![]()
|
|
||||||||
From the The active site of HIV-1 reverse transcriptase
(HIV-1 RT) was investigated by photoaffinity labeling based on
catalytic competence. A stable ternary elongation complex was assembled
containing enzyme, DNA template (RT20), DNA primer molecule (P12), and
the necessary dNTPs (one of which was
The enzyme reverse transcriptase
(RT)1 derived from the HIV-1
virus is a heterodimer composed of two subunits p66 and p51, which are
derived from the same sequence.
A variety of experimental techniques have been directed at the
elucidation of the active site and the mechanism of catalysis of the RT
DNA polymerase activity, to assist in developing a strategy for
treating HIV infection. Kinetic studies have established that an
ordered sequential assembly of components forms a ternary complex, which then conducts a processive polymerization during the elongation phase (1-7). Genetic substitution experiments have shown that several
single amino acid interchanges D110Q, D185H, or D186N in the p66
subunit produce an inactive HIV-1 RT enzyme (8, 9). Studies involving
specific amino acid derivatizations have suggested that
Lys263 (10) and Arg277 (11) are critically
involved at the active site. Photoaffinity labeling studies have
yielded additional suggestions for the nucleotide binding site
components: Lys73 (12), residues 288-307 (13), and
residues 288-423 (14).
Several x-ray structures have been solved for the HIV-1 RT unliganded
enzyme (Rogers et al. (15) reported a structure at 3.2 Å and Hsiou et al. (16) at 2.7 Å resolution), and for various ligands complexed with the holoenzyme; Kohlstaedt et al.
(17) reported a nevirapine-RT enzyme structure at a resolution of 3.5 Å, and Jacobo-Molina et al.. (18) reported a
RT·dsDNA·Fab x-ray structure at a resolution of 3.0 Å. Model
building efforts based primarily on the RT·dsDNA·Fab x-ray
structure have yielded a detailed mechanistic proposal for the HIV-1 RT
enzyme (19). The model is consistent with the critical involvement of
the Asp-triad residues and two Mg2+, as originally proposed
by Steitz et al. (20).
The results reported in this paper utilized the photoaffinity probe
S4-ddUTP to derivatize the active site of HIV-1 RT during
productive synthesis involving a ternary complex. The chain terminating
probe is located specifically at the 3 Materials--
Recombinant HIV-1 reverse transcriptase purified
from an Escherichia coli clone was kindly supplied by Dr.
Christine Debouck and Dr. Jeffrey Culp from SmithKline Beecham
Pharmaceuticals. The template and primer were a gift from Dr. Xiaolin
Zhang at the Nucleic Acid Facility of the University of Pennsylvania
Cancer Center. The sequence of the DNA templates RT19 and RT20 were
3 Photoaffinity Labeling of HIV-1 RT--
The standard reaction
mixture (100 µl) for photoaffinity labeling was: 20 mM
Tris-HCl, pH 7.9, 6 mM MgCl2, 1.0 µM HIV-1 RT heterodimer (Mr = 117,000), 10 µM DNA template, and 10 µM DNA primer. The nonradioactive substrates dATP, dCTP, and photoprobe (S4-ddUTP) were each added to a final concentration of 100 µM. The radioactive substrate [
Photoaffinity Labeling by 4-Thiodideoxyuridine Triphosphate of
the HIV-1 Reverse Transcriptase Active Site during Synthesis
SEQUENCE OF THE UNIQUE LABELED HEXAPEPTIDE*
§,
, and
**
Department of Chemistry and Biochemistry,
University of Delaware, Newark, Delaware 19716 and ¶ Genentech,
South San Francisco, California 94080
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-32P-labeled) needed for primer elongation. The
photoaffinity probe 4-thiodideoxyuridine triphosphate was
incorporated uniquely at the 3
terminus of the 32P-labeled
DNA product. Upon photolysis, the p66 subunit of a HIV-1 RT heterodimer
(p66/p51) was uniquely cross-linked to the DNA product and
subsequently digested by either trypsin or endoproteinase Lys-C. The
labeled HIV-1 RT peptide was separated, purified, and finally subjected
to Edman microsequencing. A unique radioactive hexapeptide
(V276RQLCK281) was identified and sequenced.
