![]()
|
|
||||||||
,From the Department of Microbiology and Molecular Genetics and the Markey Center for Molecular Genetics, University of Vermont, Burlington, Vermont 05405
| |
ABSTRACT |
|---|
|
|
|---|
The Saccharomyces cerevisiae Cdc42p
GTPase is localized to the plasma membrane and involved in signal
transduction mechanisms controlling cell polarity. The mechanisms of
action of the dominant negative cdc42D118A
mutant and the lethal, gain of function
cdc42G12V mutant were examined.
Cdc42D118A,C188Sp and its guanine-nucleotide exchange
factor Cdc24p displayed a temperature-dependent interaction
in the two-hybrid system, which correlated with the temperature
dependence of the cdc42D118A phenotype and
supported a Cdc24p sequestration model for the mechanism of
cdc42D118A action. Five cdc42
mutations were isolated that led to decreased interactions with Cdc24p.
The isolation of one mutation (V44A) correlated with the observations
that the T35A effector domain mutation could interfere with
Cdc42D118A,C188Sp-Cdc24p interactions and could suppress
the cdc42D118A mutation, suggesting that Cdc24p
may interact with Cdc42p through its effector domain. The
cdc42G12V mutant phenotypes were suppressed by
the intragenic T35A and K183-187Q mutations and in skm1
and cla4
cells but not ste20
cells,
suggesting that the mechanism of cdc42G12V
action is through the Skm1p and Cla4p protein kinases at the plasma membrane. Two intragenic suppressors of
cdc42G12V were also identified that displayed a
dominant negative phenotype at 16 °C, which was not suppressed by
overexpression of Cdc24p, suggesting an alternate mechanism of action
for these dominant negative mutations.
| |
INTRODUCTION |
|---|
|
|
|---|
The establishment of cell polarity is crucial for the control of many cellular and developmental processes, such as the generation of cell shape, the intracellular movement of organelles, and the secretion and deposition of new cell surface constituents (1). Polarized growth in the yeast Saccharomyces cerevisiae occurs in response to both internal and external signals, resulting in different morphological structures (2-5). The mechanics of cell polarity initiation during the mitotic cell cycle can be divided into three sequential phases: (i) nonrandom bud site selection; (ii) organization of proteins at the bud site; and (iii) bud emergence and polarized growth. Genetic and biochemical studies have identified over 25 proteins, including several GTPases and components of the actin cytoskeleton, that are involved in the regulation of the cell polarity pathway in S. cerevisiae (1, 6, 7).
At least six members of the Ras superfamily of GTPases (Rsr1p/Bud1p,
Cdc42p, Rho1p, Rho2p, Rho3p, and Rho4p) are involved in controlling
cell polarity in S. cerevisiae. These proteins are active
when in the GTP-bound state and inactive in the GDP-bound state
(8, 9). The activity of these GTPases is controlled by regulatory
proteins, such as guanine-nucleotide exchange factors, GTPase-activating proteins, and guanine-nucleotide dissociation inhibitors, as well as by the intracellular localization of the GTPase.
Rsr1p/Bud1p is a member of the Ras subfamily and is responsible for bud
site selection at one of the two cell poles, but it is not required for
bud emergence or polarized cell growth (10-12). Cdc42p is a member of
the Rho/Rac subfamily and is involved in bud site selection, bud
emergence, polarized growth, and cytokinesis (13-16). The Rho proteins
have been implicated in bud formation, actin reorganization, polarized
growth, and activation of
-glucan synthesis (17-23).
Highly conserved (80-85% identical) functional homologs of S. cerevisiae Cdc42p have been characterized in Schizosaccharomyces pombe (24, 25), Caenorhabditis elegans (26), Drosophila melanogaster (27), and Homo sapiens (28, 29), suggesting that Cdc42p may have conserved functions in these other eukaryotes. Analyses of the morphological phenotypes of dominant lethal S. cerevisiae cdc42 alleles indicated that Cdc42p functions in bud emergence and the subsequent polarized cell growth and cytokinesis (16). These data included the observation that the cdc42G12V mutation resulted in dominant lethality and large, multibudded cells, suggesting that the mutant protein was activated (GTP-bound) and constitutively interacting with downstream effectors of the pathway. These effectors may include Cla4p, Ste20p, and/or Skm1p, three S. cerevisiae members of the Pak family of protein kinases that interact with GTP-bound Cdc42p (25, 30-34). In contrast, the cdc42D118A mutant exhibited a temperature-dependent, dominant negative phenotype, suggesting that Cdc42D118Ap was inactive (GDP-bound) but could bind and sequester a cellular factor necessary for the budding process (16, 35). A candidate for this cellular factor was Cdc24p due to its ability to multicopy-suppress the cdc42D118A mutation and because a cdc24ts cdc42ts double mutant displayed synthetic lethality (35). In addition, Cdc24p showed limited amino acid sequence similarity with the Dbl proto-oncoprotein, which acts as a guanine-nucleotide exchange factor for human Cdc42p (36), and biochemical evidence indicated that Cdc24p catalyzes guanine-nucleotide exchange on Cdc42p in vitro (37).
