JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaffner-Reckinger, E.
Right arrow Articles by Kieffer, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaffner-Reckinger, E.
Right arrow Articles by Kieffer, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 20, 12623-12632, May 15, 1998


Distinct Involvement of beta 3 Integrin Cytoplasmic Domain Tyrosine Residues 747 and 759 in Integrin-mediated Cytoskeletal Assembly and Phosphotyrosine Signaling*

Elisabeth Schaffner-ReckingerDagger , Valérie Gouon, Chantal Melchior, Sébastien Plançon, and Nelly Kieffer§

From the Laboratoire Franco-Luxembourgeois de Recherche Biomédicale (CNRS and CRP-Santé), Centre Universitaire, 162A, avenue de la Faïencerie, L-1511 Luxembourg, Grand Duchy of Luxembourg

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

We have investigated the structural requirements of the beta 3 integrin subunit cytoplasmic domain necessary for tyrosine phosphorylation of focal adhesion kinase (FAK) and paxillin during alpha vbeta 3-mediated cell spreading. Using CHO cells transfected with various beta 3 mutants, we demonstrate a close correlation between alpha vbeta 3-mediated cell spreading and tyrosine phosphorylation of FAK and paxillin, and highlight a distinct involvement of the NPLY747 and NITY759 motifs in these signaling processes. Deletion of the NITY759 motif alone was sufficient to completely prevent alpha vbeta 3-dependent focal contact formation, cell spreading, and FAK/paxillin phosphorylation. The single Y759A substitution induced a strong inhibitory phenotype, while the more conservative, but still phosphorylation-defective, Y759F mutation restored wild type receptor function. Alanine substitution of the highly conserved Tyr747 completely abolished alpha vbeta 3-dependent formation of focal adhesion plaques, cell spreading, and FAK/paxillin phosphorylation, whereas a Y747F substitution only partially restored these events. As none of these mutations affected receptor-ligand interaction, our results suggest that the structural integrity of the NITY759 motif, rather than the phosphorylation status of Tyr759 is important for beta 3-mediated cytoskeleton reorganization and tyrosine phosphorylation of FAK and paxillin, while the presence of Tyr at residue 747 within the NPLY747 motif is required for optimal beta 3 post-ligand binding events.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Anchorage of cells to the extracellular matrix is mediated in part by integrins, a large family of heterodimeric cell surface receptors, that regulate numerous aspects of cell behavior, such as cell motility, proliferation, differentiation, and apoptosis (1). Cell engagement with extracellular matrix ligands induces integrin translocation to subcellular structures known as focal adhesion plaques that form at regions of close contact between the cell and its underlying substratum (2). Integrin clustering at focal contact sites in turn triggers major intracellular events, including cytoskeleton reorganization, intracellular ion transport, phosphoinositide turnover, kinase activation, and tyrosine phosphorylation of intracellular proteins (3). A large number of tyrosine-phosphorylated proteins have been identified within focal adhesion plaques. These include cytoskeletal proteins, kinases and adaptor proteins, growth factor receptors, and growth factor receptor-related signaling molecules, thus emphasizing the potential role of integrins as recruiting centers for molecules involved in various signaling pathways.

Although the link of integrins with focal adhesions is well established, the precise mechanism by which integrins associate with cytoskeletal proteins, regulate focal adhesion plaque assembly, and participate in the activation of intracellular signaling cascades is still unclear. There is convincing evidence that integrin beta subunits are likely to play a major role in these processes: (i) truncation of the beta  subunit cytoplasmic domain impairs integrin recruitment to focal contacts (4-6), and (ii) information contained in beta  subunit cytoplasmic tails coupled to the transmembrane and extracellular domains of the interleukin-2 receptor is sufficient to target these chimeric receptors to focal contacts (7) and to activate the focal adhesion kinase (FAK)1 signaling pathway (8). Based on mutational analysis of the cytoplasmic domain of the beta 1 integrin, three motifs have been identified that are important for the recruitment of integrins to adhesion plaques; these motifs correspond to the highly conserved acidic membrane-proximal domain and to two C-terminal NPXY motifs (6, 9), which constitute typical recognition sites for tyrosine kinases and adaptor proteins (10). Subsequent complementary studies (based on a combination of deletion analysis, single amino acid substitution, and the use of cytoplasmic domain synthetic peptides) have provided evidence that these highly conserved cytoplasmic motifs in the various integrin beta  subunits have similar functional properties (11-16) and display overlapping binding sites for the structural cytoskeletal proteins alpha -actinin and talin, the adaptor protein paxillin, as well as regulatory proteins including FAK, integrin-linked kinase-1 (ILK-1) (17), beta 3-endonexin (18), Shc, Grb2 (19), and integrin cytoplasmic domain-associated protein-1 (ICAP-1) (20).

The importance of tyrosine phosphorylation of focal adhesion proteins during focal contact formation is well established as tyrosine kinase inhibitors prevent the organization of focal adhesion plaques and stress fibers (21), and treatment of cells with cytochalasin B or D, which block actin polymerization, inhibits tyrosine phosphorylation of FAK and paxillin (22). In contrast, the precise mechanisms by which integrin beta  subunits trigger tyrosine phosphorylation of focal adhesion proteins during integrin-dependent cell attachment and spreading are less well understood. In an attempt to identify amino acids of the beta 3 cytoplasmic domain involved in the phosphotyrosine signaling cascade induced by beta 3 integrins, Tahiliani et al. (23) have expressed various mutant beta 3 cytoplasmic domains as separate tails connected to an extracellular reporter protein. Using this approach, they deliberately excluded the role of upstream events, such as integrin-dependent ligand binding, cell adhesion, and cell spreading, in triggering the FAK signaling cascade (23). In the present study, we have used an alternative approach to investigate the structural requirements of the beta 3 subunit cytoplasmic domain necessary to stimulate intracellular tyrosine phosphorylation during cell spreading. By expressing various human beta 3 integrin cytoplasmic domain mutants, which either promote or inhibit alpha vbeta 3-dependent CHO cell spreading, we demonstrate a close correlation between a structurally conserved beta 3 integrin cytoplasmic tail, cell spreading and FAK/paxillin phosphorylation, as all C-terminal truncation mutants unable to induce cell spreading, also failed to trigger tyrosine phosphorylation. Our data further highlight major differences in the involvement of the cytoplasmic domain tyrosine residues in beta 3-mediated post-ligand binding events. The presence of residue Tyr759 in the membrane-distal NITY759 sequence is not necessary for beta 3-mediated focal contact formation, cell spreading, and beta 3-triggered tyrosine phosphorylation of FAK or paxillin, whereas residue Tyr747 of the membrane-proximal NPLY747 motif is required for optimal alpha vbeta 3 receptor function. And finally, both the NPLY747 and NITY759 motifs contribute in defining the appropriate beta 3 cytoplasmic domain conformation necessary for post-ligand binding signaling events.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cell Culture

