|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J Biol Chem, Vol. 273, Issue 20, 12006-12016, May 15, 1998
From the We report sequence of Thermus
thermophilus HB8 DNA containing the gene (cycA) for
cytochrome c552 and a gene (cycB)
encoding a protein homologous with one subunit of an ATP-binding
cassette transporter. The cycA gene encodes a 17-residue
N-terminal signal peptide with following amino acid sequence identical
to that reported by (Titani, K., Ericsson, L. H., Hon-nami, K.,
and Miyazawa, T. (1985) Biochem. Biophys. Res. Commun. 128, 781-787). A modified cycA was placed under control of the
T7 promoter and expressed in Escherichia coli. Protein
identical to that predicted from the gene sequence was found in two
heme C-containing fractions. Fraction rC552,
characterized by an Three cytochromes c from Thermus
thermophilus HB8 have been described (cf. Fee et
al. for review (1)). One of these, the very basic cytochrome
c552, is a good substrate for the terminal oxidase, cytochrome ba3 (~250 electrons/s at
25 °C (2), and a poor substrate for the terminal oxidase cytochrome
caa3 (~1-2 electrons/s at 25 °C, Ref. 3).
Mechanistic and biophysical examination of these respiratory enzymes is
greatly impeded, because useful quantities are only obtained from large
amounts of bacterial cell mass, and yields of the cytochrome
c552 from T. thermophilus are small;
for example, <1 mg of pure cytochrome c552 is
obtained from 1 kg of Thermus cell paste (4), although this
may depend on growth conditions and purification procedures (4, 5). Studies on the functional properties of the two Thermus
cytochrome c oxidases are thus limited by the availability
of and by the need for designed mutations in the cytochrome
c. The prospect of having the three-dimensional structure of
cytochrome ba3 (6) and the report of an atomic
resolution x-ray structure of native Thermus cytochrome
c552 (7) emphasize the potential of this system
to provide novel insight on cytochrome c oxidase function. In the course of constructing a deletion series of a Thermus
genomic DNA fragment for sequencing the c552
locus, we observed that colonies from a certain time point in the
series were distinctly reddish-brown in color (8). This led us to
attempt engineered expression of the cytochrome
c552 gene in E. coli.
The c-type cytochromes have covalently attached heme groups
usually linked via thioether bonds between two cysteine residues and
the 2- and 4-vinyl groups of the heme. Bacterial cytochromes c are located in the periplasmic space in Gram-negative
bacteria, or in the case of Gram-postive bacteria, they are bound to
the outer surface of the plasma membrane by means of a hydrophobic N-terminal segment (9). Cytochrome c552 of
T. thermophilus was previously shown to be located in the
periplasmic space (10). Bacterial cytochrome c synthesis
involves several steps: (a) a pre-apocytochrome c
is synthesized in the cytoplasm, i.e. a protein having no
heme attached and which possesses an additional N-terminal domain
containing signals to transport the protein across the plasma membrane
and to specifically proteolyze the signal sequence peptide.
(b) The apoprotein and protoheme IX are transported across the plasma membrane, where the signal peptide is cleaved.
(c) Once heme and apoprotein are in the periplasmic space,
the heme is covalently attached to the protein. And finally,
(d) the protein folds into the conformation of the mature
holoprotein (cf. Ref. 11 for review). While many details
remain unknown, the entire process occurs within a few seconds of
protein synthesis (12).
As many as 16 genes and/or gene products are essential for cytochrome
c synthesis (cf. Refs. 11 and 13 for review).
Included are ferrochelatase (HemH), an enzyme responsible for
incorporating iron into protoporphyrin IX (14); heme lyase (CcmF and
CcmH) to attach heme to apoprotein by catalyzing the formation of the thioether (see Refs. 11 and 15 for review and additional references); a
thioredoxin-like molecule located in the periplasm maintains reduced
cysteine SH in apocytochromes c (CycY or HelX, Refs. 16, 17); a disulfide isomerase that presumably helps maintain the apocytochrome c in a state suitable for reaction with the
lyase (DipZ) (18); unidentified "assembly factors" such as CycH in Paracoccus denitrificans (19); and genes that encode for ABC transporters (for review, see Refs. 11 and 20). For example, the
helABCD operon of Rhodobacter capsulatus (17) and
the cycVWXY operon of Bradyrhizobium japonicum
(21) encode ABC-type ATP-dependent transport proteins that
are essential for cytochrome c synthesis in their respective
organisms (cf. Refs. 11 and 13 for review and additional
citations). Finally, there are specialized gene products for synthesis
of specific cytochromes c, e.g. cytochrome c1 of the bc1 complex
(19, 22), and there appear to be specific sequences within the
cytochrome c molecule itself that contain information to
guide the synthetic process (23, 24).