Our photoaffinity labeling results were positioned on the HIV-1
RT·DNA·Fab complex x-ray crystallography structure and compared
with the suggested aspartic triad active site.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-OH end of the nascent product. The hexapeptide VRQLCK of the p66 subunit was the only target peptide
that was detected. A general discussion of the possible mechanistic
implications of these results is directed at making all the known
topologic information compatible.
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
d-[GCGCGGGGCGCGGTGTGTA]-5
and 3
d-[GCGCGGGGCGCGGTGTTGTA]-5
.
The sequence of the DNA primer P12 was 5
d-[CGCGCCCCGCGC]-3
. The
nonradioactive deoxynucleotides (dATP, dCTP, and TTP) and Pronase E
were purchased from Sigma. Radioactive nucleotide triphosphate
[
-32P]dCTP (3,000 Ci/mmol), reflection autoradiography
film, and reflection intensifying screen were purchased from NEN Life
Science Products. The nucleoside 4-thiodideoxyuridine was prepared and
kindly provided by Dr. Robert Coleman of Ohio State University. The
corresponding triphosphate was prepared from the nucleoside according
to the method of Ruth and Cheng (21). Exonuclease III was purchased from Amersham Life Science. Sequencing grade endoproteinase Lys-C was
purchased from Promega. Sequencing grade modified trypsin was purchased
from Boehringer Mannheim. HinP1I restriction endonuclease was purchased from New England Biolabs. All reagents for gel
electrophoresis were purchased from Bio-Rad. Spectra/Por 6 molecular
porous dialysis membrane (Mr cut-off = 1,000) was purchased from Spectrum. Mini ProBlottTM membranes was
purchased from Applied Biosystems. The high intensity black lamp (model
B-100A, long wave UV, which peaks at 365 nm) was purchased from Eastern
Corp. Computer program Insight II was purchased from Biosym
Technologies.
-32P]dCTP
(3,000 Ci/mmol) was added to achieve a specific activity within the
range of (1,000~10,000 cpm/pmol). The template primer complex was
prepared by heating a solution of 20 µM DNA template and
20 µM DNA primer in the reaction buffer to 100 °C for
3 min. Upon cooling (1 h), the HIV-1 RT was added and the mixture was incubated at 37 °C for 5 min. Immediately upon adding the
substrates, the reaction mixture was placed in a depression well of an
aluminum foil-covered, temperature-regulated aluminum block. The
aluminum block was covered with an inverted Petri dish to prevent
extensive evaporation of the reaction mixtures. The UV lower wavelength cut-off of a Pyrex Petri dish is 290 nm. An additional Petri dish, filled with water, was positioned on top of the first one to provide cooling. The lamp was positioned to shine the light from a distance of
about 2 cm onto the top of the water-filled Petri dish. The reaction
mix was irradiated with UV (365 nm) for 60 min at 37 °C. To minimize
the damage from the heat generated by the UV lamp, the water in the top
Petri dish was replaced with cool water at 20 and 40 min.
DNA Product Analysis-- The DNA products were separated on the basis of molecular weight using 20% polyacrylamide (acrylamide:bisacrylamide = 19:1) gel electrophoresis containing 7 M urea (dimensions: 170 × 140 × 1.7 mm). The electrophoresis buffer was 0.89 M Tris, 0.89 M boric acid, 20 mM EDTA, pH 8.3. The gel was preelectrophoresed with bromphenol blue and xylene cyanol dye markers in deionized formamide for 1 h prior to loading the samples. Sample mixtures of 15 µl were applied and electrophoresed for 3.5-4 h at 600 V until the xylene cyanol dye marker was about 5 cm from the bottom of the gel. The DNA products were visualized by autoradiography. The radioactive bands were excised and counted in Eppendorf tubes by the Cerenkov method.