The Chinese hamster ovary (CHO) cell line CRL 9096, defective in the dihydrofolate reductase gene (CHO dhfr-), was purchased from the American Type Culture Collection (Rockville, MD). The cells were grown in Iscove's modified Dulbecco's medium (IMDM) (Life Technologies, Inc., Merelbeke, Belgium), supplemented with glutamine, penicillin, and streptomycin, 10% heat-inactivated fetal calf serum (complete IMDM), and, when required, hypoxanthine (100 µM) and thymidine (10 µM). The cells were routinely passaged with EDTA buffer, pH 7.4 (1 mM EDTA, 126 mM NaCl, 5 mM KCl, 50 mM Hepes).

Antibodies and Purified Adhesive Proteins

The following polyclonal or monoclonal antibodies were purchased: anti-alpha v from Life Technologies (24), anti-phosphotyrosine (PY-20), anti-paxillin and anti-FAK from Transduction Laboratories (Lexington, KY), and the polyclonal anti-FAK antibody (C-903) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The monoclonal antibody 4D10G3 (anti-human beta 3) was a generous gift of Dr. D. R. Phillips (COR Therapeutics, South San Francisco, CA). Monoclonal antibodies 13C2 (anti-human alpha v) and 23C6 (anti-alpha vbeta 3) were kindly provided by Dr. M. Horton (Bone and Mineral Centre, The Middlesex Hospital, London, United Kingdom), monoclonal antibody P37 (anti-human beta 3) by Dr. J. Gonzalez-Rodriguez (Instituto de Quimica Fisica, Madrid, Spain), and the blocking monoclonal antibody MA-16N7C2 (anti-human beta 3) by Dr. M. Hoylaerts (Centre for Molecular and Vascular Biology, University of Leuven, Leuven, Belgium). Purified human fibrinogen and bovine serum albumin (BSA, fraction V) were purchased from Sigma (Bornem, Belgium).

Construction of Mutant beta 3 Integrin cDNA

The full-length cDNA encoding wild type beta 3 was inserted into the 5'-EcoRI/EcoRV-3' site of the expression vector pBJ1 as described previously (25). The beta 3Y747A and beta 3Y747F mutations were introduced in the full-length beta 3 cDNA by site-directed mutagenesis using the Altered SitesTM in vitro mutagenesis kit (Promega, Lyon, France). Briefly, full-length cDNA encoding wild type beta 3 was cloned into the phagemid pALTER-1, and the mismatched primers 5'-GCCAACAACCCACTGGCTAAAGAGGCCACG-3' (beta 3Y747A) and 5'-GCCAACAACCCACTGTTTAAAGAGGCCACGTCGACCTTC-3' (beta 3Y747F) (Eurogentec, Seraing, Belgium) used for the generation of the mutant constructs. Primer beta 3Y747F allowed the generation of a new SalI restriction site (GTCGAC) in addition to the point mutation. Mutagenesis was performed according to the manufacturer's instructions. The full-length mutated beta 3 cDNA was finally excised from the pALTER phagemid with 5' XbaI/HindIII 3' and inserted into the XbaI/HindIII site of the pBJ1 mammalian cell expression vector. The cDNAs encoding the mutant beta 3Y759A, beta 3Y759F, beta 3Y747A/Y759F, beta 3Delta 754, beta 3Delta 744, and beta 3Delta 722 subunits were generated by excision of the 3' end of the full-length beta 3 coding sequence, starting at the BamHI site at nucleotide position 1501 of the published beta 3 cDNA sequence for mutant beta 3Delta 722 and starting at the EcoRI site at nucleotide position 2274 for the other mutants. The excision was followed by an insertion of a BamHI-EcoRV or an EcoRI-EcoRV cassette, obtained by oligonucleotide-directed polymerase chain reaction (PCR) mutagenesis. The nucleotides used to generate the cassette were purchased either from Genset (Paris, France) or from Eurogentec. The upstream primer (sense) for the beta 3Y759A, beta 3Y759F, and beta 3Y747A/Y759F mutant constructs was a 23-mer corresponding to the beta 3 nucleotide sequence 2023-2045: 5'-GTGAAAGAGCTTAAGGACACTGG-3'. The upstream primer (sense) for the beta 3Delta 754 and beta 3Delta 744 mutant constructs was a 26-mer corresponding to the beta 3 nucleotide sequence 2264-2290: 5'-CGACCGAAAAGAATTCGCTAAATTTG-3' comprising an EcoRI restriction site (GAATTC). The upstream primer (sense) for the beta 3Delta 722 mutant construct was a 22-mer corresponding to the beta 3 nucleotide sequence 1497-1518: 5'-GCTGGGATCCCAGTGTGAGTGC-3' comprising a BamHI restriction site (GGATCC). All downstream primers (antisense) contained a stop codon followed by an EcoRV restriction site (GATATC). The following downstream primers were used: 5'-CTTAAGCTTGATATCCTAGTTACTTAAGTGCCCCGGGCCGTGATATTGG-3' (beta 3Y759A); 5'-CTTAAGCTTGATATCCTAGTTACTTAAGTGCCCCGGAACGTGATATTGG-3' (beta 3Y759F and beta 3Y747A/Y759F); 5'-CTTAAGCTTGATATCCTAGTTACCTAGGTAGACGTGGCCTCTTTATAC-3' (beta 3Delta 754); 5'-CTTAAGCTTGATATCCTAGTTACCTAGTTGGCTGTGTCCCATTTTGC-3' (beta 3Delta 744); 5'- CTTAAGCTTGATATCCTAGTTACCTAGATGGTGATGAGGAGTTTCCAG -3' (beta 3Delta 722). For beta 3Y759A, beta 3Y759F, beta 3Delta 754, beta 3Delta 744, and beta 3Delta 722 constructs, pBJ1 beta 3wt plasmid was used as a template for cDNA amplification, while the beta 3Y747A/Y759F mutant was generated using the plasmid pBJ1 beta 3Y747A. For the beta 3Delta 722 mutant construct, the PCR-amplified fragment was purified, digested with BamHI and EcoRV, and inserted into the pBJ1 beta 3 plasmid from which the wild type BamHI-EcoRV fragment had been removed. For all the other mutant constructs, the PCRamplified fragments were digested with EcoRI and EcoRV after purification and inserted into the pBJ1 beta 3 plasmid from which the wild type EcoRI-EcoRV fragment had been removed. Each mutant beta 3 construct was verified by dideoxy sequencing using the 26-mer corresponding to the beta 3 nucleotide sequence 2264-2290 as a 5' primer.