Given the complexity of cytochrome c maturation, one might
suspect that heterologous expression would be inefficient and, indeed,
there are numerous reports to that effect (25-31). There are, however,
some notable exceptions. Thus, Ubbink et al. (32) describe
expression of the complete (including code for the signal peptide)
Thiobacillus versutus cytochrome c550
gene in E. coli. The cell mass obtained from each liter of
culture medium yielded 1-2 mg of holoprotein, all of which appeared to
reside in the periplasm. This allowed the authors to obtain enough
protein for high-resolution NMR studies. Sambongi and Ferguson (33)
made the remarkable observation that synthesis of holo Paracoccus
denitrificans cytochrome c550 in E. coli requires an N-terminal signal peptide to target the gene
product to the periplasm, whereas E. coli can synthesize
holo Hydrogenobacter thermophilus cytochrome
c552 without targeting to the periplasm. These
authors attributed heme C formation to "spontaneous cytoplasmic
attachment of heme to the (properly folded) thermostable protein,"
revealing yet another complexity of cytochrome c synthesis
in E. coli. We describe here the first heterologous
expression system for large scale preparation of Thermus
cytochrome c552 from E. coli and our
initial characterization of the gene products.
Molecular Biology Methods--
Genomic DNA was isolated from
T. thermophilus strain HB8 (ATCC 27634) as described
previously (34). E. coli strains were cultured in L-broth
(35) modified by omitting glucose and lowering the sodium chloride to
0.5%, with 1.5% agar (Difco) for plates. Plasmid preparations were
carried out by standard procedures (36). Probe design for genomic
hydridization was based on the method of most probable codons (37, 38;
see "Results") using the GCG (39) program CODONFREQUENCY. The
cytochrome c552 gene was isolated on a
1.6-kilobase KpnI genomic restriction fragment by the method of Mather et al. (40) and cloned in the Stratagene vector
BSII(SK+), generating plasmid p13BCYCA (8). An exonuclease III deletion series was constructed to sequence the sense strand (Erase-a-base system, Promega), and synthetic oligonucleotide primers were used to
sequence the antisense strand. Sequencing was performed by the method
of Sanger et al. (41) with modifications as described (42)
to alleviate compressions, false terminations, and
pyrophosphorolysis.
Construction of pETC552--
The c552
reading frame was amplified by
PCR1 from p13BCYCA (42) while
simultaneously introducing restriction sites for subcloning. The
expression vector pET17b (Novagen, Madison, WI) was used to harbor and
direct the synthesis of the following construct in E. coli
strain BL21(DE3). The sense-strand primer,
5'-d(CTGCTCGGCGGCCTGGCATATGGCCCAG)-3', introduces an NdeI site (underlined) and the start codon
(bold type). The antisense primer,
5'-d(CTGGGCCAGCATGGGATCCGGTTACTT)-3', introduces
a BamHI site (underlined) just downstream of the native stop
codon (bold type). PCR primers were synthesized at the California Institute of Technology using an Applied Biosystems 380B DNA
synthesizer. The PCR reaction was optimized using the HotWax OptiStart
KitTM (Invitrogen, San Diego, CA). The PCR fragment was gel-purified to
remove excess primers, nucleotides, and PCR buffer from the sample.
After digesting the PCR fragment and pET17b with NdeI and
BamHI, each was agarose gel-purified. The prepared vector and insert fragments were ligated with T4DNA ligase (New England Biolabs). Bacterial strain BL21(DE3) was transformed to ampicillin resistance with the ligation mixture and colonies containing the construct pETC552 were isolated for analysis. The construct was verified by DNA sequencing on an Applied Biosystems Prism DNA sequencing system at the California Institute of Technology sequencing facility.