Protein Analysis-- For protein labeling analysis, samples from the photoaffinity labeling experiments were mixed with 2 × Laemmli buffer containing the bromphenol blue dye marker (22) at 1:1 (v/v) ratio and boiled at 100 °C for 3 min. The total samples were loaded onto a 10% polyacrylamide (acrylamide:bisacrylamide = 30:0.8) gel containing 0.1% SDS (dimensions: 275 × 140 × 7 mm). The electrophoresis buffer was 25 mM Tris glycine, pH 8.3. The electrophoresis was carried out at 150 V for 1 h and 300 V for another 4.5 h. The radioactive bands were visualized by autoradiography. For quantitative analysis, the radioactive bands were excised and counted in Eppendorf tubes by the Cerenkov method.
Cerenkov Counting Calibration-- The same size gel bands containing variable amounts of 32P radioactivity were excised from a 20% urea-PAGE (or 10% SDS-PAGE) and counted in Eppendorf tubes once. Each band was then transferred to a scintillation vial and minced. The scintillation vial was filled with scintillation fluid and counted in the 32P channel for 5 min. The data from the scintillation counting was plotted versus the data from the Cerenkov counting. The points were fitted with a linear function. The slope is the calibration factor for Cerenkov counting. The calibration factor for gel bands from 20% urea-PAGE is 1.3724. The calibration factor for gel bands from 10% SDS-PAGE is 1.7245.
Proteolytic Digestion of the Labeled HIV-1 RT and Amino Acid
Sequencing of the Labeled Proteolysis Product--
The photoaffinity
labeling reaction (total volume 10 ml containing 10 nmol of HIV-1 RT
and 100 nmol each of DNA template (RT20) and DNA primer (P12)) was
performed as described above. After UV irradiation, 1.0 ml of 10 × exonuclease III (ExoIII) digestion buffer was added to the reaction
mixture. This reaction mixture was immediately digested by 5,000 units
of ExoIII (100 unit/µl) at 37 °C for 30 min (1 unit of ExoIII will
catalyze the release of 1.0 nmol of acid-soluble nucleotide in 30 min
at 37 °C in 1 × buffer). After the ExoIII digestion, the
reaction mixture was precipitated by trichloroacetic acid. A 20-ml
glass vial was used as a container, and a stir bar constantly stirred
the reaction mixture while the trichloroacetic acid was added. Ice-cold
50% trichloroacetic acid (2.5 ml) was added to the ExoIII reaction mixture to a final 1:4 (v/v) ratio. After the precipitation step, the
mixture was distributed repetitively into two Eppendorf tubes and was
subjected to centrifugation (13,000 rpm, microcentrifuge at 4 °C for
5 min). The supernatant was removed from the precipitated protein.
Multiple centrifugations were required to accumulate the precipitated
protein. After centrifugation, the pellet was washed once with cold
(
20 °C) 100% acetone and centrifuged at 4 °C for another 5 min. The pellet was air-dried and immediately dissolved into a buffer
suitable for proteolytic digestion to form peptides (trypsin or
Lys-C).
| |
RESULTS |
|---|
|
|
|---|
Photoaffinity Labeling of HIV-1 RT with
S4-ddUTP--
A previous photoaffinity labeling study
employing S4-dUTP as a probe for the active site subunit of
HIV-1 RT has been reported by Sheng and Dennis (14). The basic features
of that study were repeated using the chain terminator
S4-ddUTP, and similar results were obtained in that the
labeling of the p66 subunit was light- and
photoprobe-dependent and the efficiency of labeling
was ~2%. The basic strategy for substituting S4-ddUTP in
place of S4-dUTP in the current study was to ensure that no
additional nucleotides could be added after the photoprobe was inserted
at the 3
-terminal position of the elongated primer. In our previous
study (14), the isolation of a small labeled peptide was not achieved
and a large 16-kDa (288-423) fragment was isolated and partially
sequenced (288-313). In our present study, the isolation and
purification of the peptide derived from the Lys-C proteolysis of the
labeled p66 subunit enabled us to obtain a single radioactive
hexapeptide for sequencing.