Transfection and Selection of Stable Cell Clones

Full-length beta 3 cDNA in pBJ1 vector (20 µg) and 1 µg of dihydrofolate reductase plasmid (pMDR901) were mixed with 40 µg of LipofectAMINE (Life Technologies, Inc.) in a final volume of 200 µl of IMDM and added to CHO dhfr- cells grown to 60% confluence in 100-mm tissue culture plates. After 24 h, fetal calf serum was added to the culture medium and 48 h after transfection, the cells were grown in nucleoside-free alpha -minimal essential medium (Life Technologies, Inc.) used as selective medium. Positive transfectants were analyzed for cell surface expression of the recombinant human integrin beta 3 subunit using the anti-beta 3 monoclonal antibody P37 and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse secondary antibody (Caltag Laboratories, Burlingame, CA). Stably transfected cells were subcloned by limiting dilution and controlled for cell surface expression of the transfected beta 3 integrin subunit.

Immunofluorescence and Flow Cytometry

Surface expression of the transfected human beta 3 integrins was analyzed by flow cytometry using the monoclonal antibodies P37 (anti-human beta 3), 13C2 (anti-human alpha v), and 23C6 (anti-alpha vbeta 3). Selected transfectants were detached from culture plates with EDTA buffer, pH 7.4, and washed twice in phosphate-buffered saline (PBS) (136 mM NaCl, 2.7 mM KOH, 8 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4). The cells (5 × 105) were then incubated for 30 min on ice with the primary antibody, washed with PBS, and further incubated for 30 min on ice with a FITC-conjugated goat anti-mouse secondary antibody. Cells were washed and resuspended in PBS and then analyzed on an Epics Elite ESP flow cytometer (Coulter Corp., Hialeah, FL).

Reverse Transcriptase-PCR of mRNA and cDNA Sequencing

Total RNA was isolated from 5 × 106 transfected cells according to the method of Chomczynski and Sacchi (26). First strand cDNA synthesis from 2 µg of total RNA was performed with the Perkin-Elmer RNA-PCR kit using oligo(dT) as a primer. The coding sequence, corresponding to the cytoplasmic domain of the beta 3 integrin subunit was amplified using specific primers. The amplified products were analyzed by agarose gel electrophoresis and directly sequenced using the fmolTM DNA sequencing kit (Promega).

Ligand Coating of Latex Beads and Cell-Bead Attachment Assay

For cell-bead attachment assay, 200 µl of polystyrene 3-µm beads (Sigma) were washed twice in distilled H2O, and resuspended in 1 ml of 0.1 M bicarbonate coating buffer, pH 9. Ligand coating was performed by adding fibrinogen or BSA to the beads at a final concentration of 100 µg/ml. The beads were rotated for 1 h at room temperature, washed once in PBS, and blocked with 0.1% BSA in IMDM for 2 h at room temperature. The beads were finally washed twice and resuspended in IMDM. For the cell-bead attachment assay, CHO cells were detached with EDTA buffer, washed twice, and resuspended in serum-free IMDM. After a preincubation of 45 min at room temperature in the presence or absence of either 500 nM echistatin or 1.5 µg of the monoclonal antibody MA-16N7C2, the cells (4 × 104) were added to individual wells of 96-well microtiter plates precoated overnight at 4 °C with poly-L-lysine (Sigma) at 100 µg/ml in IMDM, and allowed to settle for 1 h at 37 °C. The freshly prepared ligand-coated beads were then added to the wells at a 50:1 bead-to-cell ratio. After a further 45-min incubation at 37 °C with gentle shaking, the unbound beads were removed with six washes in IMDM. Microphotographs were then taken of the cells (magnification, ×300) using a Nikon invertoscope equipped with phase contrast.

Cell Adhesion Assay

Adhesion assays were carried out as described previously with minor modifications (27). Briefly, cultured cells were detached with EDTA buffer, washed twice, and resuspended in serum-free IMDM. The cells (3 × 104) were then added to individual wells of 96 well-microtiter plates coated with fibrinogen at 20 µg/ml in serum-free IMDM overnight at 4 °C, and cell attachment was allowed to occur at 37 °C. For time-course experiments, the cells in the individual microtiter wells were microphotographed at different time points without prior washing of the plates or discharge of nonadherent cells. Quantitation of spread fibroblastoid cells versus non-spread round cells was performed on the micrographs according to cell morphology. For each time point, approximately 200 cells were counted and the data reported as mean percent of three independent experiments performed in triplicate.