General Methods--
Optical spectra were recorded on a
SLM/AMINCO model DB3500 spectrophotometer in 1-cm cells. Fully oxidized
proteins were obtained by making the solution 10 µM in
ferricyanide, and reduced proteins were prepared by adding a small
amount of strongly buffered sodium dithionite solution directly to the
optical cuvette. The reduced-oxidized extinction
coefficient, Expression and Purification of Recombinant Cytochrome c552-- 10 ml of culture medium (LB and 50 mg/ml ampicillin) were inoculated from a freshly streaked plate of E. coli (strain BL21-DE3) cells containing the pETC552 plasmid. After incubation overnight at 37 °C, this culture was used to inoculate 1 liter of LB medium, containing 50 mg/ml ampicillin, in a 2.8-liter Fernbach flask. This culture was incubated at 37 °C overnight on a rotary shaker set at 125 rpm. The cells were pelleted by centrifugation at 5000 × g for 5 min. The cell pellet was distinctively reddish-brown color, indicating heme protein overproduction. The pellet from 1 liter of culture was resuspended in 25 ml of 50 mM Tris-HCl, pH 8.0, 4 mg/ml lysozyme, 40 units/ml DNase I, 3 units/ml RNase A, 0.1% Triton X-100. p-toluenesulfonyl fluoride was added (2 mM) to inhibit proteolysis, and the extract was incubated at 30 °C for at least 30 min. The cell debris was separated from the extract by centrifugation at 12,000 × g for 15 min at 4 °C. The supernatant, which had the characteristic reddish-brown color, was loaded onto a CM-52 gravity column that had been equilibrated with 25 mM Tris-HCl, 0.1 mM EDTA, pH 8.0 (25 mM TE buffer (TE buffer: 25 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)) at 4 °C, washed overnight with several column volumes of equilibration buffer, and eluted with a gradient of 0-1 M NaCl in 10 mM TE buffer. Fractions containing the reddish-orange protein were combined and concentrated using Centricon 10 concentrators (Amicon) with YM-3 or YM-10 membranes. The concentrated protein was desalted (10 mM TE buffer) using a PD-10 (Amersham Pharmacia Biotech) and passed over a EconoPac CM Column (Bio-Rad) attached to an Amersham Pharmacia Biotech fast protein liquid chromatography purification system. The column was washed with several column volumes of the same buffer, and the protein was eluted with a gradient of 0-2 M NaCl in 10 mM TE buffer. The final step of the procedure involves fast protein liquid chromatography purification using a HiLoad 16/60 Superdex 75 column (Amersham Pharmacia Biotech) that was equilibrated with TE buffer (see Fig. 3). The protein was concentrated as described above.
The amino acid sequence of T. thermophilus HB8 cytochrome c552 was previously determined by Edman degradation of proteolytically generated peptides (48). We used reverse translation and took advantage of the highly skewed codon usage of T. thermophilus (cf. Refs. 49 and 50) to design a nondegenerate oligonucleotide probe for the gene that was complimentary to the protein sequence, QGQIEVKGMKYNG: 5'-(CCGTTCTACTTCATCCCCTTGACCTCGATCTGCCCCTG). This probe was used to identify and isolate a 1.6-kilobase pair KpnI fragment as described under "Experimental Procedures." The entire fragment was sequenced on both strands and is presented in Fig. 1; the sequence of the probe was found to differ in only 4 of the 38 positions (at the positions underlined above).
The DNA sequence reveals two open reading frames. The first open
reading frame begins at position 154 and ends at position 600 with the
stop codon TAA. The translated nucleotide sequence from 205 to 597 corresponds to the chemically determined amino acid sequence of native
cytochrome c552 (48), and we designate this
cycA. Translation from position 154 through 204 indicates the presence of a 17-amino acid signal peptide (underlined
in Fig. 1; cf. Ref. 51). The region upstream of the
initiation codon (position 154) contains elements that probably serve
as a promoter, including The translated amino acid sequence from cycB is also shown in Fig. 1. A TFASTA search (53) against the Swissprot data base retrieved numerous proteins that share amino acid sequence similarity, with the highest scoring hits being members of the protein superfamily known as ABC transporters (data not shown). These form a diverse group of enzymes that bind and hydrolyze ATP to drive the transport of signal sequence-independent transport of polypeptides, organic molecules, or ions across membranes (cf. Ref. 20 for a general review). As reviewed by Thöny-Meyer (11), a subset of this family is essential for cytochrome c maturation. Fig. 2 shows a complete alignment of the CycB amino acid sequence with those of the ATP-binding subunit of selected ABC transporters that have been implicated in cytochrome c maturation in several eubacteria. The designated A- and B-sites (Fig. 2) form the ATP binding fold (20, 54), and the sequence similarity in these regions as well as throughout the molecule is evident. CycB from Thermus thus appears to be a homolog of known cytochrome c maturation proteins and therefore probably has the same function in T. thermophilus (see "Discussion").