Generation of Labeled HIV-1 RT Peptide by Trypsin--
The
photoaffinity labeling reaction mixture was treated with the 3
5
DNA specific nuclease ExoIII and precipitated with trichloroacetic acid
to remove the majority of radioactive oligonucleotide (and
mononucleotides). The radioactive elongated primer containing the
photoprobe at the 3
terminus (and covalently linked to the p66
subunit) is resistant to the nuclease since its 3
end is blocked. In
Fig. 1, the results of the ExoIII
digestion can be seen by comparing lanes 1 and 2 in panel A or B. The radioactive component at the
origin is the band of interest, whereas the product (n) and the
photodimer containing the template cross-linked to the radioactive
elongated primer (T-n) are essentially removed from the trichloroacetic
acid precipitate. As seen in lane 3, after treatment with
either trypsin (panel A) or Lys-C (panel B), a
single radioactive peptide (n-p) from the p66 subunit is produced in
addition to the product (n), which persists as a detectable contaminant. The shift of n-p to a lower position is produced upon
treatment with Pronase, which cleaves most (but not all) of the peptide
from the cross-linked n fragment (lane 4 in A and B). A steric restraint may prevent Pronase from hydrolyzing
the peptide bonds close to the derivatization point between the peptide and the 3
end of the oligonucleotide product. Notice that the oligonucleotide product located at n is not altered by Pronase, and
therefore does not contain a peptide.
|
Purification of n-p by HinP1I Band Shift Method--
To purify the
labeled peptide n-p (Fig. 1, lane 3), the radioactive band
was excised from the 20% urea-PAGE gel, minced, and eluted into a
HinP1I reaction buffer. An excess of the DNA template RT20
was added and annealed to the n-p peptide. The specific endonuclease HinP1I was then added and incubated for 10 min to cleave a
9-base oligonucleotide fragment from the 5
end of n-p to generate
n
-p. This mixture was separated by rerunning in another 20%
urea-PAGE, and that autoradiogram is shown in Fig.
2 for the peptides generated by trypsin
(panel A) or Lys-C (panel B). The "band
shift" achieved by digestion with HinP1I nuclease
repositions the radioactive band n-p to a unique faster moving position
denoted n
-p. This operation (removal of a 9-mer oligonucleotide from
n-p) nicely separates the peptide of interest from any nonradioactive
peptide contaminants that might have comigrated with n-p. The n
-p
radioactive band contained 15 pmol of peptide in the case of the
trypsin-produced peptide (panel A) and 24 pmol in the case
of the Lys-C-produced peptide (panel B).
|
" indicates the cleaving sites of
HinP1I on template DNA RT20 and product DNA n. The cleavage
generated n
-p (CGCCACAACAS4ddU-peptide). The cleavage site
for HinP1I endonuclease on the target adduct is shown
below.
|
|
Sequence Analysis of the n
-p Fragments--
The n
-p fragments
resulting from HinP1I treatment of the n-p component shown
in Fig. 2 were transferred by electroblotting to a PVDF membrane and
autoradiographed to visualize the band of interest, which was excised
and a portion subjected to a Edman microsequencing. The total sample
was calculated to be 12-20 pmol. The analytical data for several
sequence analysis are presented in Table
I for either the trypsin- or
Lys-C-generated n
-p samples.
|
-p peptide derived from a trypsin
digestion sample gave evidence of a tetrapeptide that did not allow the
identification of the amino acids located in either position 1 or 3. This result did not allow distinction between two possible tetrapeptide
sequences ELNK (positions 79-82) or QLCK (positions 278-281). The
sequence analysis for the n
-p derived from a Lys-C digestion sample
was therefore conducted to make the selection between these choices
since the nonomer peptide LVDFRELNK would be produced in place of the
ELNK trypsin-generated tetrapeptide and the hexamer peptide VRQLCK
would be produced in placed of the QLCK trypsin-generated tetrapeptide.
The photoaffinity-labeled amino acid sequence was found to be the
hexapeptide VRQLCK (positions 276-281), which resulted from the Lys-C
digestion of the p66 subunit. The data for several different
experiments is collected in Table I. Note that a second template (RT19)
was also used to generate the same labeled peptide.