In localization studies, S. cerevisiae Cdc42p was found to
be targeted to the plasma membrane in the vicinity of secretory vesicles that are found at the site of bud emergence, to the tips and
sides of enlarging buds, and to the tips of mating projections in
-factor arrested cells (38). Cdc42p contains the C-terminal Lys183-Lys-Ser-Lys-Lys-Cys-Thr-Ile-Leu sequence that is
modified by geranylgeranylation at the Cys residue, which is necessary
for its anchoring within the plasma membrane (38, 39). This prenylation is deemed necessary because the cdc42C188S
mutation resulted in a nonfunctional protein that fractionated almost
exclusively into soluble pools (16, 38) and because the
cdc42C188S mutation can suppress the
cdc42G12V, cdc42Q61L, and
cdc42D118A lethal mutations (16). However,
whether geranylgeranylation is necessary and sufficient for Cdc42p
targeting to the sites of polarized growth is unknown. The polybasic
domain of four lysine residues that is next to the prenylated Cys
residue is another possible localization determinant. Similar domains
in the K-Ras protein are important for membrane targeting; altering
these Lys residues to Gln results in delocalized K-Ras proteins (40,
41).
To determine the mechanisms of action of the cdc42D118A and cdc42G12V mutations, the interactions between Cdc42D118Ap and Cdc24p were examined in the yeast two-hybrid protein system, and extragenic and intragenic suppressors of the cdc42G12V allele were characterized. The data support the hypothesis that the cdc42D118A dominant negative phenotype is due to sequestration of Cdc24p away from endogenous Cdc42p and suggest that the nature of the cdc42G12V growth and morphological phenotypes is due to improper interactions with the Skm1p and Cla4p protein kinases at the plasma membrane. Two Cdc42 effector domain mutations were also identified that either suppressed the cdc42D118A phenotype or disrupted Cdc42D118Ap-Cdc24p two-hybrid interactions, suggesting that Cdc24p may interact with Cdc42p through its effector domain.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Reagents, Media, and Strains--
Enzymes, dideoxy sequencing,
and polymerase chain reaction kits and other reagents were obtained
from standard commercial sources and used as specified by the
suppliers. [
-32P]dCTP was obtained from NEN Life
Science Products. 5-Fluoroorotic acid was obtained from American
Biorganics, Inc. (Niagara Falls, NY). Oligonucleotide primers used in
PCR1 reactions and
site-specific mutagenesis were obtained from Bio-Synthesis, Inc.
(Lewisville, TX). Protein determinations were performed using the
Bio-Rad protein assay kit using bovine serum albumin as the standard,
and immunoblots were developed using either the Enhanced Chemiluminescence (ECL) system (Amersham Corp.) or Renaissance system
(NEN Life Science Products). Horseradish peroxidase-conjugated goat
anti-rabbit IgG, protease inhibitors (phenylmethylsulfonyl fluoride,
N-tosyl-L-phenylalanine chloromethyl ketone,
aprotinin, leupeptin, and pepstatin), and glass beads (425-600 µm)
were obtained from Sigma. Cdc42p-specific antibodies were isolated and
purified as described previously (16).
|
Plasmids and DNA Manipulations-- Standard procedures were used for recombinant DNA manipulations (42) and plasmid isolation from Escherichia coli (45). Sequencing was either by the dideoxy chain termination method (46) with the U.S. Biochemical Corp. Sequenase sequencing kit or through automated sequencing at the Vermont Cancer Center DNA Sequencing Facility. Site-directed mutagenesis was performed with the MUTAGENE kit (Bio-Rad). Plasmids pBM272 (47), pRS306 and pRS315 (48), pRS425 (49), pJJ215 (50), pPGK (51), pAS1-CYH2 (52), pGAD2F (53), pRS315(CDC24-B) (35), and YEp351(CDC42), pGAL-CDC42, pRS315(CDC42), pRS315(cdc42G12V), pRS315(cdc42D118A), pRS315(cdc42D118A,C188S), pGAL-cdc42G12V, and pGAL-cdc42D118A (16) have been previously described. Plasmid pRS315(GAL1/10) was constructed by blunt-ending the 685-base pair EcoRI-HindIII fragment from pBM272 containing the divergent GAL1/10 promoters with the Klenow fragment of DNA polymerase I and inserting it into the unique SmaI site of pRS315. Plasmid pPGK2 was constructed by inserting the PGK promoter from plasmid pPGK on a XhoI plus SalI fragment into the unique SalI site of a derivative of pRS425, which had the BamHI to HindIII fragment from its multiple cloning site removed.2 Plasmid pPGK2E, which has the unique EagI site of pPGK2 removed, was constructed by cleaving pPGK2 with EagI, blunt-ending with S1 nuclease, and religating with T4 DNA ligase. Plasmids pPGK2-CDC42 and pPGK2E-CDC42 were constructed by inserting a PCR-generated CDC42 gene contained on a BamHI plus HindIII fragment into either pPGK2 or pPGK2E that had been digested with BamHI plus HindIII. pGAD2F-CDC24 was constructed by inserting the ~4-kilobase pair BamHI plus HindIII fragment from pRS315(CDC24-B), which was blunt-ended with the Klenow fragment of DNA polymerase, into pGAD2F that had been digested with BamHI and blunt-ended with the Klenow fragment of DNA polymerase.