Two palindromic sequences were identified using the GCG (39) program STEMLOOP as underlined in Fig. 1. The first palindromic sequence occurs at nt 606 to nt 617 with a complementary sequence at nt 633 to nt 622. This includes 2 G=U pairings, which suggests that this palindrome may form in the mRNA and thus may regulate a termination of translation. Since the start codon of cycB is located in the leading strand of this potential structure, it may provide part of an attenuation signal to modulate CycB formation.2 Potentially the strongest stemloop-forming sequence begins at nt 1435 to nt 1448 with a complementary region nt 1466 to nt 1453. This occurs 30 nucleotides after the termination codon of cycB, it contains a single A-C mismatch and is probably involved in termination of transcription. Although functional in Thermus cells, the suggested promoter
elements upstream of cycA (Fig. 1) do not direct the
expression of detectable amounts of cytochrome
c552 in E. coli. Other T. thermophilus HB8 promoters containing similar Accordingly, a plasmid was prepared by PCR amplification of a DNA fragment containing cycA in which the forward primer includes an NdeI site and an alanine codon just upstream of the codon for glutamine at nucleotide position 205, while the reverse primer contains a BamHI site and the normal stop codon for cycA (see "Experimental Procedures"). This fragment was then ligated into the Studier vector (59), pET17b, that had been digested with NdeI and BamHI; by this strategy, cycA was placed immediately downstream of the T7 RNA polymerase promoter. The standard strategy in this expression system is to activate the expression of T7 RNA polymerase from the host genome through an IPTG-inducible promoter, which then transcribes an open reading frame placed downstream of the T7 promoter in a pET construct (59). The complete DNA sequence of the insert showed that no mutations had been introduced during the construction process. The predicted gene product thus begins with MAQADGAKI and ends with KKLGLK (cf. Fig. 1). Lacking a signal sequence, any protein formed is likely to be restricted to the cytoplasm (cf. Ref. 11). When E. coli cells (strain BL21-DE3) containing this plasmid
are grown on agar plates in the absence of the T7 RNA polymerase inducer (IPTG) they appear as reddish-colored colonies. Similarly, when the cells are grown aerobically in 1-liter batches, again in the
absence of IPTG, the cell pellets are distinctly red-orange in color.
However, induction of T7 RNA polymerase with IPTG in liquid cultures
causes the formation of inclusion bodies in the host cytoplasm and
leads to no detectable holocytochrome c
formation.3 These
observations indicate that a balance exists under noninducing conditions between protein synthesis initiated by a somewhat
"leaky" IPTG-inducible promoter in the DE3 lysogen (cf.
Ref. 59) and the ability of the cell to provide the necessary heme for
cytochrome synthesis. We see no evidence for apocytochrome c
in our preparations (see below). When cell pellets from cultures grown
under expressing conditions (without IPTG) are treated with a
lysozyme/EDTA mixture (60) and centrifuged, the resulting supernatant
has only a faint color, suggesting that little if any heme protein was
transported to the periplasm (not shown). However, when the cells are
disrupted (see "Experimental Procedures") and subjected to
centrifugation at 10,000 × g for a few minutes, the
supernatant has a strong reddish-orange color. A cation exchange resin
(CM-52) clears the color of the supernatant in a few minutes and itself
turns reddish-brown from the adsorbed material. Accordingly, a
purification procedure was developed based on the cationic nature of
cytochrome c552 at neutral pH (the pI predicted
by PEPTIDESORT is 10.2, in agreement with that observed for native
protein (5) and its relatively small molecular mass (~15 kDa) (see
"Experimental Procedures"). As shown in Fig.
3, the elution profile of the final gel
filtration column reveals the presence of two cytochrome
c-containing fractions. The void volume of this column is
~24 ml with an exclusion limit of ~100,000 Da. The first peak,
eluting at ~65 ml, shows an
Fig. 4A shows SDS gels stained with Coomassie Blue. The sample of native protein shows a majority band near 14.5 kDa and weak impurity bands at ~21.5 and ~40 kDa. The rC552 sample shows a single band at ~14.5 kDa and no obvious impurity bands. Similarly rC557 shows a single band at ~14.5 but has a band of lesser intensity near 30 kDa. Thus, the two recombinant proteins appear to have molecular masses close to that of the native protein and consistent with translation of the cloned gene. Fig. 4B shows SDS gels that were stained for heme based peroxidase activity according to the method of Thomas et al. (61). It can be seen that the principal protein bands in all samples, appearing at ~14.5 kDa, stain for heme, and that the apparent impurity band near 31 kDa in cytochrome rC557 also stains for heme. We believe that the latter is due to a dimer of the 14.8-kDa protein that survives the denaturing influence of the SDS even at 100 °C (see below). While native cytochrome c552 is N-terminally blocked (48), the recombinant protein was designed to begin with the MAQ sequence so as to avoid this potentially complicating factor and to remove the signal sequence. Partial N-terminal sequence information on both of these fractions (Table I) show sequence beginning with alanine. The proteins are very pure with respect to the N terminus, and the individual amino acids were obtained in high percent yield (data not shown). Prior to N-terminal sequence determination, the samples were reduced with dithiothreitol, reacted with with ICH2COOH and purified by high performance liquid chromatography. These procedures should convert any free cysteine-SH groups to the carboxymethyl derivative (44). The left column of Table I shows the yield of the individual amino acids from cytochrome rC552 as the sequencing reactions