Several attempts were made to alkylate the Cys280 residue
(just prior to the Edman microsequencing) to pinpoint the possible positions of derivatization with the photoprobe. Since we were unable
to successfully achieve the alkylation, we suggest that the
Cys280 is the most likely choice of the amino acid that is
covalently linked with the photoprobe.
| |
DISCUSSION AND CONCLUSION |
|---|
|
|
|---|
In our previous study of the photoaffinity labeling of the HIV-1
reverse transcriptase using S4-dUTP as a photoprobe (14),
we isolated a 16-kDa labeled fragment (288-423) from the p66 subunit
and sequenced the N-terminal portion (288-313). In our present study
using S4-ddUTP as the photoprobe, we have isolated a unique
labeled hexapeptide (276-281). The photoprobe in our present studies
was positioned at (and only at) the 3
end of the primer terminus of an
actively synthesizing ternary complex and was incorporated as a chain
terminator. Exposure of the photoprobe to ultraviolet light
360 nm
resulted in derivatization of the amino acid Cys280 as an
accessible target, presumably in close proximity to the active site.
The isolation of a target hexapeptide that is somewhat different from
our initial study (14) could reflect the possible different binding
options available for the different photoprobes. For example, if
translocation occurs prior to photolysis, the S4-dUTP
photoprobe could engage in a binding interaction at the 3
-hydroxy
binding site for the next phosphodiester bond forming event. The
S4-ddUTP would have no such new binding option since it
does not have a 3
-hydroxyl group.
Extensive studies have been conducted to elucidate the location of the active site and the mechanism of the DNA polymerase activity of HIV-1 RT (24). Attention has been focused on the role of the Asp-triad in catalysis, since initial genetic substitution experiments by Larder et al. (8, 9) and Boyer et al. (25) showed that HIV-1 RT containing either of the mutants D110Q, D185E, D186E, D185H, D110E, or D186N (and several others) were essentially inactive. This aspartate triad is a strongly conserved feature of many nucleic acid polymerases (26).
The availability of several x-ray structures of HIV-1 RT has greatly
stimulated a detailed consideration of the active site of the
polymerase activity (17, 18). The structure of RT·dsDNA·Fab at
a resolution of 3.0 Å (18) showed that the
phosphate of a modeled
incoming nucleotide triphosphate could be positioned in close proximity
to the Asp triad, which is located near the 3
-OH terminus of the
primer strand of the complexed dsDNA. This observation has promoted
several detailed mechanistic proposals and suggestions for a two/three
divalent metal Asp triad mechanism (17, 19, 20, 27) for DNA polymerases
(HIV-1 RT, Klenow, T7 DNA polymerase, as well as DNA polymerase
).
Kinetic descriptions of the catalytic events have assisted in the
formation of mechanistic and structural proposals in that a binary
complex involving the complexation of the template-primer with the
enzyme appears to be required prior to the binding of the dNTP
substrate. A conformational change occurs in the HIV-1 RT·DNA complex
coincident with the binding of the substrate (28). The formation of
this binary complex is greatly enhanced when the single stranded
template extends to 7 or more nucleotides upstream from the 3
primer terminus (29).
Amino acid derivitizations have been conducted to implicate specific amino acids in the RT polymerization event. Pyridoxal phosphate was complexed with Lys263 and reduced to form a stable covalent derivative, which produced an inactive RT enzyme (10). Phenyl glyoxal was used to form a unique derivative with Arg277, which also inactivated the polymerization activity of the RT enzyme (11).
Photoaffinity labeling studies of HIV-1 RT in various stages of assembly or catalysis have been conducted to implicate various amino acids. The photolysis of the holoenzyme HIV-1 RT in the presence of dTTP produced a derivatized Lys73, which was suggested to be at or near the dNTP substrate binding site (12). The photolysis of RT in the presence of short oligonucleotide primers bound to template yielded derivatized enzyme, which was linked to Leu289-Thr290 or Leu295-Thr296 (13, 30).