SKM1 (Ref. 32; GenBankTM accession number X69322) was isolated from W303-1A genomic DNA by PCR using the 5
-primer
TCCCCCGGGCATATGAAGGGCGTAAAAAAG (underlined sequence is a NdeI site and contains the
SKM1 start codon; double underlined sequence is a
SmaI site) and the 3
-primer GCTCTAGACTCGAGACATAACGCGAAGCAAACG
(underlined sequence is a XhoI site; double underlined
sequence is a XbaI site; nonunderlined sequence is the
reverse complement of +144 to +163 downstream of the SKM1
stop codon). The resulting 2547-base pair PCR fragment was digested
with SmaI plus XbaI and inserted into
SmaI plus XbaI-digested pTZ18U (54). To generate
a skm1::HIS3 disruption, the
SmaI-XhoI fragment containing HIS3
from plasmid pJJ215 was blunt-ended with Klenow fragment and inserted
into the blunt-ended unique StuI site at +241 of the
SKM1 coding region in pTZ18U(SKM1). The resulting plasmid was digested with SmaI plus XbaI,
releasing a 3.86-kilobase pair skm1::HIS3 fragment
that was used to transform the diploid strain HD2 to His+.
Sporulation and tetrad analysis of stable His+
transformants yielded His+ haploid cells in which the
skm1::HIS3 allele had replaced a wild-type SKM1 allele at its chromosomal location, which was confirmed
by DNA-DNA blot hybridization (data not shown).
PCR and Site-directed Mutagenesis--
The PCR mutagenesis
protocol was based on the Zhou et al. (55) protocol
previously described. Plasmid pRS315(cdc42D118A,
C188S) was amplified under essentially standard reaction
conditions (reaction volume was 200 µl; reaction conditions were 10 mM Tris-HCl, pH 8.8, 50 mM KCl, 50 µM each dNTP, 2 fmol of template, 50 pmol of each primer,
and 5 units of AmpliTaq DNA polymerase; cycle profile (30 cycles total)
was 94 °C for 1 min, 50 °C for 2 min, and 72 °C for 3 min) on
a Perkin-Elmer DNA thermal cycler model 480. The 5
- and 3
-primers
were, respectively,
GAATTCAAGCTTCGTATTAGGTCTTCC (underlined
sequence is an EcoRI site; double underlined sequence is a
HindIII site; nonunderlined sequence is
20 to
6 upstream of the CDC42 start codon), and
CGCGGATCCGGGCATATACTAATATG (underlined sequence is a
BamHI site; nonunderlined sequence is the reverse complement
of +2 to +18 downstream of the CDC42 stop codon). The pool
of PCR fragments was digested with NdeI plus
BamHI (the NdeI site is at the CDC42
start codon) and directionally inserted into NdeI plus
BamHI-digested pAS1-CYH2. The pool of
pAS1-CYH2(cdc42D118A,C188S,X (X is any possible
new mutation) plasmids was amplified in E. coli and
transformed into S. cerevisiae HF7c cells already containing pGAD2F(CDC24). Plasmid
pAS1-CYH2(cdc42D118A,C188S) was obtained using
the same procedure; the entire coding region was sequenced to confirm
the presence of only those two mutations and no other spurious
mutations.
-primer in
the PCR reaction with the same 5
-primer used in the PCR mutagenesis
reactions (see above). Primers were used at a final concentration of
0.1 nM in a final reaction volume of 50 µl. The PCR
cycling parameters were 30 cycles of 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 3 min, followed by a 5-min extension reaction at
72 °C. The resulting PCR product was digested with NdeI
plus BamHI (the NdeI site is at the
CDC42 start codon) and directionally inserted into
NdeI plus BamHI-digested pAS1-CYH2.
Introduction of the K183-187Q mutations into either the wild-type or
cdc42G12V mutant gene was accomplished using a
PCR approach. The nucleotide sequence of the K183-187Q mutagenic
primer was
CGCGGATCCGACTACAAAATTGTACATTGTTGACTTTGCTGGATAACAGG (lysine 183, 184, 186, and 187 to Gln; underlined G bases are T
in the wild-type sequence; the double underlined sequence is a
BamHI restriction site). The mutagenic primer was used as
the 3
-primer in the PCR reaction with the same 5
-primer used in the
PCR mutagenesis reactions (see above). Template for the PCR reaction
was 1 µg of either YEp351(CDC42) to generate the
cdc42K183-187Q quadruple mutant or
pRS315(cdc42G12V) to generate the
cdc42G12V,K183-187Q quintuple mutant. Primers
were used at a final concentration of 0.1 µM in a final
reaction volume of 100 µl, and the PCR cycling parameters were as
described above. The mutant genes were placed under the control of the
PGK promoter by digesting the resulting ~600-base pair PCR
products with HindIII plus BamHI and inserting into HindIII plus BamHI-cleaved pPGK2. For all
mutant genes, the entire coding region for each mutant gene was
sequenced to confirm the presence of the desired mutation(s) and the
absence of any spurious mutations.
Two-hybrid Protein Interactions--
The two-hybrid interaction
methodology has been described (44, 53). The HF7c transformants
containing pGAD2F(CDC24) and pAS1-CYH2(cdc42D118A,C188S) were selected on
SC-Leu-Trp media at 23 °C and then tested at various temperatures.
Colonies were transferred to nitrocellulose paper, permeablized in
liquid nitrogen, and incubated at 30 °C on 3MM Whatman paper
presoaked with 0.3 ml/inch2 Z buffer (56) containing 1 mg/ml 5-bromo-4-chloro-3-indolyl-
-D-galactoside (X-gal).