progress. It is noteworthy that the encoded N-terminal methionine (62) has been completely removed in both fractions and that the first 11 amino acids are otherwise predicted by the gene sequence (cf. Fig. 1). At the first predicted cysteine, however, the yield dropped by ~10-fold, increased again for the next two amino acids (also predicted by the gene sequence), and fell again precipitously at the next predicted cysteine. The last amino acid reported is the histidine predicted to serve as the proximal ligand to the heme iron (7). These data demonstrate that both cysteine groups are largely blocked (>95%) in cytochrome rC552, at least partly by forming thioether bonds with the two vinyl groups of the heme, as is seen in normal cytochromes c (however, see below). The right column of Table I shows the yield of the individual amino acids from cytochrome rC557 as the sequencing reactions progress. The N-terminal sequence of cytochrome rC557 is identical to that of cytochrome rC552 (Table I), and in this particular sample, there is no detectable Cys(Cm)-cysteine, suggesting complete reaction of the cysteine-SH with the heme. In addition, overall amino acid compositions of both samples are consistent with the compositions predicted from the cycA sequence in pETC552 (data not shown). Fig. 5 shows electrospray mass spectra of native cytochrome c552 from T. thermophilus and recombinant cytochromes rC552 and rC557 obtained from E. coli. The ion spectrum of the native sample, recorded with a 10 mM NH4+-acetate solution, shows seven major ions ranging from 1847(8+) to 1059(14+) and a few very small peaks probably from impurities (spectrum not shown). The mass spectrum of native cytochrome c552 (isolated from Thermus cells) in aqueous solution has its primary peak at 14,771 Da followed by a ladder of peaks resulting from the binding of one to several Na+ ions (Fig. 5A). The predicted molecular mass of the molecule, based on the amino acid sequence of Titani et al. (48), after correcting for the formation of an N-terminal pyroglutamate residue (14,157 Da) and adding 617 Da for the iron-protoporphyrin IX, is 14,774 daltons. The difference between the predicted and observed values is just outside the expected error limits of ± 2 Da, but this is not pursued further here. There is no evidence for apoprotein in the mass spectrum recorded on a broader scale (not shown). Furthermore, dissolving the protein in a highly denaturing solvent prior to recording the ion spectrum (see below) reveals no apoprotein (not shown). This is to be expected if all the heme in the sample is covalently bound to the protein. The electrospray ion spectrum of cytochrome rC552, recorded from a solution of 10 mM NH4+-acetate, consists of only two major peaks at 2483(6+) and 2128(7+) and a minor peak at 1862(8+). The mass spectrum of cytochrome rC552 (Fig. 5B) reveals a relatively small peak is at 14,858, a dominant peak at 14,890 Da, and a lesser peak at 14,910 Da, the latter corresponding to the binding of one Na+ ion to the 14,890-Da material. A broader reconstruction of the mass spectrum from the ion spectrum failed to reveal the presence of apoprotein (14,245 Da). The predicted molecular mass for rC552 is 14,245 + 617 = 14,862 daltons which may correspond to the relatively small peak at 14,858 Da, although it is just outside the error limits of ± 2 Da. The most likely explanation of the mass spectrum is that 1-3 water molecules remain tightly bound to this protein even after the ionization/evaporation event of the electrospray experiment. This notion is supported by the observation that when cytochrome rC552 is diluted into the strongly denaturing solvent (cf. Ref. 42), 30% formic acid, 60% isopropyl alcohol, 10% water, the majority peak is shifted from 14,890 in water to 14,875 Da (Fig. 5C). This 15-Da decrement is assigned to the loss of a single water molecule. Interestingly, the peak at 14,890 Da remains in Fig. 5C, but at reduced intensity, suggesting that the water is quite tightly bound to the protein. In contrast to native cytochrome c552, dissolution in the denaturing solvent produces a small amount of material (~5%) appearing at 14,245 Da that corresponds to the predicted mass of the apoprotein. This is consistent with the finding that ~4-5% of the cysteine residues in this fraction are not covalently attached to heme (Table I). A reconstruction of the mass spectrum over the range 10-50 kDa (not shown) reveals only a weak band at 29,724 Da, which is assigned to cytochrome rC557. As shown in Fig. 5D, the mass spectrum of cytochrome rC557 in aqueous solution reveals a single peak at 14,858 Da which is very close to that predicted from the gene sequence plus one iron-protoporphyrin IX (14,862 Da). However, this is not the dominant species in the mass spectrum (see below). As with the rC552 protein, there is no evidence for apoprotein in this sample. Similarly, while the ion spectrum (not shown) changes dramatically on dissolution of the protein into the denaturing solvent, the reconstructed spectrum in this range (not shown) is essentially the same as that obtained in aqueous solution (see below). Also, there is no evidence for formation of apoprotein upon denaturation, confirming the N-terminal sequence data, which shows that essentially all the heme in rC557 is covalently bound (Table I). The monomeric species in the mass spectrum of
rC557 (Fig. 5D) represents only a
very small fraction of the protein reaching the mass detector. Instead,
the protein appears to oligomerize. The molecular ion spectrum of
cytochrome rC557 is shown in Fig. 6 and, as
noted above, is very different from that of cytochrome rC552. Here there are 12 ions ranging from
1982.0 (15+ on the dimer) to 1144.0 (est. 26+ on the dimer) occurring
in unit charge steps. A broad scale reconstruction of the mass spectrum
using the program Bio-MultiView reveals peaks at n × 14,858, where n appears to increase without bound. Thus,
there is an extremely small peak at 14,858 Da (that shown in Fig.