The catalytic competent ternary complex has been derivatized using the photoprobe S4-dUTP (14) or the photoprobe (FABdCTP) (31). A large peptide containing the derivative was reported by Sheng and Dennis (14). Our present study using S4-ddUTP as a photoprobe with a catalytically competent strategy, photoaffinity labeled the p66 subunit of HIV-1 RT and allowed the isolation of the hexapeptide Val276-Lys281 with Cys280 as the derivatized amino acid.
We have collected the data from many diverse experimental approaches to
the elucidation of the active site of HIV-1 RT and attempted to
integrate the information. In Fig. 3
(A-C), we have examined the topographic locations of the
C
carbons of the various targeted amino acids as they would be
positioned in the reported 3.0-Å x-ray structure of the
RT·dsDNA·Fab complex (18).
|
A cluster of
carbons of certain targeted amino acids suggested to
be involved at the active site of the polymerase are positioned at
about a 90° clockwise rotation from the terminal phosphate. This
rotation would correspond to about 2-3 translocations during synthesis
(assuming ~36°/dNTP added) if the aspartic 185 served as a fixed
marker for the catalytic site of the polymerase event. The location of
Lys73 is about 90° in the opposite direction (counter
clockwise) and might correspond to a location of the single-stranded
template upstream from the active site (Fig.
4A).
|
The large distances between these targeted
carbons and the aspartic
185 suggested to be at the catalytic site are problematic (Fig.
4B). The static "snapshot" of the enzyme complexed with the duplex template-primer moiety might misrepresent the location of
the 3
end of the product as being positioned in the double helix when,
in fact, the dynamic synthesizing ternary complex might contain a
segment (3 or more nucleotides long) that is quite flexible and not
fixed in the final duplex helix.
The active site of a polymerase also presents problems with respect to
topographic assignments of function to structure since derivatization
(e.g. by a photoprobe substrate) could occur either before
or after translocation. A substrate probe containing a photoreactive
group in the binding recognition loci (4-thio moiety) might effectively
target the substrate binding site prior to translocation but would be
located at a very different site after translocation. In contrast, a
substrate probe containing a photoreactive group in the 3
moiety would
be positioned at the catalytic site only after bond formation
(involving the 5
-phosphate), followed by translocation to position the
3
-hydroxyl for formation of the next phosphodiester bond.
Kinetic studies have indicated certain conformational changes in HIV-1
RT and one could consider that the metal/Asp triad loci not only
functionally masks the negative charge of the incoming nucleotide
triphosphate but actually escorts the pyrophosphate product away from
the newly formed phosphodiester bond at the catalytic site. We are
currently investigating a chain terminating photoprobe, which appears
to derivatize at the catalytic site of the polymerase, since the probe
is located at the 3
-position of the substrate analogue.
| |
FOOTNOTES |
|---|
* This work was supported in part by a grant (to S. N.) from the Howard Hughes Medical Institute through the Undergraduate Biological Sciences Education Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Submitted in partial fulfillment of the requirements for a Ph.D. degree in the Dept. of Chemistry and Biochemistry at the University of Delaware. Present address: Dept. of Pharmacology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205.
Present address: Dept. of Biochemistry, The Johns Hopkins
University School of Hygiene and Public Health, Baltimore, MD
21205.
** To whom correspondence should be addressed. Tel.: 302-831-2974; Fax: 302-831-6335; E-mail: ddennis{at}udel.edu.
1
The abbreviations used are: RT, reverse
transcriptase; dsDNA, duplex DNA; ExoIII, exonuclease III; HIV-1, human
immunodeficiency virus type 1; P12, 5
-d[CGCGCCCCGCGC]-3
; RT19,
3
d-[GCGCGGGGCGCGGTGTGTA]-5
; RT20,
3
-d[GCGCGGGGCGCGGTGTGTA]-5
; S4-dUTP, 4-thiodeoxyuridine
5
-triphosphate; S4-ddUTP, 4-thiodideoxyuridine
triphosphate; PAGE, polyacrylamide gel electrophoresis; CAPS,
3-(cyclohexylamino)propanesulfonic acid.
| |
REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |