JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, S.
Right arrow Articles by Dennis, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, S.
Right arrow Articles by Dennis, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Photoaffinity Labeling by 4-Thiodideoxyuridine Triphosphate of the HIV-1 Reverse Transcriptase Active Site during Synthesis
SEQUENCE OF THE UNIQUE LABELED HEXAPEPTIDE*

Shanhua LinDagger §, William J. Henzel, Sunil NayakDagger par , and Don DennisDagger **

From the Dagger  Department of Chemistry and Biochemistry, University of Delaware, Newark, Delaware 19716 and  Genentech, South San Francisco, California 94080

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The active site of HIV-1 reverse transcriptase (HIV-1 RT) was investigated by photoaffinity labeling based on catalytic competence. A stable ternary elongation complex was assembled containing enzyme, DNA template (RT20), DNA primer molecule (P12), and the necessary dNTPs (one of which was alpha -32P-labeled) needed for primer elongation. The photoaffinity probe 4-thiodideoxyuridine triphosphate was incorporated uniquely at the 3' terminus of the 32P-labeled DNA product. Upon photolysis, the p66 subunit of a HIV-1 RT heterodimer (p66/p51) was uniquely cross-linked to the DNA product and subsequently digested by either trypsin or endoproteinase Lys-C. The labeled HIV-1 RT peptide was separated, purified, and finally subjected to Edman microsequencing. A unique radioactive hexapeptide (V276RQLCK281) was identified and sequenced. Our photoaffinity labeling results were positioned on the HIV-1 RT·DNA·Fab complex x-ray crystallography structure and compared with the suggested aspartic triad active site.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The enzyme reverse transcriptase (RT)1 derived from the HIV-1 virus is a heterodimer composed of two subunits p66 and p51, which are derived from the same sequence.

A variety of experimental techniques have been directed at the elucidation of the active site and the mechanism of catalysis of the RT DNA polymerase activity, to assist in developing a strategy for treating HIV infection. Kinetic studies have established that an ordered sequential assembly of components forms a ternary complex, which then conducts a processive polymerization during the elongation phase (1-7). Genetic substitution experiments have shown that several single amino acid interchanges D110Q, D185H, or D186N in the p66 subunit produce an inactive HIV-1 RT enzyme (8, 9). Studies involving specific amino acid derivatizations have suggested that Lys263 (10) and Arg277 (11) are critically involved at the active site. Photoaffinity labeling studies have yielded additional suggestions for the nucleotide binding site components: Lys73 (12), residues 288-307 (13), and residues 288-423 (14).

Several x-ray structures have been solved for the HIV-1 RT unliganded enzyme (Rogers et al. (15) reported a structure at 3.2 Å and Hsiou et al. (16) at 2.7 Å resolution), and for various ligands complexed with the holoenzyme; Kohlstaedt et al. (17) reported a nevirapine-RT enzyme structure at a resolution of 3.5 Å, and Jacobo-Molina et al.. (18) reported a RT·dsDNA·Fab x-ray structure at a resolution of 3.0 Å. Model building efforts based primarily on the RT·dsDNA·Fab x-ray structure have yielded a detailed mechanistic proposal for the HIV-1 RT enzyme (19). The model is consistent with the critical involvement of the Asp-triad residues and two Mg2+, as originally proposed by Steitz et al. (20).

The results reported in this paper utilized the photoaffinity probe S4-ddUTP to derivatize the active site of HIV-1 RT during productive synthesis involving a ternary complex. The chain terminating probe is located specifically at the 3'-OH end of the nascent product. The hexapeptide VRQLCK of the p66 subunit was the only target peptide that was detected. A general discussion of the possible mechanistic implications of these results is directed at making all the known topologic information compatible.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- Recombinant HIV-1 reverse transcriptase purified from an Escherichia coli clone was kindly supplied by Dr. Christine Debouck and Dr. Jeffrey Culp from SmithKline Beecham Pharmaceuticals. The template and primer were a gift from Dr. Xiaolin Zhang at the Nucleic Acid Facility of the University of Pennsylvania Cancer Center. The sequence of the DNA templates RT19 and RT20 were 3'd-[GCGCGGGGCGCGGTGTGTA]-5' and 3'd-[GCGCGGGGCGCGGTGTTGTA]-5'. The sequence of the DNA primer P12 was 5'd-[CGCGCCCCGCGC]-3'. The nonradioactive deoxynucleotides (dATP, dCTP, and TTP) and Pronase E were purchased from Sigma. Radioactive nucleotide triphosphate [alpha -32P]dCTP (3,000 Ci/mmol), reflection autoradiography film, and reflection intensifying screen were purchased from NEN Life Science Products. The nucleoside 4-thiodideoxyuridine was prepared and kindly provided by Dr. Robert Coleman of Ohio State University. The corresponding triphosphate was prepared from the nucleoside according to the method of Ruth and Cheng (21). Exonuclease III was purchased from Amersham Life Science. Sequencing grade endoproteinase Lys-C was purchased from Promega. Sequencing grade modified trypsin was purchased from Boehringer Mannheim. HinP1I restriction endonuclease was purchased from New England Biolabs. All reagents for gel electrophoresis were purchased from Bio-Rad. Spectra/Por 6 molecular porous dialysis membrane (Mr cut-off = 1,000) was purchased from Spectrum. Mini ProBlottTM membranes was purchased from Applied Biosystems. The high intensity black lamp (model B-100A, long wave UV, which peaks at 365 nm) was purchased from Eastern Corp. Computer program Insight II was purchased from Biosym Technologies.