Plasmid DNA from selected colonies containing
pAS1-CYH2(cdc42D118A,C188S,X) and
pGAD2F(CDC24) was recovered into E. coli SURE
cells. Plasmids displaying the characteristic cdc42
restriction enzyme banding pattern were sequenced and retransformed
into HF7c cells containing pGAD2F(CDC24) for retesting
and liquid assays.
-Galactosidase liquid assays were performed in
triplicate, and specific activities were calculated as described
(56).
Selection of Intragenic Suppressors of the cdc42G12V
Mutant--
A PCR mutagenesis approach was taken to identify
intragenic mutations that suppress the cdc42G12V
dominant lethality. The starting template was
pGAL-cdc42G12V; the 5
- and
3
-primers utilized were the same as used in the PCR mutagenesis of
cdc42D118A,C188S (see above). 30 pmol of each
primer and 2 fmol of template were used in a reaction volume of 100 µl. The PCR cycling parameters were 30 cycles of 94 °C for 15 s, 50 °C for 30 s, and 72 °C for 2 min. The library of PCR
products obtained was extracted with PCI (phenol:chloroform:isoamyl
alcohol, 25:24:1), ethanol-precipitated, and resuspended in 20 µl of
sterile distilled H2O. The resulting library of fragments
was digested with BamHI plus HindIII and ligated
into BamHI plus HindIII-cleaved pPGK2. The
resulting library of pPGK2 plasmids was transformed into E. coli SURE cells by electroporation; ~24,000 ampicillin-resistant
transformants were pooled, and plasmid DNA was extracted and
resuspended in 200 µl of sterile distilled H2O.
::TRP1/CDC42
ura3-52/ura3-52) at the ura3-52 locus by
cutting the pRS306 derivative plasmids with BsmI, which has
a unique site in the URA3 gene, and transforming DJD6-11
with the linearized plasmids, selecting for Ura+
transformants at 23 °C. Stable Ura+ transformants were
subjected to tetrad analysis to follow the ura3-52::cdc42S86P::URA3
or
ura3-52::cdc42S89P::URA3
marked loci. In more than 10 tetrads each, Ura+,
Trp+ haploid cells could not be isolated (data not shown),
indicating that the cdc42S86P and
cdc42S89P mutant genes do not encode functional
Cdc42 proteins.
Cell Fractionation and Immunoblot Analyses-- Cell fractionation experiments were performed as described previously (38). Briefly, cells containing PGK promoter-driven cdc42 mutant genes on plasmids were grown in SC-Leu liquid media to midlog phase at 23 °C. ~1 × 108 cells were collected, washed with water, resuspended in 200 µl of lysis buffer (0.3 M sorbitol, 140 mM NaCl, 50 mM Tris, pH 8.0) with protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride and 1:1000 dilutions of 1 mg/ml stock of aprotinin in water, 1 mg/ml stock of N-tosyl-L-phenylalanine chloromethyl ketone in 95% ethanol, 1 mg/ml stock of leupeptin in water, and 1 mg/ml stock of pepstatin in methanol), and lysed on ice by vortexing with 425-600 µM acid-washed glass beads. Greater than 90% cell lysis was verified by light microscopy. Cells lysates were spun at 500 × g for 4 min at 4 °C; the 500 × g supernatants were then spun at 10,000 × g for 10 min at 4 °C, and the pellets were resuspended in the same volume of lysis buffer. To assess the relative amount of Cdc42p in each fraction, equal volumes of each fraction were loaded onto an SDS-12.5% polyacrylamide gel for immunoblot analysis.
For immunoblots, protein samples were diluted 1:1 in SDS-lysis buffer (57) containing 40%
-mercaptoethanol, heated at 100 °C for 5 min, and separated on an SDS-polyacrylamide gel, and protein was
transferred to nitrocellulose paper (BA-S83, 0.2 µm; Schleicher and
Schuell). Affinity-purified anti-Cdc42p antibody was used at 1:500, and
horseradish peroxidase-conjugated goat anti-rabbit IgG secondary
antibody was used at 1:1000. Antibody-antigen complexes were detected
with the ECL system or Renaissance system.
Photomicroscopy-- Cells were grown to log phase in the appropriate synthetic complete media, collected, sonicated briefly, and examined morphologically. To assess the percentage of dead cells in a population, 2 µl of a 4 mg/ml solution of methylene blue in distilled H2O was added to 100 µl of a sonicated cell suspension. Cells that took up the dye and were deep blue were scored as dead cells. Photomicroscopy using Hoffman modulation optics was performed using an Olympus BH-2 epifluorescence microscope. Photographs were obtained using Kodak TMAX 400 film. Digital images (Fig. 4) were captured using a Dage VE-1000SIT digital camera (Image Processing Solutions, Woburn, MA) and VG-5 video frame grabber card (Scion Corp., Frederick, MD) and analyzed in Adobe Photoshop 4.0 (Adobe Systems, Inc., San Jose, CA) on a PowerTower 180 MacOS computer (PowerComputing, Round Rock, TX).
| |
RESULTS |
|---|
|
|
|---|
Temperature-dependent Interaction between Cdc24p and Cdc42D118A,C188Sp-- The cdc42D118A mutant displays a dominant negative phenotype at 23 °C but not at 30 °C or higher temperatures, and overexpression of Cdc24p can suppress this phenotype (35). These data suggested that the cdc42D118A dominant negative phenotype may be due to the nonfunctional binding of Cdc24p by mutant Cdc42D118Ap such that Cdc24p could not interact with the endogenous wild-type Cdc42p. It also suggested that this interaction could occur at 23 but not 30 °C. To test this hypothesis, the interaction between these proteins in the yeast two-hybrid protein system was examined. In frame fusion proteins between Cdc24p and the GAL4 transcriptional activation domain in plasmid pGAD2F and between Cdc42D118A,C188Sp and the GAL4 DNA binding domain in pAS1-CYH2 were generated. The C188S mutation was incorporated to bypass the normal plasma membrane localization of Cdc42p (16, 38). A two-hybrid protein interaction between Cdc24p and Cdc42D118A,C188Sp was observed at 23 but not 30 or 34 °C (Fig. 1). This interaction correlates with the temperature dependence of the cdc42D118A mutant phenotype and further supports the hypothesis that the dominant negative phenotype was due to binding of Cdc24p by mutant Cdc42D118Ap. Our data are consistent with a model in which Cdc42D118Ap binds Cdc24p within the cell at 23 °C, not allowing the endogenous wild-type Cdc42p to bind, and that interaction is lost at higher temperatures, but we cannot rule out the possibility that our data are the result of a unique behavior of mutant Cdc42D118Ap.
|
Isolation of Mutations in cdc42D118A,C188S That Inhibit Interactions with Cdc24p-- To define the domain(s) of Cdc42p that interact with Cdc24p, PCR-generated mutations that reduced the two-hybrid interactions with Cdc24p, using a blue-to-white colony color change at 23 °C, were introduced into the cdc42D118A,C188S gene in pAS1-CYH2. From nitrocellulose lifts of ~800 colonies, eight colonies of white or pale blue color were chosen for further characterization. The plasmid DNA from these eight colonies was recovered into E. coli, and three plasmids were found to have no CDC42 insert; these colonies were white in the assay, as would be expected. The remaining five plasmids displayed the characteristic cdc42 restriction enzyme banding pattern and contained single point mutations in the cdc42D118A,C188S gene resulting in the following amino acid changes: V44A, S86P, I117S, T138A, and L165S. All of the new mutant proteins showed a reduced interaction with Cdc24p (Table II), and all were equally expressed in S. cerevisiae as shown by immunoblot analysis (data not shown).
|
Effects of the T35A Effector Domain Mutation on the cdc42G12V and cdc42D118A Mutants-- The phenotype of the cdc42G12V allele suggested that the mutant protein constitutively interacted with a downstream effector that activated the cell polarity pathway. Therefore, mutations that disrupt the interaction between Cdc42p and downstream effectors should suppress this mutant phenotype. In addition, these effector domain mutations, when present as the only mutation, should result in a nonfunctional protein and large, round, unbudded cells. In contrast, the dominant negative phenotype of the cdc42D118A allele is due to a nonfunctional interaction with an upstream component of the pathway, Cdc24p (see above), and therefore would not be predicted to be suppressed by effector domain mutations. The T35A effector domain mutation has been shown to interfere with the ability of Cdc42p to interact with the Pak family of protein kinases, which are downstream effectors of Cdc42 function (25, 30, 60, 61).
The T35A mutation can suppress the dominant lethality (Fig. 2A) and morphological abnormalities (Fig. 2B) of the cdc42G12V mutation at 23 °C. Neither the cdc42T35A nor cdc42G12V,T35A mutant gene can complement the cdc42-1ts mutant at 37 °C (Fig. 2A), indicating that these alleles encode nonfunctional proteins, presumably due to their inability to interact with downstream effectors of the pathway. This result is substantiated by the morphological phenotype of large, round unbudded cells seen in these mutant cell cultures at 37 °C (data not shown). Surprisingly, the T35A mutation can also suppress the morphological phenotype (large, round unbudded cells) of the dominant negative cdc42D118A allele (Fig. 2B). Cells expressing the cdc42T35A,D118A double mutant gene for 9 h at 23 °C displayed 44% budded cells (n = 200), with 70% of the budded cells exhibiting abnormal bud shapes and/or multiple buds. Given that the cdc42D118A dominant negative phenotype is due to sequestration of Cdc24p, the suppression of the cdc42D118A phenotype may be due to an altered interaction of Cdc42T35A,D118Ap with Cdc24p. In fact, introduction of the T35A mutation into the Cdc42D118A,C188S protein leads to a loss of interaction with Cdc24p in the two-hybrid protein assay (Table II). The T35A mutation cannot suppress the lethal growth defect associated with the cdc42D118A mutation (Fig. 2A), and neither the single nor double mutant gene could complement the cdc42-1ts mutant at 37 °C. Interestingly, the V44A effector domain mutation (see above) could suppress both the cdc42D118A growth and morphological defects.3 Taken together, these data suggest that the Cdc24p guanine-nucleotide exchange factor interacts with Cdc42p through its effector domain (see "Discussion").
|
Suppression of cdc42G12V by the K183-187Q Mutation-- To examine the role of the C-terminal polylysine region in targeting of Cdc42p to the plasma membrane, the four Lys residues were altered to uncharged Gln residues in either the wild-type or cdc42G12V mutant gene. The intragenic K183-187Q mutation was able to suppress the cdc42G12V lethality, but the quintuple mutant gene was unable to complement the cdc42-1ts mutant (Fig. 3A). This result suggested that this polylysine region plays an important role in the function of Cdc42p. Interestingly, the quadruple K183-187Q mutant gene can complement the cdc42-1ts allele at 37 °C (Fig. 3A), suggesting that some of this mutant protein can be properly localized and, hence, functional.
|
Effects of Pak Kinase Deletions on cdc42G12V
Lethality--
To test the hypothesis that
cdc42G12V lethality was due to an improper
interaction with a downstream effector(s) at the plasma membrane, the
effects of Pak kinase deletions on cdc42G12V
lethality were examined. The pGAL-cdc42G12V
plasmid was transformed into strains that had individual single deletions in either of the three Pak kinases, CLA4,
STE20, or SKM1, as well as the corresponding
double deletion mutants, and growth and morphological phenotypes on
galactose-containing media at 23 °C were assayed (Table
III; Fig.
4). The cdc42G12V
lethality was still observed in the cla4
and
ste20
single deletion mutants as well as the
cla4
skm1
and
ste20
skm1
double deletion mutants, but
cdc42G12V expression was not lethal in the
skm1
mutant (HD2-1-2B), with 68% of the cells appearing
normal in morphology (Table III). In addition,
cdc42G12V expression was still lethal in a
rga1
mutant (data not shown), which has a deletion in one
of the Cdc42p GTPase-activating proteins Rga1p. These results suggested
that cdc42G12V lethality was due, in part, to an
interaction with the Skm1p protein kinase. However, when the
morphological phenotypes of the cla4
cells were examined,
a dramatic change from the typical cdc42G12V
morphological phenotype was observed (Fig. 4; Table III). Instead of
the large, multibudded cell phenotype observed when overexpressing cdc42G12V in wild-type or ste20
cells (Fig. 4), a new phenotype of large, round cells with one or more
small buds (76%) as well as large, round unbudded cells (~10%) was
observed. This cellular morphology was also observed in
skm1
cells but at a lower frequency (26 versus
76%). The large, round unbudded phenotype is similar to the
cdc42 loss of function or dominant negative phenotype;
however, the presence of small buds on the large, round cells suggested that bud emergence had occurred in these cells, but growth was restricted to the mother cell and not directed into an enlarging bud.
Taken together, these data suggest that the mechanism of cdc42G12V action is through interactions with
Skm1p and Cla4p but not Ste20p or Rga1p (see "Discussion").
|
|
Isolation of Temperature-dependent Intragenic Suppressors of cdc42G12V-- A PCR-generated mutant library was screened for intragenic suppressors of the cdc42G12V mutant gene by increased transformation frequency of wild-type W303-1A cells (see "Experimental Procedures"). Based on the above-mentioned suppressor results, three types of mutations were envisioned arising from this screen: (i) mutations that affect the localization of Cdc42p, such as the C188S and K183-187Q mutations, (ii) mutations in the effector domain, such as the T35A mutation, and (iii) loss of function or null mutations as well as true revertants of the G12V mutation. Leu+ transformants were selected at both 30 and 35 °C with the goal of isolating cdc42G12V suppressors that had secondary temperature-dependent phenotypes, thereby eliminating the third type of mutations. A total of 1400 Leu+ transformants were obtained at 30 °C and 856 Leu+ transformants at 35 °C. Of these 2256 transformants, four had secondary temperature-dependent growth phenotypes (data not shown).
The plasmids from these four transformants were purified by passage through E. coli and retransformed into W303-1A. The resulting transformants displayed poor growth at 34, 30, and 23 °C and no growth at 16 °C (data not shown). These transformants were grown at 30 °C and then shifted to 16 °C for 18 h to examine their morphological phenotypes. At the semipermissive temperature of 30 °C, the four mutants showed an increase in unbudded cells over wild type (Table IV, top), and all four showed a further increase in unbudded cells within the population when shifted to 16 °C for 18 h (Table IV, top), suggesting that they were exerting a dominant negative effect over the endogenous wild-type CDC42 allele. There was also an increase in the percentage of dead (i.e. methylene blue-staining) cells in the mutant populations (Table IV, top). In addition, all four mutant genes were lethal in a cdc42-1ts background (i.e. plasmids containing the mutant genes could not be transformed into DJTD2-16A cells), which is a result similar to that seen with plasmids containing the cdc42D118A dominant negative mutant (16).
|
|
background
(see "Experimental Procedures"), further substantiating the theory
that these alleles encode nonfunctional proteins.
For the S86P and S89P mutations, the mechanism of suppression of the
cdc42G12V mutation was not due to loss of
membrane attachment, because both show a particulate fractionation
pattern that was similar to the wild-type Cdc42p fractionation pattern
(Fig. 3B). In addition, the 16 °C dominant negative
phenotype could not be suppressed by overexpression of Cdc24p or by
overexpression of the Cdc42p effector Cla4p (data not shown),
suggesting that the mechanism of action of these alleles is different
from that of the dominant negative
cdc42D118A allele (see above) and not due
to sequestration of the Cla4p downstream effector. Interestingly, the
S86P mutation was also identified in the screen for mutations that
reduced a two-hybrid protein interaction between Cdc24p and
Cdc42D118A,C188Sp at 23 °C (see above; Table II).
Cdc42D118A,C188S,S86Pp does not interact with Cdc24p
in the two-hybrid protein system at 23 °C (Table II) or at 16 °C
(data not shown), indicating a different dominant negative mechanism
for this allele.
| |
DISCUSSION |
|---|
|
|
|---|
In genetic and biochemical experiments with numerous Ras-related proteins, a region between residues 26 and 48 has been identified as being required for interactions with downstream effectors (8, 63, 64). The first indication that this so-called "effector domain" may be an important region of Cdc42p came from a sequence comparison between functional homologs of Cdc42p and other closely related GTPases (14). Functional homologs of Cdc42p from S. pombe, C. elegans, and humans can complement the S. cerevisiae cdc42-1ts mutation and are 80-85% identical to Cdc42p, especially in the highly conserved region between residues 26 and 50 (Fig. 5). The human Rac1 protein is 74% identical to Cdc42p but cannot complement the cdc42-1ts mutation, indicating that it is not a functional homolog. Interestingly, the only region of Rac1p that is significantly different from functional Cdc42p homologs is residues 41-52, the region in Ras-like proteins that interacts with effector proteins. The inability of Rac1p to complement the cdc42-1ts mutant may therefore be due to its inability to interact with a Cdc42-specific effector.
The S. cerevisiae Cdc42 GTPase interacts with several proteins, including the Ste20, Cla4, and Skm1 protein kinases (30, 32, 34, 61) that are predicted to function downstream in the cell polarity pathway. This prediction is based, in part, on the inability of these proteins to interact with the Cdc42T35A effector domain mutant protein. The Thr35 residue lies within the G-2 domain of Ras-related GTPases (8), which is predicted to change conformation upon GTP binding. The results presented herein further define the cdc42T35A mutation as an effector domain mutation, but the ability of the T35A mutation to suppress the dominant negative cdc42D118A morphological phenotypes and to disrupt interactions with Cdc24p suggests that this region of Cdc42p may also interact with the Cdc24p exchange factor. Another mutation (V44A) in the effector domain was identified by its ability to disrupt the interaction between Cdc42D118A,C188Sp and Cdc24p, providing further support for this role of the effector domain, and recently, the T35A mutation in the human Cdc42p was found to disrupt responsiveness to Cdc24p-mediated nucleotide exchange activity (58). Taken together, these data suggest that the so-called "effector domain" plays multiple roles in the interactions of Ras-related GTPases with their regulatory and effector proteins.
The ability of the K183-187Q mutation to suppress the cdc42G12V dominant lethality is due, in part, to the partial delocalization of the mutant protein from the plasma membrane. As opposed to the nonfunctional cdc42C188S mutant gene that cannot complement the cdc42-1ts mutant (16), the ability of the cdc42K183-187Q mutant gene to complement the cdc42-1ts mutant suggests that this mutation has an intermediate effect on Cdc42p function. In addition, these results suggest that the polylysine domain of Cdc42p is necessary but not sufficient for complete plasma membrane localization. This is an important point, because Cdc42p is targeted to a specific location on the plasma membrane at sites of polarized growth (38) as opposed to general plasma membrane localization of Ras proteins. This C-terminal polylysine region is not found in most Ras-like GTPases, and its positive charges may be functioning in interactions with negatively charged components, either protein or phospholipid, at the membrane site. Whether these interactions play a role in the specific targeting of Cdc42p or in enhancing membrane association is unclear at this point. Interestingly, deletion of this region in the mammalian Cdc42p led to loss of interaction with phosphatidylinositol 4,5-bisphosphate-containing vesicles (65); phosphatidylinositol 4,5-bisphosphate has also been shown to enhance nucleotide exchange with Cdc42Hs (65). Further support for the importance of the polybasic region in Cdc42p function comes from the isolation of a new temperature-sensitive cdc42 mutation (K186R) within the polybasic region (15).
The ability of the skm1
and cla4
mutations
to suppress the growth and/or morphological phenotypes of the
cdc42G12V mutation suggest that the
Cdc42G12V mutant protein is exerting its lethal effects
through these two protein kinases but not through the Ste20p protein
kinase. Interpretation of these phenotypes at the protein-protein
interaction level is complicated, however, by the presence of
endogenous wild-type Cdc42p in these cells. For instance, the lethality
of the cdc42G12V mutation could be due either to
a direct effect of Cdc42G12Vp on a cellular process or to
an indirect effect of Cdc42G12Vp on the interactions
between wild-type Cdc42p and another protein in the cell. The reversal
of cdc42G12V lethality in a skm1
mutant can be explained by postulating a role for Skm1p in either
mediating Cdc42G12Vp lethality or in inhibiting the
function of the endogenous wild-type Cdc42p in these cells. Skm1p may
be functioning either through a direct interaction with Cdc42p or
through an indirect interaction with other downstream effectors such as
Cla4p. The mechanism by which cdc42G12V
lethality is restored in cla4
skm1
and
ste20
skm1
double deletion mutants is
unclear at this point, but it could reflect the inability of
Cdc42G12Vp-expressing cells to grow in the presence of only
a single Pak-like kinase; again this could be due to a nonfunctional
interaction between either Cdc42G12Vp or endogenous
wild-type Cdc42p with the remaining Pak-like kinase. It should be noted
that in two-hybrid protein studies, Cdc42G12Vp interacts
comparably with Cla4p and Ste20p (30, 61); two-hybrid interactions
between Cdc42G12Vp and Skm1p have not been reported.