5D), a strong peak at 29,716 Da, a much weaker peak at
44,575 Da, followed by a stronger peak at 59,433 Da, a weak peak at
74,291 Da, and so on. The molecular ion spectrum, however, supports
only the presence of dimers. This can be seen, for example, by using
the formula Mapp = [((m/z) × z) To further test for the presence of multimers in aqueous solutions of rC557, samples were subjected to gel electrophoresis under nondenaturing conditions. Fig. 4C shows reversed polarity electrophoresis at pH 4.5 in 15% acrylamide gel (46). In the left lane, the native cytochrome c552 from Thermus shows essentially a single band (and a minor impurity), and the recombinant rC552 fraction (central lane) shows a dominant single band with electrophoretic mobility very similar to that of native protein and a weak band of lesser mobility. In the case of rC557 (right lane), only a weak band is observed at the mobility of native and rC552 proteins, but it shows a strong band with approximately the same electrophoretic mobility as the weak band in rC552. Were there a mixture of dimers, tetramers, etc., these would appear as a ladder of bands, which is not the case. Thus, as anticipated from the electrospray and gel filtration observations, this experiment indicates that "as isolated" rC557 exists predominantly as a homodimer, whereas rC552 exists primarily as a monomer, with the possibility of some dimer formation (see middle lane in Fig. 4C). The major features in the visible absorption spectra of oxidized and
reduced native cytochrome c552 and recombinant
cytochromes rC552 and
rC557 are presented in Figs.
7 and 8 and
summarized in Table II; the visible
peak(s) in the pyridine hemochrome spectrum is also included (in
parentheses). The native protein has Soret maxima at 409 nm
(oxidized) and 417 nm (reduced), and the reduced protein shows the
Some of the spectral differences are better visualized in the second
derivative absorption spectra of the Soret (oxidized and reduced) and
visible (reduced) regions, as shown in Fig. 8. This presentation
defines the Soret absorption maxima mentioned above and illustrates the
characteristic splitting of the The pyridine hemochrome (phc) spectra of native cytochrome
c552 and recombinant cytochromes
rC552 and rC557 are shown
in Fig. 9, A and B.
These provide additional insight into the origin of the spectral
differences described above. In the Soret region, the native
Thermus cytochrome c552 shows a
single band at 413 nm, whereas cytochrome rC552
shows a somewhat broader band near 415 nm with a distinct shoulder near
433 nm. The cytochrome rC557 fraction shows the
major peak near 416 nm, being approximately as broad toward the blue as
the rC552 spectrum but having distinctly less of
the 433 nm material evident toward the red. In the visible region (Fig.