Photoaffinity Labeling of HIV-1 RT-- The standard reaction mixture (100 µl) for photoaffinity labeling was: 20 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 1.0 µM HIV-1 RT heterodimer (Mr = 117,000), 10 µM DNA template, and 10 µM DNA primer. The nonradioactive substrates dATP, dCTP, and photoprobe (S4-ddUTP) were each added to a final concentration of 100 µM. The radioactive substrate [alpha -32P]dCTP (3,000 Ci/mmol) was added to achieve a specific activity within the range of (1,000~10,000 cpm/pmol). The template primer complex was prepared by heating a solution of 20 µM DNA template and 20 µM DNA primer in the reaction buffer to 100 °C for 3 min. Upon cooling (1 h), the HIV-1 RT was added and the mixture was incubated at 37 °C for 5 min. Immediately upon adding the substrates, the reaction mixture was placed in a depression well of an aluminum foil-covered, temperature-regulated aluminum block. The aluminum block was covered with an inverted Petri dish to prevent extensive evaporation of the reaction mixtures. The UV lower wavelength cut-off of a Pyrex Petri dish is 290 nm. An additional Petri dish, filled with water, was positioned on top of the first one to provide cooling. The lamp was positioned to shine the light from a distance of about 2 cm onto the top of the water-filled Petri dish. The reaction mix was irradiated with UV (365 nm) for 60 min at 37 °C. To minimize the damage from the heat generated by the UV lamp, the water in the top Petri dish was replaced with cool water at 20 and 40 min.

A small aliquot of the photoaffinity labeling reaction mix was removed and analyzed for protein and DNA product. Radioactive labeled and unlabeled HIV-1 RT was analyzed by 10% SDS-PAGE (22). The DNA product of the HIV-1 RT was analyzed by 20% urea-PAGE. In both cases, the radioactive bands were detected by autoradiography. For a quantitative analysis, radioactive bands of interest were excised for Cerenkov counting.

DNA Product Analysis-- The DNA products were separated on the basis of molecular weight using 20% polyacrylamide (acrylamide:bisacrylamide = 19:1) gel electrophoresis containing 7 M urea (dimensions: 170 × 140 × 1.7 mm). The electrophoresis buffer was 0.89 M Tris, 0.89 M boric acid, 20 mM EDTA, pH 8.3. The gel was preelectrophoresed with bromphenol blue and xylene cyanol dye markers in deionized formamide for 1 h prior to loading the samples. Sample mixtures of 15 µl were applied and electrophoresed for 3.5-4 h at 600 V until the xylene cyanol dye marker was about 5 cm from the bottom of the gel. The DNA products were visualized by autoradiography. The radioactive bands were excised and counted in Eppendorf tubes by the Cerenkov method.

Protein Analysis-- For protein labeling analysis, samples from the photoaffinity labeling experiments were mixed with 2 × Laemmli buffer containing the bromphenol blue dye marker (22) at 1:1 (v/v) ratio and boiled at 100 °C for 3 min. The total samples were loaded onto a 10% polyacrylamide (acrylamide:bisacrylamide = 30:0.8) gel containing 0.1% SDS (dimensions: 275 × 140 × 7 mm). The electrophoresis buffer was 25 mM Tris glycine, pH 8.3. The electrophoresis was carried out at 150 V for 1 h and 300 V for another 4.5 h. The radioactive bands were visualized by autoradiography. For quantitative analysis, the radioactive bands were excised and counted in Eppendorf tubes by the Cerenkov method.

Cerenkov Counting Calibration-- The same size gel bands containing variable amounts of 32P radioactivity were excised from a 20% urea-PAGE (or 10% SDS-PAGE) and counted in Eppendorf tubes once. Each band was then transferred to a scintillation vial and minced. The scintillation vial was filled with scintillation fluid and counted in the 32P channel for 5 min. The data from the scintillation counting was plotted versus the data from the Cerenkov counting. The points were fitted with a linear function. The slope is the calibration factor for Cerenkov counting. The calibration factor for gel bands from 20% urea-PAGE is 1.3724. The calibration factor for gel bands from 10% SDS-PAGE is 1.7245.

Proteolytic Digestion of the Labeled HIV-1 RT and Amino Acid Sequencing of the Labeled Proteolysis Product-- The photoaffinity labeling reaction (total volume 10 ml containing 10 nmol of HIV-1 RT and 100 nmol each of DNA template (RT20) and DNA primer (P12)) was performed as described above. After UV irradiation, 1.0 ml of 10 × exonuclease III (ExoIII) digestion buffer was added to the reaction mixture. This reaction mixture was immediately digested by 5,000 units of ExoIII (100 unit/µl) at 37 °C for 30 min (1 unit of ExoIII will catalyze the release of 1.0 nmol of acid-soluble nucleotide in 30 min at 37 °C in 1 × buffer). After the ExoIII digestion, the reaction mixture was precipitated by trichloroacetic acid. A 20-ml glass vial was used as a container, and a stir bar constantly stirred the reaction mixture while the trichloroacetic acid was added. Ice-cold 50% trichloroacetic acid (2.5 ml) was added to the ExoIII reaction mixture to a final 1:4 (v/v) ratio. After the precipitation step, the mixture was distributed repetitively into two Eppendorf tubes and was subjected to centrifugation (13,000 rpm, microcentrifuge at 4 °C for 5 min). The supernatant was removed from the precipitated protein. Multiple centrifugations were required to accumulate the precipitated protein. After centrifugation, the pellet was washed once with cold (-20 °C) 100% acetone and centrifuged at 4 °C for another 5 min. The pellet was air-dried and immediately dissolved into a buffer suitable for proteolytic digestion to form peptides (trypsin or Lys-C).

In the case of trypsin digestion, the pellet was recovered by dissolving it into 100 µl of denaturation buffer 1 (800 mM ammonium bicarbonate, pH 7.9, and 8 M urea). The solution was incubated at 50 °C for 30 min, and then it was diluted 8-fold with H2O. Trypsin was added at a ratio of 1:20 (w/w). The trypsin digestion was incubated at 37 °C overnight. In the case of Lys-C digestion, the pellet was recovered by dissolving it into 100 µl of denaturation buffer 2 (125 mM Tris-HCl, pH 7.7, 5 mM EDTA, and 5 M urea). The solution was incubated at 50 °C for 30 min and then was diluted 5-fold with H2O. The Lys-C (1 µg/µl) was added at a ratio of 1:60 (w/w). The Lys-C digestion was incubated at 37 °C overnight.

To remove small radioactive nucleotides, excess salts, and urea, the peptide digestion solution was dialyzed against H2O at 4 °C overnight, then concentrated to 30 µl by SpeedVac. The molecular weight cut-off of the dialysis membrane was 1,000. The concentrated peptide solution was mixed with buffer (98% formamide, 0.1% bromphenol blue) at a ratio of 1:1 (v/v), and then loaded on to a 20% urea-PAGE. Electrophoresis was conducted at 600 V for 4 h. The radioactive bands in the gel were visualized by autoradiography. A small amount of labeled peptide sample, which was digested with Pronase, was also loaded on to the same 20% urea-PAGE. The Pronase-sensitive radioactive band was the labeled peptide band of interest. This band was excised, quantified by Cerenkov counting, minced in a 1.5-ml Eppendorf tube, and then soaked in 1.0 ml of H2O overnight to elute the labeled peptides. The eluate was separated from the gel by centrifugation. The elution was repeated two more times so that the recovery of labeled peptide reached 90%. The eluates were combined, dialyzed against H2O, and concentrated again by SpeedVac.

The recovered peptide (about 20 pmol) was dissolved into 100 µl of H2O. To purify the peptide adduct, a "gel band shift" procedure was conducted using the endonuclease HinP1I. The DNA template (RT20) was added to the peptide solution at a ratio of 80:1 (template/peptide). The standard reaction buffer was also added to the peptide solution to give a final peptide solution containing 1 × HIV-1 RT reaction buffer. The DNA template and DNA product double helix (total volume was 178 µl) were annealed by boiling the mixture at 100 °C for 3 min and cooling it down gradually (30 min). About 20 µl of 10 × NEBuffer 2 (100 mM Tris-HCl, pH 7.9, 500 mM NaCl, 100 mM MgCl2, and 10 mM dithiothreitol) and 2 µl of HinP1I (5 unit/µl) were added to the mixture. The final volume was 200 µl. HinP1I digestion was performed at 37 °C for 30 min. The reaction mixture was then dialyzed against H2O at 4 °C overnight. The molecular weight cut-off of the dialysis membrane was 1,000. The dialyzed solution was then concentrated to 15 µl by SpeedVac. The sample was analyzed on a 20% urea-PAGE, and the shifted labeled peptide was visualized by autoradiography. The gel was removed from the electrophoresis cell and soaked in the electroblotting buffer for 5 min. The electroblotting buffer was 10 mM CAPS, pH 11, and 20% HPLC-grade methanol. The Mini ProBlottTM membrane was prewetted with methanol for a few seconds and then was placed in a dish containing blotting buffer. The transblotting sandwich was then assembled and electroblotting was conducted at a constant current of 200 mA (50-75 V), at 4 °C for 60 min. The Mini ProBlottTM membrane was removed from the transblotting sandwich and was rinsed with deionized water prior to air drying. The labeled peptide on the Mini ProBlottTM membrane was located by autoradiography. The peptide area was cut out and subjected to Edman microsequencing on a Perkin Elmer 494 automated protein sequencer equipped with a 6-mm microcartridge. Sequence interpretation was performed on a DEC Alpha (23).

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Photoaffinity Labeling of HIV-1 RT with S4-ddUTP-- A previous photoaffinity labeling study employing S4-dUTP as a probe for the active site subunit of HIV-1 RT has been reported by Sheng and Dennis (14). The basic features of that study were repeated using the chain terminator S4-ddUTP, and similar results were obtained in that the labeling of the p66 subunit was light- and photoprobe-dependent and the efficiency of labeling was ~2%. The basic strategy for substituting S4-ddUTP in place of S4-dUTP in the current study was to ensure that no additional nucleotides could be added after the photoprobe was inserted at the 3'-terminal position of the elongated primer. In our previous study (14), the isolation of a small labeled peptide was not achieved and a large 16-kDa (288-423) fragment was isolated and partially sequenced (288-313). In our present study, the isolation and purification of the peptide derived from the Lys-C proteolysis of the labeled p66 subunit enabled us to obtain a single radioactive hexapeptide for sequencing.

Generation of Labeled HIV-1 RT Peptide by Trypsin-- The photoaffinity labeling reaction mixture was treated with the 3' right-arrow 5' DNA specific nuclease ExoIII and precipitated with trichloroacetic acid to remove the majority of radioactive oligonucleotide (and mononucleotides). The radioactive elongated primer containing the photoprobe at the 3' terminus (and covalently linked to the p66 subunit) is resistant to the nuclease since its 3' end is blocked. In Fig. 1, the results of the ExoIII digestion can be seen by comparing lanes 1 and 2 in panel A or B. The radioactive component at the origin is the band of interest, whereas the product (n) and the photodimer containing the template cross-linked to the radioactive elongated primer (T-n) are essentially removed from the trichloroacetic acid precipitate. As seen in lane 3, after treatment with either trypsin (panel A) or Lys-C (panel B), a single radioactive peptide (n-p) from the p66 subunit is produced in addition to the product (n), which persists as a detectable contaminant. The shift of n-p to a lower position is produced upon treatment with Pronase, which cleaves most (but not all) of the peptide from the cross-linked n fragment (lane 4 in A and B). A steric restraint may prevent Pronase from hydrolyzing the peptide bonds close to the derivatization point between the peptide and the 3' end of the oligonucleotide product. Notice that the oligonucleotide product located at n is not altered by Pronase, and therefore does not contain a peptide.


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 1.   Generation of labeled HIV-1 RT peptide by trypsin (panel A) or Lys-C (panel B). The autoradiogram of electrophoretically separated components in a 20% urea-PAGE after specific treatments and purification of the photoaffinity labeling reaction mixture. See procedure for details of the ExoIII digestion, trichloroacetic acid precipitation, trypsin or Lys-C hydrolysis, and Pronase digestion.

The efficiency of labeling was calculated to be 2%, by measuring the total combined radioactivity of the p66 subunit isolated as p1 and p2 bands on a 10% SDS-PAGE (14) and assuming that all of the HIV-1 RT enzyme added to the reaction was catalytically active. The reaction mixture produced a total of 200 pmol of derivatized p66 subunit. The treatment with ExoIII followed by trichloroacetic acid precipitation yielded 150 pmol of p66 subunit. The labeled peptide recovered from the (n-p) gel band after the 20% urea-PAGE procedure was 45 pmol.

Purification of n-p by HinP1I Band Shift Method-- To purify the labeled peptide n-p (Fig. 1, lane 3), the radioactive band was excised from the 20% urea-PAGE gel, minced, and eluted into a HinP1I reaction buffer. An excess of the DNA template RT20 was added and annealed to the n-p peptide. The specific endonuclease HinP1I was then added and incubated for 10 min to cleave a 9-base oligonucleotide fragment from the 5' end of n-p to generate n'-p. This mixture was separated by rerunning in another 20% urea-PAGE, and that autoradiogram is shown in Fig. 2 for the peptides generated by trypsin (panel A) or Lys-C (panel B). The "band shift" achieved by digestion with HinP1I nuclease repositions the radioactive band n-p to a unique faster moving position denoted n'-p. This operation (removal of a 9-mer oligonucleotide from n-p) nicely separates the peptide of interest from any nonradioactive peptide contaminants that might have comigrated with n-p. The n'-p radioactive band contained 15 pmol of peptide in the case of the trypsin-produced peptide (panel A) and 24 pmol in the case of the Lys-C-produced peptide (panel B).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   Purification of n-p by HinP1I band shift method. The autoradiogram of the 20% urea-PAGE separated components of the HinP1I-digested peptide derived from the p66 subunit treated with trypsin (panel A) or Lys-C (panel B). Lane 1 serves as a marker for the reaction components T-n and n. The band denoted n-p is the component containing the peptide fragment covalently linked to the radioactive DNA 20-mer product, and the band denoted n'-p is the digestion fragment produced by treatment of n-p with the HinP1I nuclease (lane 2). Details can be found under "Experimental Procedures."

The "down-arrow " indicates the cleaving sites of HinP1I on template DNA RT20 and product DNA n. The cleavage generated n'-p (CGCCACAACAS4ddU-peptide). The cleavage site for HinP1I endonuclease on the target adduct is shown below.
<AR><R><C><UP>n-p:</UP></C><C><UP>5′-CGCGCCCCG↓CGCCACAACAS<SUP>4</SUP>ddU-peptide</UP></C></R><R><C><UP>Template RT20:</UP></C><C><UP>3′-GCGCGGGGCGC↓GGTGTTGTA-5′</UP></C></R></AR>
<UP><SC>Sequence</SC> 1</UP>

Sequence Analysis of the n'-p Fragments-- The n'-p fragments resulting from HinP1I treatment of the n-p component shown in Fig. 2 were transferred by electroblotting to a PVDF membrane and autoradiographed to visualize the band of interest, which was excised and a portion subjected to a Edman microsequencing. The total sample was calculated to be 12-20 pmol. The analytical data for several sequence analysis are presented in Table I for either the trypsin- or Lys-C-generated n'-p samples.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Amino acid sequence analysis of the n'-p peptide (each of the entries (1-5) were for different experiments)

The sequence analysis for the n'-p peptide derived from a trypsin digestion sample gave evidence of a tetrapeptide that did not allow the identification of the amino acids located in either position 1 or 3. This result did not allow distinction between two possible tetrapeptide sequences ELNK (positions 79-82) or QLCK (positions 278-281). The sequence analysis for the n'-p derived from a Lys-C digestion sample was therefore conducted to make the selection between these choices since the nonomer peptide LVDFRELNK would be produced in place of the ELNK trypsin-generated tetrapeptide and the hexamer peptide VRQLCK would be produced in placed of the QLCK trypsin-generated tetrapeptide. The photoaffinity-labeled amino acid sequence was found to be the hexapeptide VRQLCK (positions 276-281), which resulted from the Lys-C digestion of the p66 subunit. The data for several different experiments is collected in Table I. Note that a second template (RT19) was also used to generate the same labeled peptide.

Several attempts were made to alkylate the Cys280 residue (just prior to the Edman microsequencing) to pinpoint the possible positions of derivatization with the photoprobe. Since we were unable to successfully achieve the alkylation, we suggest that the Cys280 is the most likely choice of the amino acid that is covalently linked with the photoprobe.

    DISCUSSION AND CONCLUSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In our previous study of the photoaffinity labeling of the HIV-1 reverse transcriptase using S4-dUTP as a photoprobe (14), we isolated a 16-kDa labeled fragment (288-423) from the p66 subunit and sequenced the N-terminal portion (288-313). In our present study using S4-ddUTP as the photoprobe, we have isolated a unique labeled hexapeptide (276-281). The photoprobe in our present studies was positioned at (and only at) the 3' end of the primer terminus of an actively synthesizing ternary complex and was incorporated as a chain terminator. Exposure of the photoprobe to ultraviolet light lambda 360 nm resulted in derivatization of the amino acid Cys280 as an accessible target, presumably in close proximity to the active site. The isolation of a target hexapeptide that is somewhat different from our initial study (14) could reflect the possible different binding options available for the different photoprobes. For example, if translocation occurs prior to photolysis, the S4-dUTP photoprobe could engage in a binding interaction at the 3'-hydroxy binding site for the next phosphodiester bond forming event. The S4-ddUTP would have no such new binding option since it does not have a 3'-hydroxyl group.

Extensive studies have been conducted to elucidate the location of the active site and the mechanism of the DNA polymerase activity of HIV-1 RT (24). Attention has been focused on the role of the Asp-triad in catalysis, since initial genetic substitution experiments by Larder et al. (8, 9) and Boyer et al. (25) showed that HIV-1 RT containing either of the mutants D110Q, D185E, D186E, D185H, D110E, or D186N (and several others) were essentially inactive. This aspartate triad is a strongly conserved feature of many nucleic acid polymerases (26).

The availability of several x-ray structures of HIV-1 RT has greatly stimulated a detailed consideration of the active site of the polymerase activity (17, 18). The structure of RT·dsDNA·Fab at a resolution of 3.0 Å (18) showed that the alpha  phosphate of a modeled incoming nucleotide triphosphate could be positioned in close proximity to the Asp triad, which is located near the 3'-OH terminus of the primer strand of the complexed dsDNA. This observation has promoted several detailed mechanistic proposals and suggestions for a two/three divalent metal Asp triad mechanism (17, 19, 20, 27) for DNA polymerases (HIV-1 RT, Klenow, T7 DNA polymerase, as well as DNA polymerase beta ).

Kinetic descriptions of the catalytic events have assisted in the formation of mechanistic and structural proposals in that a binary complex involving the complexation of the template-primer with the enzyme appears to be required prior to the binding of the dNTP substrate. A conformational change occurs in the HIV-1 RT·DNA complex coincident with the binding of the substrate (28). The formation of this binary complex is greatly enhanced when the single stranded template extends to 7 or more nucleotides upstream from the 3' primer terminus (29).

Amino acid derivitizations have been conducted to implicate specific amino acids in the RT polymerization event. Pyridoxal phosphate was complexed with Lys263 and reduced to form a stable covalent derivative, which produced an inactive RT enzyme (10). Phenyl glyoxal was used to form a unique derivative with Arg277, which also inactivated the polymerization activity of the RT enzyme (11).

Photoaffinity labeling studies of HIV-1 RT in various stages of assembly or catalysis have been conducted to implicate various amino acids. The photolysis of the holoenzyme HIV-1 RT in the presence of dTTP produced a derivatized Lys73, which was suggested to be at or near the dNTP substrate binding site (12). The photolysis of RT in the presence of short oligonucleotide primers bound to template yielded derivatized enzyme, which was linked to Leu289-Thr290 or Leu295-Thr296 (13, 30).

The catalytic competent ternary complex has been derivatized using the photoprobe S4-dUTP (14) or the photoprobe (FABdCTP) (31). A large peptide containing the derivative was reported by Sheng and Dennis (14). Our present study using S4-ddUTP as a photoprobe with a catalytically competent strategy, photoaffinity labeled the p66 subunit of HIV-1 RT and allowed the isolation of the hexapeptide Val276-Lys281 with Cys280 as the derivatized amino acid.

We have collected the data from many diverse experimental approaches to the elucidation of the active site of HIV-1 RT and attempted to integrate the information. In Fig. 3 (A-C), we have examined the topographic locations of the Calpha carbons of the various targeted amino acids as they would be positioned in the reported 3.0-Å x-ray structure of the RT·dsDNA·Fab complex (18).


View larger version (148K):
[in this window]
[in a new window]
 
Fig. 3.   Various derivatized alpha  carbon atoms positioned in the 3 Å x-ray structure of the RT·dsDNA·Fab complex (18). Panel A, a stereo view of HIV-1 RT looking down the axis of the bound duplex DNA from the top of a closed "right hand" (right-hand analogy of Kohlstaedt et al. (17)). The colored spheres denote certain alpha  carbons of RT: Asp triad (yellow), Lys73 (green), Lys263 (white), Arg277 (purple), Cys280 (red), and Thr290 (orange). The phosphorus atoms of the primer product strand are shown in blue except for the 3'-terminal phosphate, which is striped. The alpha  carbon backbone of RT is traced in pink. Panel B is the same view as panel A without the alpha  carbon backbone of RT. Panel C is the same view as panel B but rotated 90°.