The presence of Cla4p, either as the sole Pak kinase in the cell or in combination with Ste20p and/or Skm1p, does seem necessary for the cdc42G12V-dependent generation of multibudded cells. In addition, the absence of Cla4p, and to a lesser extent Skm1p, shifts the Cdc42G12V mutant phenotype from a multibudded morphology to a large, round cell with one or more small buds, suggesting that Cla4p and Skm1p are not necessary for bud emergence but are necessary for restricting growth to the enlarging bud. This phenotype was reminiscent of the phenotype observed when cdc24-4ts cells were arrested with hydroxyurea and then released into 37 °C (restrictive temperature) media (66), the phenotype that first suggested Cdc24p also functioned later in the cell cycle beyond bud emergence. This phenotype was also reminiscent of Cdc24p overexpression phenotypes (35), of downstream mutants of the polarity pathway such as rho1 mutants or pkc1 mutants (67-69), and of Skm1p overexpression phenotypes (32). These data suggesting a role for Cla4p in restricting growth to the enlarging bud are also consistent with those previously obtained for cla4 mutations in wild-type backgrounds (30).
To identify other domains of Cdc42p that are important for function, intragenic suppressors of the cdc42G12V dominant lethality were isolated. Given the different mechanisms of suppression observed for the T35A and K183-187Q mutations, it was important to assay both the ability of these suppressors to complement the cdc42-1ts mutant and the subcellular fractionation of the mutant proteins to distinguish between loss of function mutations and loss of localization mutations. The C157R mutation lies in a domain implicated in the responsiveness of the human Cdc42p to Cdc24p-mediated nucleotide exchange activity (58) and within the G-5 domain of Ras-related GTPases, which functions in the binding of guanine nucleotides (8). The Cys157 residue is unique to Rho/Rac/Cdc42 proteins in this domain, but we have not pursued the C157R mutation further at this time because it does not exhibit a phenotype on its own. The fractionation patterns of the S86P and S89P mutant proteins, as well as their inability to complement the cdc42-1ts mutant or act as the sole copy of Cdc42p within the cell, suggested that these mutations suppressed the cdc42G12V phenotype by generating a nonfunctional albeit properly localized protein. However, the dominant negative phenotype of these mutant genes at 16 °C suggested that these mutant proteins were able to negatively interact with some component of the pathway, possibly sequestering it away from the endogenous Cdc42p. It is unlikely that the sequestered component was Cla4p or Cdc24p, since overexpression of either was unable to suppress the dominant negative phenotype. In addition, the S86P mutation disrupted the interaction between Cdc42D118A,C188Sp and Cdc24p in a two-hybrid protein assay at both 23 and 16 °C, suggesting that the sequestered component was not Cdc24p. Interestingly, the paradigmatic cdc42T17N dominant negative allele also could not be suppressed by overexpression of Cdc24p.4 Taken together, these data suggest the mechanism of action of these dominant negative alleles is different from that of the cdc42D118A allele.
The S86P and S89P mutations are within a domain of Cdc42p (residues
82-120) and other GTPases in which dominant negative mutations have
been recently isolated (59, 62). In addition, mutations in this domain
lead to diminished responses to Cdc24p-mediated nucleotide exchange
activity (58), suggesting that this domain of Cdc42p plays an important
role in its function. The analogous domain in S. cerevisiae
Ras2p is involved in the interaction between Ras2p and its
GTPase-activating protein, Ira2p (70, 71). This domain in the Ras
crystal structure corresponds to the turn between loop 6 and the
3
helix (72), a region of the protein that is predicted to be in close
proximity to bound nucleotide. Introduction of additional Pro residues
into this region (Fig. 5) could have a profound effect on the
conformation of the protein and/or its ability to bind nucleotide,
thereby leading to loss of interactions with both guanine-nucleotide
exchange factors and GTPase-activating proteins.
Overall, these studies have identified the effector domain of Cdc42p as being important for interactions with both downstream effectors and the upstream guanine-nucleotide exchange factor Cdc24p and have identified two new domains of Cdc42p as being important for function and/or membrane localization. Biochemical interaction and genetic suppressor studies in the future may further define the regions of the effector domain that are necessary for interactions with multiple Cdc42p effectors and regulators and may elucidate the mechanism of Cdc42p targeting to the plasma membrane.
| |
ACKNOWLEDGEMENTS |
|---|
We thank D. Beach, B. Benton, J. Kurjan, P. Miller, M. Snyder, and W. White for strains and reagents; T. Hunter for automated DNA sequencing; and members of the Johnson laboratory for helpful discussions and comments on this manuscript.
| |
FOOTNOTES |
|---|
* This research was supported by National Science Foundation Grant DMB-9405972, a grant from the Lucille P. Markey Charitable Trust, and a UVM-HELiX (Howard Hughes Program for Training in Biology) fellowship (to J. O. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address: Biology Dept., Eastern Nazarene College, 23 E. Elm Ave., Quincy, MA 02170.
§ To whom correspondence should be addressed: Dept. of Microbiology & Molecular Genetics, University of Vermont, 202A Stafford Hall, Burlington, VT 05405. Tel.: 802-656-8203; Fax: 802-656-8749; E-mail: dijohnso{at}zoo.uvm.edu.
1
The abbreviations used are: PCR, polymerase
chain reaction; X-gal,
5-bromo-4-chloro-3-indolyl-
-D-galactoside.
2 P. Miller and D. I. Johnson, unpublished results.
3 T. J. Richman and D. I. Johnson, manuscript in preparation.
4 M. Ziman and D. I. Johnson, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|