Cell Spreading and Immunofluorescence Staining of Focal Adhesion Plaques

Intracellular immunofluorescence staining of adherent cells was performed using eight-well glass chamber slides (Lab-Tek, Nunc International, Naperville, IL) precoated overnight at 4 °C with 20 µg/ml of fibrinogen in serum-free IMDM. The cultured cells were detached with EDTA buffer, washed twice with IMDM, and incubated overnight in individual compartments of the chamber slides. The cells were fixed for 15 min at 4 °C with 3% paraformaldehyde, 2% sucrose in PBS, pH 7.4, rinsed twice with PBS, and permeabilized with labeling buffer (0.5% Triton X-100, 0.5% BSA in PBS, pH 7.4) for 15 min at room temperature. Immunofluorescent staining was performed by incubating the glass slides for 30 min with a primary mouse monoclonal antibody to human beta 3 (P37) or to the alpha vbeta 3 complex (23C6) diluted in labeling buffer. After three washing steps, the glass slides were incubated for another 30 min with FITC-conjugated goat anti-mouse IgG in the presence or absence of 0.5 µg/ml phalloidin conjugated to tetramethylrhodamine isothiocyanate (TRITC, Molecular Probes, Eugene, OR). Negative controls were stained in the absence of the primary antibody. The slides were finally washed three times in labeling buffer and mounted in Mowiol 40-88/DABCO (Sigma). The specimens were examined with a Leica-DMRB fluorescence microscope using a 63 × oil immersion objective. Microphotograhs were taken using Ilford HP5 Plus 400 films (Ilford, Mobberley, United Kingdom).

Tyrosine Phosphorylation Assay

Petri dishes (100 mm) were coated overnight at 4 °C with 100 µg/ml of purified human fibrinogen in serum-free IMDM. The dishes were then blocked with 5 mg/ml BSA in serum-free IMDM for 1 h at 37 °C and finally washed twice with serum-free IMDM. Cultured cells were detached with EDTA buffer, carefully washed twice with serum-free IMDM, resuspended in IMDM, and either kept in suspension or added to the coated dishes in the presence or absence of 5 µM cytochalasin B (Sigma). After a 2-h incubation at 37 °C, nonadherent cells were sedimented at 1000 rpm for 10 min and lysed with the following lysis buffer: 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 5 mM EDTA, 10 mM NaF, 1 mM Na3VO4, 10 µg/ml pepstatin A, 3 mM phenylmethylsulfonyl fluoride. Adherent cells were lysed in situ with the same lysis buffer. Lysates were clarified by centrifugation at 12,000 rpm for 10 min at 4 °C, and the protein content determined with the Bio-Rad protein assay reagent (Bio-Rad, Nazareth, Belgium).

Immunoprecipitation and Western Blot Analysis

Preparation of Cell Lysates-- Cultured cells were detached with EDTA buffer, washed twice in cold PBS buffer, and lysed for 30 min in 300 µl of ice-cold lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 5 mM phenylmethylsulfonyl fluoride). Lysates were cleared by centrifugation at 12,000 rpm for 10 min at 4 °C, and the protein concentration was determined according to the method of Markwell (28).

Immunoprecipitation-- For each cell clone, equal amounts of protein lysate (1-1.5 mg of protein) were incubated for 1 h at 4 °C with either monoclonal antibody P37 (to human beta 3), or, for tyrosine phosphorylation assays, with polyclonal rabbit anti-FAK or monoclonal mouse anti-paxillin antibody. Immune complexes were precipitated by a 30-min incubation at 4 °C with protein A-Sepharose beads (75 µl of a 1:1 suspension in PBS). The beads were then washed three times with lysis buffer, and the precipitates recovered by boiling the beads in 30 µl of SDS sample buffer (125 mM Tris-HCl, pH 6.8, 4.6% SDS, 20% glycerol, 0.5 mg/ml bromphenol blue) either in the presence or absence of 1.4 M beta -mercaptoethanol.

Western Blot Analysis-- Immunoprecipitates or total cell lysates (50 µg of protein) were resolved by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto nitrocellulose using a semi-dry transblot apparatus (Amersham Pharmacia Biotech, Roosendaal, The Netherlands). The membranes were blocked for 1 h in blocking buffer (Tris-buffered saline (TBS) (20 mM Tris-HCl, pH 7.4, 137 mM NaCl) containing 0.1% Tween and either 1% BSA for tyrosine phosphorylation assays or 5% nonfat dry milk) and incubated overnight with the primary antibody diluted in blocking buffer. After several 5 to 10 min washes in TBS-Tween (TBS, pH 7.4, 0.1% Tween), the membranes were incubated for 1 h with sheep anti-mouse IgG conjugated to horseradish peroxydase (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom) in TBS-Tween containing 5% nonfat dry milk at pH 7.4. The membranes were then washed in TBS and bound antibody visualized using enhanced chemiluminescence (ECL) (Pierce) according to the manufacturer's instructions. After exposure to autoradiography films, the membranes prepared for tyrosine phosphorylation assays were stripped by a 30-min incubation at 50 °C in 50 ml of stripping buffer (62.5 mM Tris, pH 6.7, 2% SDS, 100 mM beta -mercaptoethanol) and then reprobed with a monoclonal antibody to either FAK or paxillin. For each experiment, the level of antibody binding was quantified by scanning densitometry and the results expressed as the ratio of phosphorylated FAK versus total immunoprecipitated FAK. The data for each cell clone were normalized to the ratio obtained for CHO beta 3wt cells adherent on fibrinogen (expressed as 100%).