A cluster of alpha  carbons of certain targeted amino acids suggested to be involved at the active site of the polymerase are positioned at about a 90° clockwise rotation from the terminal phosphate. This rotation would correspond to about 2-3 translocations during synthesis (assuming ~36°/dNTP added) if the aspartic 185 served as a fixed marker for the catalytic site of the polymerase event. The location of Lys73 is about 90° in the opposite direction (counter clockwise) and might correspond to a location of the single-stranded template upstream from the active site (Fig. 4A).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   Topographic relationship of various derivatized alpha  carbons suggested to be at the active site of HIV-1 RT. Panel A shows the radial location of various alpha  carbons of the RT molecule about the axis of the duplex DNA as viewed in Fig. 3A. The bold arrow indicates the direction of rotation of the duplex DNA during successive translocations that accompany polymerization. Panel B gives the distances (in Å) between certain alpha  carbons of RT.

The large distances between these targeted alpha  carbons and the aspartic 185 suggested to be at the catalytic site are problematic (Fig. 4B). The static "snapshot" of the enzyme complexed with the duplex template-primer moiety might misrepresent the location of the 3' end of the product as being positioned in the double helix when, in fact, the dynamic synthesizing ternary complex might contain a segment (3 or more nucleotides long) that is quite flexible and not fixed in the final duplex helix.

The active site of a polymerase also presents problems with respect to topographic assignments of function to structure since derivatization (e.g. by a photoprobe substrate) could occur either before or after translocation. A substrate probe containing a photoreactive group in the binding recognition loci (4-thio moiety) might effectively target the substrate binding site prior to translocation but would be located at a very different site after translocation. In contrast, a substrate probe containing a photoreactive group in the 3' moiety would be positioned at the catalytic site only after bond formation (involving the 5'-phosphate), followed by translocation to position the 3'-hydroxyl for formation of the next phosphodiester bond.

Kinetic studies have indicated certain conformational changes in HIV-1 RT and one could consider that the metal/Asp triad loci not only functionally masks the negative charge of the incoming nucleotide triphosphate but actually escorts the pyrophosphate product away from the newly formed phosphodiester bond at the catalytic site. We are currently investigating a chain terminating photoprobe, which appears to derivatize at the catalytic site of the polymerase, since the probe is located at the 3'-position of the substrate analogue.

    FOOTNOTES

* This work was supported in part by a grant (to S. N.) from the Howard Hughes Medical Institute through the Undergraduate Biological Sciences Education Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Submitted in partial fulfillment of the requirements for a Ph.D. degree in the Dept. of Chemistry and Biochemistry at the University of Delaware. Present address: Dept. of Pharmacology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205.

par Present address: Dept. of Biochemistry, The Johns Hopkins University School of Hygiene and Public Health, Baltimore, MD 21205.