9B), the phc spectrum of native Thermus
cytochrome c552 shows a
The absorption spectra indicate the presence of some non-heme C material in the recombinant cytochrome c preparations. As noted above, essentially all the heme in both fractions is covalently bound, as confirmed by the ability of acid-acetone extraction (63) to remove only traces of color from the rC552 protein (data not shown). Some heme could be removed from rC552 by the silver sulfate method of Paul (64) (provided the protein was first dialyzed against dilute acetic acid to remove chloride), as indicated by the fact that the phc spectrum of the resulting extract was similar to that of starting material (not shown). However, treatment of the extracted heme by the method of Grinstein (65), which simultaneously removes the iron and produces the dimethyl ester, reveals only the presence of protoporphyrin IX (as evidenced by the characteristic four-line spectrum with peaks at 505, 538, 577, and 625 nm (65). We will defer identification of this material until it can be separated from the protein in a form suitable for chromatographic purification (Ref. 66; however, see "Discussion"). The above results show that the cytochrome rC552
obtained from E. coli is not a "molten image" (Psalms
106:19) of native cytochrome c552. However, the
data of Fig. 10 show that cytochrome
rC552 is an excellent substrate for cytochrome
ba3, having ~85% of native c552 activity, while cytochrome
rC557 is quite a poor substrate, having only
~5% of native cytochrome c552 activity. Thus,
when used as a substrate for Thermus cytochrome
ba3, we obtain the following Michaelis-Menten
parameters: native cytochrome c552 has
Vmax = ~70 s
Cytochrome c synthesis in E. coli is a complicated process that appears to accommodate only certain foreign cytochrome c genes, and there are few examples of successful expression. While we were surprised that E. coli bearing pETC552 produced such high levels of holocytochrome c552, our enthusiasm has been tempered by the knowledge that this cytochrome is actually a complicated mixture of different forms. Identification of the structural gene for the cytochrome c in the same operon with an ABC transporter was also an unexpected finding. We will first deal with the implications of cycB. The currently suggested function of the ABC transporters in cytochrome c maturation is to selectively transport protoheme IX from the cytosol into the periplasmic space and to bring it into contact with a specific apocytochrome c, and Thöny-Meyer (11) has pointed out that the CcmB component of the ABC transporter (not yet identified in Thermus) may contain a heme binding site. Among the currently known genes involved in cytochrome c maturation, none is transcribed as part of an operon that includes the cytochrome c structural gene (11). While further work is needed to establish involvement of this ABC transporter component in Thermus cytochrome c biosynthesis, our finding of an operon that encodes both the structural gene of the cytochrome c and a component of the ABC transporter strongly suggests that the latter is involved in the maturation process. We turn now to the cytochrome c expressed in E. coli. As reported by Titani et al. (48), the mature
holocytochrome c552 isolated from T. thermophilus has a blocked N terminus, probably a pyroglutamate.
The DNA sequence reveals that the cytochrome is synthesized in
Thermus cells as a pre-protein having an N-terminal signal
peptide. The sequence of this signal peptide,
(M)K+R+TLMAFLLLGGLALA The truncated cycA gene in pETC552 begins with the sequence MAQ followed by the sequence of the mature protein. In both fractions, the N-terminal Met is completely removed. As evidenced by the absence of heme-free protein in our preparations, essentially all of the cytochrome c apoprotein that is synthesized appears to react with protoheme IX. This is occurring in the cytoplasm and is thus consistent with the idea of Sambongi and Ferguson (33), that a properly folded and reduced apoprotein can react spontaneously with protoheme IX to form the thioether linkages of heme C. However, there would appear to be two folding paths, one of which results in monomeric rC552 and the other dimeric rC557. In addition, part of the heme in both fractions is chemically modfied (see below). The expression system yields ~3 mg of purified cytochrome
rC552 and ~0.8 mg of cytochrome
rC557 per liter of culture medium. This level of
production is adequate to obtain the quantities of material required
for most modern biophysical studies. However, because there are several
cytochrome c related products in the final protein
solutions, the use of this material will be somewhat restricted. The
majority species in fraction rC552 appears to be
a "native-like" cytochrome c. Because
rC552 lacks the "split- The most important complication is that the cytochrome rC552 contains a significant amount of non-heme C chromophore. While the atomic structure of this chromophore remains to be determined, we know the following from our current data. The material is covalently attached to the protein, probably at the cysteine residues; it has a molecular mass very close to that of protoheme IX (within ±3-4 Da); it is removed from the protein under the same conditions that remove the protoheme IX, namely reaction with Ag+ ions; either it does not survive the strongly acidic conditions needed to remove the iron from protoporphyrin IX, or it does not release its Fe under these conditions9; it is redox active and accounts for ~30-40% of the oxidizing equivalents in the sample while heme C accounts for the remainder10; and it reacts with hydrazine at elevated temperatures to create a new chromophore having an absorption band at 602 nm.11 Unfortunately, we have not found growth conditions that suppress formation of this material. Fortunately, the unusual heme is not a serious impediment to examining the steady-state kinetic/proton translocation properties of cytochrome ba3. Thus, on a per milligram protein basis, the rC552 protein is ~85% as active as native cytochrome c552, suggesting that the protein molecules to which the unusual heme is bound are at least partially active. Alternatively, the change from the neutral N-terminal pyroglutamate to the positively charged N-terminal Ala may affect the interaction with cytochrome ba3. While not perfect, the expression system, as it is currently used, will provide the substrate needed for many functional studies with cytochrome ba3 that were not previously feasible. What is the nature of the non-heme C material? Barker and co-workers (71, 72), in attempting to transmute cytochromes b to cytochromes c by the judicious placement of cysteine residues near the heme, discovered a noncovalently attached green heme in their recombinant preparations, which they recently identified as iso-spirographis heme, in which the 4-vinyl of protoheme IX is oxidized to a formyl group.12 The unusual heme is thought to form, during expression in E. coli, by a heme-mediated oxidation of its own vinyl group when in close proximity to the free thiol group of the protein (71). The pyridine hemochrome spectrum of the free iso-spirographis heme has absorption maxima at 434, 538, and 582 nm (73), while the pyridine hemochrome spectrum of the unusual heme in fraction rC552 shows absorption bands near 433 nm and at 576 nm. Because the electrospray spectra show essentially one protein species, the non-C heme material has a molecular mass very close to that of protoheme IX. A mono-formyl heme would have a mass only 2 Da larger than protoheme, a difference that would not be resolved in our spectra. This and the similarity of the phc spectra support a working hypothesis that the unusual chromophore is a "formyl" heme. The N-terminal sequences and mass spectral data indicate that the unusual heme is covalently attached to the protein in a manner that protects both cysteine residues from reacting with iodoacetate, perhaps as a thiohemiacetal bond. Efforts are currently underway to separate this material from the true recombinant cytochrome c552 and to characterize it by a combination of resonance Raman, high resolution NMR, EPR, and other techniques. The third interesting product of the gene expression system is the
rC557 fraction. All the analytical results
indicate that the two proteins are identical in composition, but the
red-shifted Sosnick et al. (74) have rationalized biphasic ("fast" and "slow") folding in horse heart cytochrome c, with the fast phase due to molecules having the heme properly coordinated in the unfolded state (His-14 and Met-80), while the slow phase is due to molecules that have suffered "adventitious misorganization in early chain condensation" caused by non-native ligation of the heme in the unfolded state (either His-26 or His-33). The presence of rC557 in our preparations can be explained by the scheme of Sosnick et al. (74) if a portion of the molecules is improperly coordinated in the unfolded state (His-16 and possibly His-33, Met-64, or His-87 in place of Met-70), followed by thermodynamic trapping in this state by formation of a dimer. Bryngelson et al. (75) have pointed out that misligation during cytochrome c folding would introduce considerable roughness into the energy landscape for the folding of this protein, which otherwise appears to be quite smooth. The low activity of rC557 as a substrate for cytochrome ba3 suggests that the dimer interface involves a portion of the surface area that normally interacts with the oxidase. Once the structural coordinates are made available (7), it may be possible to deduce the structure of this dimer. A fourth complication is that the rC557 fraction also contains unusual heme, though by comparison with the rC552 fraction, at a much lower level. In summary, thermostable cytochromes c can be expressed heterologously in E. coli cells, but the resulting product is not the desired mature, homogeneous holoprotein. Indeed, there appears to be a multiplicity of closely related products, some of which, at least, perform the expected biological function.
We thank Dr. Gary Siuzdak and his staff at TSRI for helpful discussions, Dr. Steve Marsh at Cal Tech for sequencing the PCR product, Dr. Claire Slutter for assistance in the initial design of the PCR primers, Drs. Grant Mauk and Kevin Smith for valuable advice regarding the non-heme C material, Dr. Graham Palmer for bringing the work of Sutherland and Klein (79) to our attention, and Professor Jack Richards of CalTech for his general interest in and support of this project.
* This work was supported by National Institutes of Health Grant GM35342 (to J. A. F.). This work was taken in part from the Ph.D. thesis of J. A. K. Electrospray ionization mass spectrometry was carried out by the staff of the Mass Spectroscopy Facility at the Scripps Research Institute with support from the Lucille P. Markey Charitable Trust and an National Institutes of Health Shared Instrumentation Grant RR07273.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M93437.
1
The abbreviations used are: PCR, polymerase
chain reaction; nt, nucleotide; ABC, ATP-binding cassette; phc,
pyridine hemochrome; IPTG,
isopropyl-
2 A significant effort was made to detect an RNA transcript in Thermus cells containing both cycA and cycB using Northern analyses (36). By rapidly cooling Thermus cells grown at 70 °C to ice temperature, we were able to detect very low levels of an RNA molecule that bound an oligonucleotide probe specific for cycA but could not detect any RNA using an oligonucleotide probe specific for cycB (J. A. Fee, J. A. Keightley, and D. Sanders, unpublished results).
3 J. A. Keightley, unpublished observations.
4
The
5
Cytochromes c from certain protozoa
(81, 82) and C14A human cytochrome c expressed in yeast (83)
show
6 J. A. Fee, I. McLaughlin, T. R. Todaro, and D. Sanders, manuscript in preparation.
7 K. Bren, J. A. Fee, et al., unpublished observations.
8 P. Williams, D. McRee, E. Stura, and J. A. Fee, unpublished observations.
9 A. Pastuszyn and J. A. Fee, unpublished data.
10 T. Todaro and J. A. Fee, unpublished data.
11 J. A. Fee, unpublished results.
12 G. Mauk, personal communication.
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||