reported to be related to TS-directed drug resistance,
was discovered in a human colon tumor cell line and conferred
approximately a 3-4-fold resistance to FdUrd (10-12). This mutation
was reported to affect the catalytic properties of human TS enzyme,
showing an 8-fold decrease in kcat but without significant change in the Km values for both dUMP
and CH2H4folate between the mutant and
wild-type TS.
As point mutations in human TS leading to the generation of
antifolate-resistant genes have not yet been reported, an important goal of this work was to obtain human TS mutants conferring resistance to novel antifolates with minimal changes in the catalytic activity of
the altered enzymes. Such mutants would be of much interest both for
understanding structure-function for human TS and for their potential
applications in gene therapy by protecting hematopoietic progenitors
from TS inhibitor toxicity.
In the present study, we generated TS mutants from human sarcoma HT1080
cells following ethyl methanesulfonate (EMS) exposure and Thymitaq
selection. Clonal sublines containing these mutations were identified
by DNA-SSCP and sequencing. These mutant cDNAs were cloned into
mammalian expression vectors and transfected into mouse TS-negative
cells for cytotoxicity assays. The relevant enzymes were expressed in
E. coli purified and characterized by kinetic studies
in vitro.
Materials--
Ethyl methanesulfonate (EMS) was supplied by
Sigma. The TransformerTM site-directed mutagenesis kit was
purchased from CLONTECH Laboratories, Inc. (Palo
Alto, CA). The bacterial expression plasmid pET-17×b and competent
E. coli BL21(DE3) cells were from Novagen, Inc. (Madison,
WI). The mammalian expression vector pcDNA3 was from Invitrogen
(San Diego, CA). DEAE-cellulose (DE52) was from Whatman, and
phenyl-Sepharose CL-4B was from Amersham Pharmacia Biotech. Oligonucleotide primers were synthesized by either IDT, Inc.
(Coralville, IA), or Operon Technologies, Inc. (Alameda, CA). Human
recombinant TS cDNA modified to enhance expression (15) when placed
in bacterial expression vector pET-17×b (named pET-17×b (hTS)) was
kindly provided by Dr. Frank Maley (New York Health Department, Albany,
NY). Alamar Blue was from Alamar Biosciences, Inc. (Sacramento, CA).
Thymitaq (AG337) was a generous gift of Agouron Pharmaceuticals, Inc.
(San Diego, CA).
(6R,6S)-CH2H4folate was
synthesized by Dr. B. Schircks Laboratories (Jona, Switzerland).
Tomudex (ZD1694) was a kind gift from Zeneca (Macclesfield, UK).
BW1843U89 was supplied by Glaxo-Wellcome (Research Triangle Park,
NC).
Cell Lines and Culture Conditions--
Human fibrosarcoma HT1080
cells were obtained from the American Type Culture Collection
(Rockville, MD). Stock cultures of the parental cell line HT1080 and
resistant sublines were maintained in RPMI 1640 medium supplemented
with 10% fetal bovine serum, 2 mM L-glutamine,
100 µg/ml streptomycin, and 100 units/ml penicillin. The TS-negative
cell line FSthy21, a kind gift of Dr. T. Seno (9), was
originally established from mouse FM3A cells. FSthy21 cells
were grown in Eagle's minimum essential medium supplemented with 10%
dialyzed fetal bovine serum, 1 µM 5-CHO-tetrahydrofolate, and 10 µM thymidine. Prototrophic transformant clones,
derived from FSthy21 cells by transfection of wild-type or
mutant human TS cDNAs, were cultured in the same medium as
mentioned above without thymidine and reduced folate supplements.
Chemical Mutagenesis and Drug Selection--
In order to
determine the optimum concentration of EMS and Thymitaq for random
mutagenesis experiments, we first carried out the cytotoxicity assay of
human fibrosarcoma HT1080 cells with EMS or Thymitaq. IC50
values and the minimal concentration of EMS or Thymitaq that resulted
in no colony formation in HT1080 cells were obtained by plots of
colonies surviving versus various EMS or Thymitaq
concentrations.
Single-stranded Conformation Polymorphism (SSCP)
Analysis--
RNA from the HT1080 cells and resistant sublines was
isolated, and first-strand cDNAs were synthesized by reverse
transcriptase-PCR. For DNA-SSCP analysis, TS fragments (150-260 bp)
were obtained by PCR amplification using the cDNAs as the template
and 6 pairs of TS-specific primers (the sequences of oligonucleotide
primers used in various experiments such as PCR amplification,
DNA-SSCP, and sequence analysis are described in Table
I). The reaction mixture containing 1 µCi of [
DNA Sequence Analysis for Mutant Detection--
The reverse
transcriptase-PCR fragments exhibiting abnormal mobility on SSCP gels
were subsequently subcloned into pCR-ScriptTM SK(+) vector,
which permits the efficient cloning of PCR fragments with a high yield
and sequencing by two commercially designed primers (M3 ( Southern, Northern, and Western Blot Analysis--
The human TS
probe, which was 32P-labeled by random primer DNA labeling
kit (Boehringer Mannheim), was a 950-bp gel-purified fragment of human
TS cDNA cleaved from the pET-17×b(hTS) plasmid with
NdeI and HindIII restriction enzymes (15). As a
loading control, a Site-directed Mutagenesis-- The vector pcDNA3 under T7 promoter control was used to obtain a mammalian expression system for human TS. The construction of the plasmid containing recombinant human TS cDNA was performed by digestion of pET-17×b(hTS) with NdeI and HindIII to generate a 950-bp fragment containing a full cDNA sequence of human TS. After treatment with T4 DNA polymerase to create blunt ends, the 950-bp DNA fragment was ligated to the unique EcoRV site of pcDNA3 vector to produce the pcDNA3-hTS plasmid. The correct size (6.4 kilobase pairs) and orientation was confirmed by restriction mapping and sequencing. The TransformerTM site-directed mutagenesis kit was used to obtain point mutations in human TS. The mutagenic and selective primers used for site-directed mutagenesis experiments are described in Table II. A selection primer that contains a unique KspI restriction site instead of the unique SmaI restriction site on the pcDNA3 vector is shown last, and the other 8 primers were designed to generate mutants of the human TS gene at the targeted site with 1 to 3 nucleotide changes. Mutant human TS cDNA was obtained by annealing one mutagenic primer and one selection primer to the single strand pcDNA3-hTS plasmid. The experimental procedures followed the manufacturer's instructions. The resulting colonies were initially screened using KspI digestion that only cuts newly synthesized plasmids. Plasmids with correct point mutations in human TS were examined further by restriction mapping and DNA sequencing.
Transfection of Mouse TS-negative Cells with Wild-type and Mutant Human TS cDNAs-- The mouse TS-negative FSthy21 cells were used as host for DNA transfections that were performed using a DOTAP transfection kit (Boehringer Mannheim). Three days after transfection, cells were placed in selective media, which lacked thymidine and reduced folate. Surviving cells having the ability to grow in the absence of thymidine were cloned in soft agarose. Growth Inhibition Assay for Transfected Cells-- Cloned logarithmically growing suspension mouse TS-negative FSthy21 cells transfected with either wild-type or variant human TS cDNA were seeded in 96-well plates at 2,000 cells/well in 180 µl of complete medium. Two hours later, drug (Tomudex, Thymitaq, BW1843U89, or FdUrd) was added, and the cells were grown in drug-containing medium for an additional 7 days. Cell viability was measured by the Alamar BlueTM assay. To the above 96-well cultured cells, 25 µl of Alamar Blue (10% of incubation volume) was added according to the manufacturer's instructions. The 96-well plates were then incubated at 37 °C for 4 h. Viable cells induce chemical reduction of the media which results in a change in color from blue to red. The intensity of red color (and fluorescence) is proportional to the number of viable cells. After incubation, fluorescence was read at 530-560 nm excitation wavelength and 590 nm emission wavelength by an automated plate reader (model EL340; Bio-Tek). Drug concentrations needed to reduce cell growth by 50% (IC50 values) were determined graphically by plotting cell growth versus inhibitor concentrations. TS Protein Expression Vector Construction and Purification-- Human TS variants (G52S and D49G) selected for enzyme kinetic characterization were recloned into the protein expression vector pET-17×b. DNA fragments carrying the entire mutant human TS cDNA were amplified using the corresponding pcDNA3-hTS vector as the template and two primers designed to contain appropriate restriction site for cloning. The 5'-primer (5' GGAATTCTGCAGCATATGCTTGTTGC 3') contains a created NdeI restriction site, and the 3'-primer (5' CTAGATGCATGCTCGAGCGGCCGCC 3') has an XhoI site. After PCR amplification, the reaction mixture was digested with NdeI and XhoI enzymes, and the restricted DNA fragment (950 bp) was inserted into the corresponding sites of pET-17b vector. The correct construction of mutant pET-17b(hTS) was verified by restriction mapping and sequence analysis. The protein expression pET-17×b(hTS) plasmid (wild-type or mutant TS) was used to transform E. coli strain BL21(DE3). Bacterial cells were grown at 30 °C in 1 liter of tryptone phosphate medium (2% bacto-tryptone, 1.5% yeast extract, 0.2% sodium phosphate (dibasic), 0.1% potassium phosphate (monobasic), 0.8% sodium chloride, and 0.2% glucose) supplemented with 100 µg/ml ampicillin (18). The wild-type and the two mutant TSs were induced with 1 mM isopropyl- -thiogalactose for 5 h at which point
the enzyme was induced to about 10-15% of the soluble protein. The
purification procedures were basically carried out as described by
Ciesla et al. (19) for rat TS purification, which included
streptomycin treatment of crude extract, followed by ammonium sulfate
precipitation, ion-exchange cellulose DE-52, and phenyl-Sepharose CL-4B
chromatography. A minor modification was made by eluting TS protein
from a phenyl-Sepharose CL-4B column with a decreasing linear gradient
of ammonium sulfate from 0.8 mM to 0 instead of 0.8 to 0.4 mM. Finally, TS fractions were precipitated with solid
ammonium sulfate and stored at 80 °C until use. TS purity was
demonstrated by 12% SDS-PAGE.
TS Characterization--
TS activity was monitored
spectrophotometrically at 340 nm as described previously (20, 21). The
assay mixture contained 50 mM Tris·HCl, pH 7.4, 25 mM MgCl2, 6.5 mM formaldehyde, 1 mM EDTA, 75 mM 1) values were obtained by
dividing Vmax (µmol/min/mg protein) by the
estimated concentration of enzyme (µmol) used in the reaction.
Inhibition constants (Ki) were determined from the
steady-state inhibition reaction rates for mixtures of enzyme, dUMP,
CH2H4folate, and inhibitor. A high fixed
CH2H4folate concentration (600-800
µM) and variable antifolate concentrations were used to
measure the inhibition produced by Tomudex, Thymitaq, and BW1843U89. A
constant dUMP concentration (500 µM) was used, and FdUMP
concentrations were varied to measure inhibition by FdUMP.
Random Mutagenesis-- Based on EMS and Thymitaq cytotoxicity assays, a concentration of 400 µg/ml EMS that resulted in 80% inhibition of colony formation and 40 µM Thymitaq, approximately 20-fold higher than IC50 value for this compound, were chosen for selection of resistant clones. Following EMS exposure and Thymitaq selection, a relatively large number of resistant clones (41 per 4 × 108 cells) were generated in comparison with no EMS pretreatment but selected in Thymitaq (1 per 108 cells), indicating that EMS increased the frequency of surviving Thymitaq-resistant clones by approximately 10-fold. All 41 of these clones from EMS and Thymitaq treatment and 1 clone from a control experiment without EMS were expanded to establish stable Thymitaq-resistant cell lines, which were grown in the presence of 40 µM Thymitaq. DNA-SSCP Analysis-- To detect putative point mutations leading to drug resistance, all 41 EMS-exposed Thymitaq-resistant cell lines and one control-resistant cell line (HT1080-A, without EMS treatment) were investigated by SSCP analysis. After total RNA isolation and reverse transcription, fragments that include most of the entire coding sequence of human TS gene except nucleotides 1-69 and 915-939 were amplified by 6 pairs of primers. DNA-SSCP screening demonstrated that shifted bands in addition to normal migrating bands were observed on SSCP gels for nine EMS-exposed Thymitaq-resistant cell lines (HT1080-1b, -2b, -1c, -2c, -1d, -2d, -1e, -2e, and -6e), indicating the possible presence of mutations in these fragments (Fig. 2).
The Expressed Levels of Human TS in Resistant Cells-- Western blotting revealed that some resistant sublines (HT1080-A, -1b, -2b, -2c, -2d, -2e, and -6e) demonstrated elevation of protein levels, and modest increases in TS genomic DNA were also seen in these sublines by Southern blotting. The corresponding mRNA levels were observed to increase in only HT1080-2c, -2d, and -2e sublines as determined by Northern blotting, using ribosomal phosphoprotein 36B4 mRNA as controls. In contrast, some sublines (HT1080-1c, -1d, and -1e) did not amplify the TS gene and nor did they overexpress TS mRNA and protein (Fig. 3).
Mutations Identified by Sequencing Analysis-- The fragments produced by PCR amplifications with abnormal migration on SSCP gels were cloned into pCR-Script vector for sequencing. More than 20 mutations including some silent mutations in the 9 Thymitaq-resistant cell lines were identified, which are Q214R, A228T, and K266I mutations from HT1080-1b; I40T and D49N from HT1080-2b; T51A from HT1080-1d; R25H and F59L from HT1080-2d; G52S from HT1080-1e; D49G, D130G, and T234M from HT1080-2e; and K47E, R50C, Y65C, V79M, and V84A from HT1080-6e (the G52S mutation as an example is shown in Fig. 4). The results combining Western and SSCP analyses indicated that human TS protein overexpression and mutations in the TS coding region were both present in the same cell lines. No mutations were detected in the untreated HT1080 cell line or in the HT1080-A line that was obtained by Thymitaq selection without EMS exposure.
Construction of Mutations in Human TS by Site-directed Mutagenesis-- To determine whether only single point mutations result in changes in Thymitaq binding to TS, we expressed mutant TS genes with only single point mutations. The human TS expression vector pcDNA3-hTS, which contains the entire coding sequence of the human TS gene with minor modifications of the N-terminal nucleotide codon, was utilized for these studies (15). Eight TS mutants, including K47E, D49N, D49G, R50C, T51A, G52S, F59L, and Q214R detected in the resistant subline analysis, were generated by site-directed mutagenesis using pcDNA3-hTS as a template. These mutations were selected from the 20 or more mutations found, based on their occurrence in highly conserved regions of this enzyme (Table III). Sequencing the coding regions demonstrated that the expected substitution had been introduced and that no other alteration had occurred (data not shown).
Rescue of TS-negative Cells by Transfection of Various Human TS cDNAs-- Transfection of the eight human TS variants as generated above into TS-negative mouse cells was used to demonstrate whether or not the altered TS protein had sufficient catalytic activity to permit normal growth in the absence of thymidine. Mouse TS-negative cells (FSthy21) were transfected with a plasmid (pcDNA3-hTS) encoding wild-type or each of the mutant human TS enzymes by standard DOTAP transfection procedures. The results of these experiments showed that three TS variants (K47E, D49G, and G52S) as well as wild-type TS were able to complement growth of TS-negative cells in selective medium lacking thymidine. In contrast, cells transfected with the other five human TS variants (D49N, R50C, T51A, F59L, and Q214R) did not survive (data not shown). For each surviving transfectant, at least 12 individual clones were isolated. Those clones were then expanded to cell lines by growth in normal media. Growth Sensitivity to Antifolates and FdUrd-- Before determining growth sensitivity to Tomudex, Thymitaq, BW1843U89, and FdUrd, the levels of human TS protein for the transfectants were measured by Western blot analyses. For each of the human TS wild-type or variants, three cell clones were randomly selected. The three mutant clones (K47E-2, D49G-1, and G52S-3) expressed levels of TS protein similar to that of a control clone (wt-1) transfected with the wild-type vector (data not shown). These four clones were chosen for determination of cytotoxicity of drugs as described below. The effect of the three antifolates and FdUrd on the growth of transfectants that stably express various TS proteins was evaluated by cytotoxicity studies. Cell growth was measured by the Alamar Blue assay. The IC50 values of Tomudex, Thymitaq, BW1843U89, and FdUrd are presented in Table IV. D49G and G52S transfectants conferred resistance to Thymitaq (40- and 12-fold, respectively) and to FdUrd (26- and 97-fold, respectively) as compared with the wild type transfected cell line. In contrast, no marked changes were observed for Tomudex and BW1843U89 cytotoxicity compared with the wild type transfected cell line.
Subcloning and Expression of Human TS in E. coli--
Based on the
drug sensitivity results presented above, TS mutants D49G and G52S were
selected for enzyme kinetic studies. The D49G and G52S human TS
cDNA were inserted into protein expression vectors pET-17×b. The
pET system provided high yields of soluble protein in a derivative of
the E. coli strain BL21(DE3). The activity of the enzyme was
monitored and found to be highest 5 h after the addition of
isopropyl- Purification of Mutant TS Proteins-- A procedure previously used to purify rat TS, using sequential ion-exchange/phenyl-Sepharose chromatography, was adopted for purification of wild-type and mutant human TS proteins (19), modified in that the human TS was eluted from phenyl-Sepharose using a linear gradient of ammonium sulfate of 0.8 M to 0 instead of 0.8 to 0.4 M employed for rat proteins, which is similar to that described in a recently published paper (15). After purification, a single major component on SDS-PAGE gel migrating with an apparent molecular weight of human TS protein was observed for the wild-type and mutant enzymes. Purity was estimated to be greater than 80% as determined by densitometric scanning. Kinetic Properties of Mutant Enzymes-- To obtain information about the catalytic and ligand-binding properties of these TS variants, the kinetic parameters Vmax and Km values for substrate and cofactor and Ki values for inhibitors were evaluated. The Km values for CH2H4folate and dUMP were not significantly different between the wild-type and G52S mutant forms, whereas the catalytic efficiency (kcat) of G52S was even higher than the kcat of wild-type TS (Table V). The Km for dUMP and CH2H4folate of the D49G variant was increased 3-fold over wild-type TS, and D49G mutants showed diminished catalytic activity with kcat values 3-fold lower than wild-type TS.
Strategies-- As expected, random mutagenesis by exposure of human sarcoma HT1080 cells to an alkylating agent (EMS) and selection with Thymitaq resulted in the generation of a large number of resistant colonies, as compared with Thymitaq selection without EMS pretreatment. Thymitaq was employed as a selective drug in as much as Thymitaq is not a substrate for folylpolyglutamate synthetase and enters cells by passive diffusion, thus eliminating resistance mechanisms such as an altered reduced folate transporter and a decrease in folylpolyglutamate synthetase activity. Therefore, the expected major causes of resistance in the Thymitaq-resistant clones are overexpression and/or an alteration of the target human TS enzyme. The advantage of this approach is that mutations caused by EMS could occur anywhere in the entire TS gene and may not be limited to specific regions of the gene as in cassette or site-directed mutagenesis. However, as it is almost impossible to obtain more than one mutation in a nucleotide codon by random mutagenesis, some desirable amino acid substitutions are excluded by this approach. Human TS Mutants Identified in EMS-exposed Cells-- The presence of point mutations in EMS-exposed Thymitaq-resistant cells was determined by SSCP analysis using 6 pairs of primers to span the cDNA for TS; each amplified fragment was 150-260 bp, providing an 80-90% range of sensitivity (24). By screening most of the entire coding sequence of human TS gene from Thymitaq-resistant HT1080 sublines, shifted bands in addition to normal migrating bands were observed on SSCP gels, indicating the presence of wild-type and mutant TS genes in the sample. Previous studies demonstrated that polymorphisms could be detected when mutant DNA comprised as little as 3% of the total gene copies in a PCR mixture (25). However, SSCP cannot discriminate between pre-existing mutations and those mutations introduced by Taq polymerase errors during early-stage amplification. TS fragments showing abnormal migration on SSCP gels were sequenced, and more than 20 mutations of human TS were identified in nine Thymitaq-resistant sublines, indicating that some cell lines contain more than one mutation in TS. This phenomenon was observed in other EMS-treated cell lines (17). We assumed that some or most of those mutations were generated by EMS exposure, based on following evidence: 1) none of the mutations were detected in parent HT1080 and EMS-untreated HT1080-A cells; and 2) most amino acid substitutions were found in highly conserved positions (Table III), suggesting that these variants likely led to drug resistance. We chose eight mutations from 20 or more found for further investigation. Based on knowledge of the crystal structure of the enzyme, F59L and Q214R mutations were chosen since these amino acids are important for ligand binding and structural stability. Additionally, six other mutations (K47E, D49N, D49G, R50C, T51A, and G52S) located in the Arg50 loop were chosen, as this loop becomes more ordered by movement and reorientation upon ligand binding (26). These eight TS mutants were expressed in mouse TS-negative cells to examine directly the ability of these mutations to allow growth in the absence of thymidine and confer resistance to Thymitaq. Three of these cDNAs allowed growth in the absence of thymidine, and cytotoxicity studies showed that D49G and G52S TS variants displayed resistance to the selective drug Thymitaq, providing additional proof that these mutations were involved in the Thymitaq-resistant phenotype.The Arg50 Loop and Drug Resistance--
Of interest,
of the 20 point mutations identified from random mutagenesis, six
occurred in the highly conserved Arg50 loop (amino acids
47-52). This loop connects elements of protein secondary structure, an
Kinetic Studies of D49G and G52S Human TS Mutants--
The kinetic
characterization studies of the highly purified altered enzymes
obtained from an E. coli expression system are consistent
with the cell growth inhibition results. The product of
Ki·kcat/Km
has been suggested as a comparative index to represent both catalytic
efficiency and drug inhibition (32). The values of
Ki·kcat/Km
for wild type and G52S via FdUMP are 0.34 and 8.3 (s Future Applications in Gene Therapy-- Treatment with intense dosages of chemotherapeutic agents, including fluorodeoxyuridine and antifolates, may increase the curability of sensitive tumors (33). However, this approach is often limited due to myelosuppression. To overcome bone marrow toxicity from chemotherapy, transfer of drug resistance genes into hematopoietic progenitors is a promising approach. Introduction of drug resistance genes such as mutant dihydrofolate reductase, the multiple drug resistance gene (MDR-1), glutathione transferase, alkyl transferase, cytidine deaminase, and aldehyde dehydrogenase into murine hematopoietic cells has been shown to improve chemotherapy tolerance in vitro and in vivo (34-38). The newly identified human TS mutants (D49G and G52S), because of their desirable properties that include catalytic function (kcat) and resistance to FdUrd and Thymitaq, are excellent candidates for gene transfer studies. Preliminary transfection experiments of mutant human TS cDNA retroviral constructs have demonstrated that the G52S mutant functions in a dominant manner to protect murine bone marrow cells from FdUrd toxicity as compared with wild-type TS.2
We thank Dr. Frank Maley for the human TS cDNA and anti-hTS antibody as well as for invaluable advice. We acknowledge the technical assistance of Dr. Saori Nakahara and Wen Chen.
* This work was supported by USPHS Grant CA08010 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ American Cancer Society Professor. To whom correspondence should be addressed: Memorial Sloan-Kettering Cancer Center, 1275 York Ave., Box 78, New York, NY 10021. Tel.: 212-639-8230; Fax: 212-639-2767.
1 The abbreviations used are: TS, thymidylate synthase; bp, base pair(s); CH2H4folate, 5,10-methylene-5,6,7,8-tetrahydrofolate; EMS, ethyl methanesulfonate; SSCP, single-stranded conformation polymorphism; DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate; h. human; FdUrd, fluorodeoxyuridine; FdUMP, 5-fluoro-2-deoxyuridylate; Tomudex or ZD1694, N-(5-[N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-ylmethyl)-N-methylamino]2-thenol)-L-glutamic acid; Thymitaq or AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)-quinazoline dihydrochloride; BW1843U89, (S)-2-(5-(((1,2-dihydro-3-methyl-1-oxobenzo[f]quinazolin-9-yl)methyl)amino)-1-oxo-2-isoindolinyl)glutaric acid; PCR, polymerase chain reaction.
2 Y. Tong, X. Liu-Chen, E. A. Ercikan-Abali, G. M. Capiaux, S.-C. Zhao, D. Banerjee, and J. R. Bertino, unpublished results.
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||