** To whom correspondence should be addressed. Tel.: 302-831-2974; Fax: 302-831-6335; E-mail: ddennis{at}udel.edu.

1 The abbreviations used are: RT, reverse transcriptase; dsDNA, duplex DNA; ExoIII, exonuclease III; HIV-1, human immunodeficiency virus type 1; P12, 5'-d[CGCGCCCCGCGC]-3'; RT19, 3'd-[GCGCGGGGCGCGGTGTGTA]-5'; RT20, 3'-d[GCGCGGGGCGCGGTGTGTA]-5'; S4-dUTP, 4-thiodeoxyuridine 5'-triphosphate; S4-ddUTP, 4-thiodideoxyuridine triphosphate; PAGE, polyacrylamide gel electrophoresis; CAPS, 3-(cyclohexylamino)propanesulfonic acid.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Majumdar, C., Abbotts, J., Broder, S., and Wilson, S. H. (1988) J. Biol. Chem. 263, 15657-15665[Abstract/Free Full Text]
  2. Huber, H. E., McCoy, J. M., Seehra, J. S., Richardson, C. C. (1989) J. Biol. Chem. 264, 4669-4678[Abstract/Free Full Text]
  3. Huber, H. E., and Richardson, C. C. (1990) J. Biol. Chem. 265, 10565-10573[Abstract/Free Full Text]
  4. Kedar, P. S., Abbotts, J., Kovács, T., Lesiak, K., Torrence, P., and Wilson, S. H. (1990) Biochemistry 29, 3603-3611[CrossRef][Medline] [Order article via Infotrieve]
  5. Reardon, J. E., and Miller, W. H. (1990) J. Biol. Chem. 265, 20302-20307[Abstract/Free Full Text]
  6. Kati, W. M., Johnson, K. A., Jerva, L. F., Anderson, K. S. (1992) J. Biol. Chem. 267, 25988-25997[Abstract/Free Full Text]
  7. Jaju, M., Beard, W. A., and Wilson, S. H. (1995) J. Biol. Chem. 270, 9740-9747[Abstract/Free Full Text]
  8. Larder, B. A., Purifoy, D. J., Powell, K. L., Darby, G. (1987) Nature 327, 716-717[CrossRef][Medline] [Order article via Infotrieve]
  9. Larder, B. A., Kemp, S. D., and Purifoy, D. J. M. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 4803-4807[Abstract/Free Full Text]
  10. Basu, A., Tirumalai, R. S., and Modak, M. J. (1989) J. Biol. Chem. 264, 8746-8752[Abstract/Free Full Text]
  11. Mitchell, L. L. W., and Cooperman, B. S. (1992) Biochemistry 31, 7707-7713[CrossRef][Medline] [Order article via Infotrieve]
  12. Cheng, N., Merrill, B. M., Painter, G. R., Frick, L. W., Furman, P. A. (1993) Biochemistry 32, 7630-7634[CrossRef][Medline] [Order article via Infotrieve]
  13. Basu, A., Ahluwalia, K. K., Basu, S., and Modak, M. J. (1992) Biochemistry 31, 616-623[CrossRef][Medline] [Order article via Infotrieve]
  14. Sheng, N., and Dennis, D. (1993) Biochemistry 32, 4938-4932[CrossRef][Medline] [Order article via Infotrieve]
  15. Rodgers, D. W., Gamblin, S. J., Harris, B. A., Ray, S., Culp, J. S., Helling, B., Woolf, D. J., Debouck, C., Harrison, S. C. (1995) Proc. Natl. Acad. Sci. U. S. A. 90, 6320-6324[Abstract/Free Full Text]
  16. Hsiou, Y., Ding, J., Das, K., Clark, A. D., Jr., Hughes, S. H., Arnold, E. (1996) Structure 4, 853-860[Abstract/Free Full Text]
  17. Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., Steitz, T. A. (1992) Science 256, 1783-1790[Abstract/Free Full Text]
  18. Jacobo-Molina, J., Ding, J., Nanni, R. G., Clark, A. D., Jr., Lu, X., Tantillo, C., Williams, R. L., Kamer, G., Ferris, A. L., Clark, P., Hizi, A., Hughes, S. H., Arnold, E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6320-6324
  19. Patel, P. H., Jacobo-Molina, A., Ding, J., Tantilo, C., Clark, A. D., Jr., Raag, R., Nanni, R., G., Hughes, S. H., Arnold, E. (1995) Biochemistry 34, 5351-5363[CrossRef][Medline] [Order article via Infotrieve]
  20. Steitz, T. A., Smerdon, S. J., Jäger, J., and Joyce, C. M. (1994) Science 266, 2022-2025[Free Full Text]
  21. Ruth, J., and Cheng, K. (1981) Mol. Pharmacol. 20, 415-522[Abstract/Free Full Text]
  22. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  23. Henzel, W. J., Rodriguez, H., and Watanabe, C. (1987) J. Chromatogr. 404, 41-52[CrossRef][Medline] [Order article via Infotrieve]
  24. Joyce, C. M., and Steitz, T. A. (1994) Annu. Rev. Biochem. 63, 777-822[CrossRef][Medline] [Order article via Infotrieve]
  25. Boyer, P. L., Ferris, A. L., and Hughes, S. H. (1992) J. Virol. 66, 1031-1039[Abstract/Free Full Text]
  26. Delarue, M., Poch, O., Tordo, N., Moras, D., and Argos, P. (1990) Protein Eng. 3, 461-467[Abstract/Free Full Text]
  27. Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., Kraut, J. (1994) Science 264, 1891-1903[Abstract/Free Full Text]
  28. Johnson, K. A. (1993) Annu. Rev. Biochem. 62, 685-713[CrossRef][Medline] [Order article via Infotrieve]
  29. Boyer, P. A., Tantillo, C., Jacobo-Molina, A., Nanni, R. G., Ding, J., Arnold, E., Hughes, S. H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4882-4886[Abstract/Free Full Text]
  30. Sobol, R. W., Suhadolnik, R. J., Kumar, A., Lee, B. J., Hatfield, D. L., Wilson, S. H. (1993) Biochemistry 30, 10623-10631
  31. Lavrik, O. I., Prasad, R., Beard, W. A., Safronov, I. V., Dobrikov, M. I., Srivastava, D. K., Shishkin, G. V., Wood, T. G., Wilson, S. H. (1996) J. Biol. Chem. 271, 21891-21897[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, S.
Right arrow Articles by Dennis, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, S.
Right arrow Articles by Dennis, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.