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In order to determine how the beta 3 integrin cytoplasmic domain regulates integrin-dependent tyrosine phosphorylation during cell spreading, a series of beta 3 integrin subunit mutants were generated that either promote or fail to promote beta 3 integrin-dependent cell spreading (Fig. 1). After stable transfection of wild type or mutant beta 3 cDNA into CHO cells, cell clones were analyzed by flow cytometry for surface expression of the chimeric alpha v(hamster)beta 3(human) receptor, using monoclonal antibodies specific to human alpha v (13C2), human beta 3 (P37), and the alpha vbeta 3 complex (23C6). As shown in Fig. 2, all the cell clones selected for the present study revealed similar levels of cell surface expression of the chimeric alpha vbeta 3 receptor, except mutant beta 3Delta 722, for which only weak labeling could be observed, despite several successive transfection attempts. Western blot analysis of the expressed recombinant beta 3 subunit in each cell clone essentially confirmed the immunofluorescence data (Figs. 3 and 4A). Interestingly however, despite the weak surface expression of deletion mutant beta 3Delta 722, a band even stronger in intensity to that observed for wild type beta 3 could be demonstrated in CHO beta 3Delta 722 cells. The slightly increased electrophoretic mobility of deletion mutants beta 3Delta 744 and beta 3Delta 722 as compared with recombinant wild type beta 3 confirmed their smaller molecular size. Correct heterodimerization of endogenous alpha v with the human beta 3 subunit was demonstrated for each deletion mutant by immunoprecipitation experiments using the anti-human beta 3 antibody P37. As shown in Fig. 4B, two bands corresponding to alpha v and beta 3 were coprecipitated with similar intensities for all deletion mutants, including beta 3Delta 722. Finally, to confirm that each selected cell clone expressed the human beta 3 integrin subunit with the expected cytoplasmic mutation, mRNA was isolated from the transfected cell clones and transcribed into cDNA. The cDNA segment encoding the cytoplasmic domain was amplified using beta 3 specific primers, and the amplified segment sequenced (results not shown). Taken together, these data demonstrate that the selected cell clones express on their cell surface the recombinant beta 3 subunit with the expected mutation, and that an almost complete deletion of the cytoplasmic domain of the integrin beta 3 subunit (beta 3Delta 722) interferes with surface exposure of the preformed heterodimeric alpha vbeta 3Delta 722 integrin complex.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Amino acid sequence of the cytoplasmic domain of wild type and mutant beta 3 integrin subunits. The cytoplasmic amino acid sequence of beta 3, beginning with Lys716 of the published sequence is shown (46). Residues of the highly conserved NPLY747 and NITY759 motifs are indicated in bold letters. Mutants are named according to the position of their amino acid substitution or stop codon. For the deletion mutants, the position of the stop codon is indicated by the number of the corresponding amino acid. For the substitution mutants, the modified amino acid residue(s) are underlined.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Flow cytometry analysis of chimeric alpha vbeta 3 expression in CHO cells transfected with recombinant human beta 3. CHO cells, stably transfected with the beta 3 subunits listed in Fig. 1, were grown to confluence in complete IMDM, detached with EDTA buffer, washed twice, and resuspended in serum-free IMDM. The suspended cells were then labeled with saturating amounts of a primary monoclonal antibody to human alpha v (13C2), human beta 3 (P37), or to the alpha vbeta 3 complex (23C6) and stained with FITC-conjugated goat anti-mouse IgG. The ordinate depicts the number of cells per channel and the abscissa the relative fluorescence intensity in arbitrary units (log scale).


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 3.   Western blot analysis of recombinant beta 3 integrin substitution mutants expressed in CHO cells. Transfected CHO cells were grown to confluence in complete IMDM, detached with EDTA buffer, and washed twice in cold PBS buffer. Cell lysates were then prepared and protein concentrations were determined as described under "Experimental Procedures." Equal amounts of protein from mock- or beta 3-transfected CHO cells (50 µg) were resolved by 8% SDS-PAGE under non-reducing conditions, transferred to nitrocellulose, and immunoblotted with a monoclonal antibody to human beta 3 (4D10G3). Platelet lysate (5 µg of protein) was run in parallel as a positive control. Asterisk (*) denotes a nonspecific band observed with CHO cell lysates.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4.   Immunoprecipitation and Western blot analysis of recombinant beta 3 integrin deletion mutants expressed in CHO cells. Transfected CHO cell lysates were prepared as described in the legend of Fig. 3. A, the detergent extracts of mock-transfected CHO cells and positive beta 3 transfectants (50 µg of protein) were resolved by 5.5% SDS-PAGE under non-reducing conditions. The band corresponding to the human beta 3 integrin subunit was visualized by immunoblotting with the monoclonal antibody 4D10G3. B, detergent extracts of mock-transfected CHO cells and positive beta 3 transfectants (1 mg of protein) were used for immunoprecipitation with a monoclonal antibody to human beta 3 (P37). The precipitates were resolved by 8% SDS-PAGE under reducing conditions, transferred to nitrocellulose, and visualized with a monoclonal antibody to alpha v (24), reacting with hamster and human alpha v, and with the monoclonal antibody 4D10G3, reacting exclusively with human beta 3. The strong band with the apparent molecular mass of 50 kDa in panel B corresponds to precipitated mouse IgG heavy chain. Platelet lysate (5 µg of protein) was run in parallel as a positive control.

alpha vbeta 3-mediated CHO Cell Binding to Immobilized Fibrinogen Is Not Impaired by beta 3 Cytoplasmic Domain Mutations-- In order to determine whether the selected beta 3 mutants retained the ability to interact with immobilized fibrinogen, a cell binding assay was performed using fibrinogen or BSA-coated polystyrene beads. When CHO beta 3wt cells were tested, they were completely covered with fibrinogen-coated beads and had a "morula" type appearance. In contrast, when the cells were incubated with BSA-coated beads, no binding of the beads to the cells could be observed. The binding of fibrinogen-coated beads was RGD-dependent, since it could be specifically blocked with the disintegrin echistatin or the blocking anti-human beta 3 monoclonal antibody MA-16N7C2 known to contain an RGD sequence in its CDR3 domain (29) (Fig. 5A). Interestingly, all the mutant cell clones studied bound the fibrinogen-coated beads to a similar extent as CHO beta 3wt cells, demonstrating that the beta 3 cytoplasmic domain mutations did not impair alpha vbeta 3 receptor-ligand interaction (Fig. 5B).


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 5.   Binding of fibrinogen-coated beads to CHO transfectants. Washed beta 3-transfected CHO cells were allowed to settle onto poly-L-lysine-coated 96-well microtiter plates and were further incubated under gentle shaking with fibrinogen- or BSA-coated polystyrene beads. After 45 min at 37 °C, the microtiter plates were washed six times and microphotographs were taken of the cells (original magnification, ×300). Ligand inhibition assays were performed by preincubating the cells in suspension with either 500 nM echistatin or 1.5 µg of monoclonal antibody MA-16N7C2 (29). A, CHO beta 3wt cells. B, CHO mock transfectants (Mock) and CHO beta 3 mutant cell clones incubated with fibrinogen-coated beads.

Role of the Cytoplasmic Domain Tyrosine Residues in beta 3 Integrin-dependent Cell Spreading-- To determine the functional role of the tyrosine residues in the membrane-proximal NPLY747 and membrane-distal NITY759 sequence in alpha vbeta 3-mediated cell spreading on fibrinogen, adherence of CHO cells expressing the beta 3 mutants indicated in Fig. 1 was performed using a steady state adhesion assay. The quantitative analysis of cell spreading is shown in Fig. 6 (A and B). Spreading of CHO cells expressing wild type beta 3 was essentially complete after a 2-h incubation at 37 °C, in contrast to mock-transfected CHO cells that lacked the alpha vbeta 3-dependent adhesive phenotype on fibrinogen, demonstrating that CHO cell spreading on fibrinogen completely relies on the transfected human beta 3 subunit. None of the three deletion mutants (beta 3Delta 754, beta 3Delta 744, and beta 3Delta 722) underwent shape change on fibrinogen, demonstrating that a minimal deletion of 9 C-terminal amino acids comprising the membrane-distal NITY759 motif was already sufficient to completely prevent beta 3 integrin-dependent cell spreading. When the single tyrosine residues 747 or 759 were mutated into alanine, a complete inhibition of cell spreading on fibrinogen was observed with mutant beta 3Y747A and a strong inhibition was observed with mutant beta 3Y759A. Similarly, the double mutant beta 3Y747A/Y759F exhibited the same defective cell spreading phenotype as mutant beta 3Y747A. On the other hand, when the more conservative, but still phosphorylation-defective substitutions of tyrosine by phenylalanine were tested (Y747F and Y759F), almost complete restoration of cell spreading was observed for mutant beta 3Y759F, whereas only 50% of the cells expressing the mutation Y747F underwent shape change, as compared with CHO beta 3wt cells. In order to determine whether this reduced cell spreading was due to decreased cell spreading kinetics, a time-course experiment was performed and cell spreading monitored over 12 h. As shown in Fig. 6B, spreading of CHO beta 3wt and CHO beta 3Y747F cells reached a plateau at about 3 h. Interestingly however, only 50% of the CHO beta 3Y747F cells underwent cell spreading even after 12 h of incubation at 37 °C, although 100% of the cells expressed the recombinant beta 3 receptor as monitored by fluorescence-activated cell sorting analysis. To exclude the possibility that the observed differences in cell spreading depended on clonal variation, additional cell clones that were independently isolated during the transfection procedure were analyzed. For each mutation, up to three cell clones were tested and each exhibited the same spreading phenotype (data not shown). Finally, no increase in cell spreading was observed with increasing coating concentrations of fibrinogen (data not shown). Taken together, these data provide evidence that the structural integrity of the beta 3 subunit cytoplasmic tail is a prerequisite for beta 3-mediated cell spreading and that the presence of residue Tyr747, but not Tyr759, in the tandem NXXY motifs is required for the normal spreading phenotype.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of beta 3 mutations on transfected CHO cell spreading onto fibrinogen. beta 3-transfected CHO cells were grown to confluence in complete IMDM, detached with EDTA buffer, washed twice, resuspended in serum-free IMDM, and allowed to adhere to microtiter plates precoated with 20 µg/ml fibrinogen overnight at 4 °C. A, after a 2-h incubation at 37 °C, the cells were microphotographed and the percentage of spread cells was determined by correlating the number of spread cells versus the total cell number on the photograph. B, time course of cell spreading onto immobilized fibrinogen. Microphotographs were taken over a period of 12 h at the indicated time points, and cell spreading was quantified as described above. The means ± S.D. of three independent experiments performed in triplicate are reported.

Effect of Cytoplasmic Domain Mutations on beta 3 Integrin Focal Contact Localization and Stress Fiber Formation-- We next analyzed the ability of the beta 3 mutants to translocate to focal contacts and to promote stress fiber formation. Immunofluorescent staining was performed after a 12-h incubation of transfected CHO cells on fibrinogen-coated glass slides. The cells were then fixed, permeabilized, and either stained with a monoclonal antibody to the beta 3 integrin subunit or alpha vbeta 3 complex or costained with an anti-beta 3 antibody and TRITC-labeled phalloidin to visualize actin stress fibers. As shown in Fig. 7, none of the beta 3 deletion mutants were able to translocate to focal adhesion plaques. The use of the complex-specific anti-alpha vbeta 3 antibody 23C6 further demonstrated that all deletion mutants, including beta 3Delta 722, formed heterodimeric complexes with endogenous alpha v. Fig. 8 displays the costaining of beta 3 integrins and stress fibers in selected CHO cell clones. The wild type human beta 3 subunit was localized in focal contacts at the tips of well organized actin stress fibers. In contrast, immunostaining of the transfected cells expressing the point mutants beta 3Y747A or beta 3Y747A/Y759F revealed the round morphology of firmly attached but unspread cells, and the complete absence of beta 3 integrin-induced focal adhesions or stress fibers, as visualized by the diffuse staining of the cells with the anti-beta 3 antibody and phalloidin. An identical result was obtained with the deletion mutants beta 3Delta 754, beta 3Delta 744, and beta 3Delta 722 (data not shown). The cell clone expressing mutant beta 3Y759A exhibited strongly reduced stress fiber formation and beta 3 focal contact recruitment in those cells that were able to spread on fibrinogen, whereas cells expressing mutant beta 3Y759F had a wild type phenotype. Interestingly, with mutant beta 3Y747F, an intermediate phenotype was observed; in the cells that had undergone shape change, beta 3 integrin was detectable in focal adhesion plaques, but the number of focal adhesion plaques was reduced and the few actin stress fibers were located predominantly at the cell periphery. Altogether, these results essentially confirm the data described for cell spreading experiments.


View larger version (105K):
[in this window]
[in a new window]
 
Fig. 7.   Immunofluorescence analysis of the intracellular localization of recombinant human beta 3 integrins in CHO cells adherent on fibrinogen. Glass coverslips were coated with 20 µg/ml fibrinogen at 4 °C for 24 h. Transfected CHO cells, grown to confluence in complete IMDM, were detached with EDTA buffer, washed twice, and resuspended in serum-free IMDM. Cells were allowed to adhere overnight at 37 °C to the coverslips, fixed, permeabilized, labeled with a primary monoclonal antibody to human beta 3 (P37) or to alpha vbeta 3 (23C6), and stained with FITC-conjugated goat anti-mouse IgG. Negative controls were performed by staining the cells in the absence of a primary antibody. Scale bar, 10 µm.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 8.   Immunofluorescent costaining of recombinant human beta 3 integrins and stress fibers in transfected CHO cells grown on fibrinogen-coated glass coverslips. beta 3-transfected CHO cells were grown on fibrinogen-coated glass coverslips as described in the legend of Fig. 7. After fixation and permeabilization, the cells were labeled with a monoclonal antibody to human beta 3 (P37) and costained with FITC-conjugated goat anti-mouse IgG and TRITC-conjugated phalloidin. Microphotographs of the same cells visualize actin cytoskeleton organization and beta 3 integrin localization. Scale bar, 10 µm.

Correlation between beta 3 Integrin-mediated Cell Spreading and beta 3-triggered Tyrosine Phosphorylation-- In an effort to determine how beta 3 integrin-dependent cell spreading correlated with tyrosine kinase activation and intracellular phosphotyrosine signaling, we investigated the effect of the cytoplasmic domain mutations on beta 3 integrin-triggered postreceptor occupancy events, namely tyrosine phosphorylation of the intracellular proteins FAK and paxillin. As tyrosine phosphorylation of FAK and paxillin is not only an integrin-mediated response, but can also be stimulated by growth factors, the transfected cells were carefully washed before plating, in order to eliminate all traces of fetal calf serum. After a 2-h incubation at 37 °C on immobilized fibrinogen, attached cells were lysed in situ, and the lysate used for FAK or paxillin immunoprecipitation. Immunoblots of the precipitates were first probed with a monoclonal anti-phosphotyrosine antibody (PY-20), then stripped and reprobed with a monoclonal anti-FAK or anti-paxillin antibody. In a control experiment shown in Fig. 9, stimulation of tyrosine phosphorylation of FAK was observed when transfected CHO cells expressing wild type beta 3 were allowed to spread on immobilized fibrinogen, whereas only background tyrosine phosphorylation was observed when the same cells were kept in suspension for 2 h or when mock-transfected CHO cells were plated on fibrinogen, demonstrating that the observed increase in FAK tyrosine phosphorylation could be specifically attributed to beta 3 integrin-triggered outside-in signaling. When the mutant cell clones were tested, a strong correlation between beta 3-mediated cell spreading and beta 3-triggered FAK phosphorylation was observed (Fig. 10). All the cell clones that were unable to spread on fibrinogen were also unable to trigger FAK phosphorylation above background levels (CHO beta 3Delta 754, CHO beta 3Delta 744, CHO beta 3Delta 722, as well as CHO beta 3Y747A and CHO beta 3Y747A/Y759F). The beta 3Y759A mutant failed to signal tyrosine phosphorylation of FAK, consistent with the strongly reduced spreading phenotype of CHO beta 3Y759A cells. In contrast, the more conservative, but still phosphorylation-defective phenylalanine substitution of Tyr759 restored FAK tyrosine phosphorylation, while the Y747F substitution gave an intermediate phenotype, suggesting that the presence of Tyr759, and hence phosphorylation of this residue, is not strictly required to signal FAK tyrosine phosphorylation. These data further indicate that beta 3 integrins with a structural modification of the cytoplasmic tail, due to an alanine substitution of Tyr747 or Tyr759, fail to trigger FAK tyrosine phosphorylation.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 9.   alpha vbeta 3-specific CHO cell adhesion to immobilized fibrinogen triggers FAK tyrosine phosphorylation. Transfected CHO cells were grown to confluence, detached with EDTA buffer, washed twice, and resuspended in serum-free IMDM. The cells were then plated on Petri dishes, precoated with 100 µg/ml fibrinogen, and blocked with 5 mg/ml BSA (adh) or kept in suspension (susp). After a 2-h incubation at 37 °C, detergent soluble cell extracts were prepared as described under "Experimental Procedures" and FAK was immunoprecipitated using a polyclonal antibody to FAK. A, the precipitates were analyzed for tyrosine phosphorylation by anti-phosphotyrosine (PY-20) immunoblotting. The band of Mr = 117 corresponds to tyrosine-phosphorylated beta -galactosidase used as a molecular weight standard (MW St.). B, the blot was stripped and reprobed with a monoclonal antibody to FAK. C, quantitation of each band of the anti-phosphotyrosine and anti-FAK immunoblots was performed by scanning densitometry. The level of FAK tyrosine phosphorylation was determined as the ratio between the values obtained for phosphorylated FAK and those for total FAK. For each cell clone, the signal was normalized to the signal obtained with adherent CHO beta 3wt cells (100%). The means ± S.D. of three independent experiments are reported.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 10.   Ability of the different beta 3 integrin mutants to trigger FAK tyrosine phosphorylation. The percentage of FAK tyrosine phosphorylation was determined as described under Fig. 9. The means ± S.D. of three independent experiments are represented.

In order to determine the specificity of paxillin phosphorylation during beta 3 integrin-stimulated cell spreading, CHO beta 3wt cells were incubated on fibrinogen in the presence or absence of cytochalasin B, known to prevent cell spreading by inhibiting actin polymerization and subsequent stress fiber formation. As shown in Fig. 11, in the absence of cytochalasin B, CHO beta 3wt cell spreading was complete after 2 h of incubation on fibrinogen, and a band corresponding to the 68-kDa protein paxillin was identified with the anti-phosphotyrosine antibody PY20, indicating that paxillin was phosphorylated to a modest, but significant and consistently reproducible level. In contrast, cytochalasin B abolished beta 3-mediated cell spreading and tyrosine phosphorylation of paxillin. The amount of paxillin immunoprecipitated from cells incubated in the absence or presence of cytochalasin B was roughly the same. When the beta 3 mutants were tested, the results correlated essentially with those observed for FAK phosphorylation; the C-terminal deletion mutants Delta 754, Delta 744, and Delta 722 consistently abolished beta 3-triggered paxillin phosphorylation (Fig. 12). Concerning the substitution mutants, only the point mutant beta 3Y759F was reproducibly able to signal paxillin phosphorylation to wild type levels. For the other point mutants, beta 3Y747A, beta 3Y747F, beta 3Y759A, and beta 3Y747A/Y759F, the results were less clear, as the band corresponding to phosphorylated paxillin was of variable intensity depending on the experiment. The amount of immunoprecipitated paxillin from each transfected cell clone was approximately the same as shown after stripping and rehybridization of the anti-phosphotyrosine blot with an anti-paxillin antibody. These results confirm that the presence of the conserved amino acid Tyr759 of the membrane-distal NITY759 sequence within the beta 3 cytoplasmic domain is not required for beta 3-triggered phosphotyrosine signaling.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 11.   Inhibition of paxillin tyrosine phosphorylation by cytochalasin B. CHO beta 3wt cells were plated on fibrinogen-coated dishes (100 µg/ml) as described under Fig. 9 in the presence (+ cyto B) or absence (- cyto B) of 5 µM cytochalasin B. After a 2-h incubation at 37 °C, detergent cell extracts were prepared and paxillin was immunoprecipitated. A, the precipitates were analyzed for tyrosine phosphorylation by anti-phosphotyrosine (PY-20) immunoblotting. Asterisk (*) denotes a band corresponding to an unidentified tyrosine-phosphorylated protein. B, anti-paxillin immunoblotting was performed to demonstrate equal protein loading. C, microphotographs of untreated (- cyto B) and treated (+ cyto B) cells were taken (original magnification, ×300) 2 h after cell plating on immobilized fibrinogen.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 12.   Effect of beta 3 mutations on alpha vbeta 3-triggered paxillin tyrosine phosphorylation. Transfected CHO cell detergent extracts were prepared as described under Fig. 9 and paxillin was immunoprecipitated. A and C, paxillin tyrosine phosphorylation was assayed by anti-phosphotyrosine immunoblotting. Asterisk (*), unidentified tyrosine-phosphorylated protein. B and D, the blots were stripped and reprobed with a monoclonal antibody to paxillin.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Integrin cytoplasmic domains are key effectors in regulating integrin-receptor function. In many cell types, both the alpha  and beta  subunit cytoplasmic domains modulate integrin affinity for extracellular ligands, and hence play a role in inside-out signaling (14, 30-32). Integrin-mediated cell spreading, in contrast, appears to rely essentially on integrin beta  subunits, as the beta  subunit cytoplasmic tail by itself contains sufficient information to target integrins to focal adhesions (7) and to trigger tyrosine phosphorylation of intracellular proteins (8). Following the initial identification of three regions within the cytoplasmic tail of the beta 1 integrin subunit necessary for focal contact recruitment of integrins (6), numerous studies on beta 1 and beta 3 subunits have focused on the functional role of two of these highly conserved sequences, NPXY and NXXY, which constitute typical recognition sites for tyrosine kinases and are encoded by a single exon known to undergo alternative splicing (33). Both of these tandem domains appear to be crucial for integrin receptor function, although studies of various recombinant mutant beta 3 integrin subunits expressed as heterodimers with either alpha IIb as a fibrinogen receptor, or alpha v as a major vitronectin receptor, have generated divergent results: beta 3 mutants with a deletion of the membrane-distal NITY759 sequence up to amino acid 756 completely prevented alpha IIbbeta 3 integrin-dependent cell spreading on immobilized fibrinogen (13), while deletion of the same C-terminal domain up to amino acid 751 allowed normal alpha vbeta 3-dependent cell spreading on vitronectin (12). Furthermore, by using cell-permeable peptides carrying different linear beta 3 cytoplasmic domain sequences, Liu and co-workers (15) identified the beta 3 C-terminal segment (residues 747-762) as a major cell adhesion regulatory domain capable of inhibiting the interaction of alpha IIbbeta 3-expressing HEL cells or alpha vbeta 3-expressing endothelial cells with immobilized fibrinogen, while peptides with a Y759F substitution were unable to induce this inhibitory effect. Differences concerning the involvement of the membrane-proximal NPLY747 sequence in signal transduction have also been reported; mutations in the beta 3 cytoplasmic domain that eliminate or disrupt the membrane-proximal NPLY747 motif prevented alpha vbeta 3-mediated cell attachment to immobilized vitronectin, but did not perturb the ability of alpha vbeta 3 to interact with soluble vitronectin (12), while mutations in the NPLY747 sequence abolished inside-out signaling of alpha IIbbeta 3 (14).

The observations that the NPLY747 and NITY759 motifs in the beta 3 integrin subunit might differently regulate alpha IIbbeta 3 and alpha vbeta 3 receptor function prompted us to investigate the effect of beta 3 cytoplasmic domain mutations, that either promote or inhibit cell spreading, on alpha vbeta 3-mediated tyrosine phosphorylation of two major focal adhesion proteins, the focal adhesion kinase FAK (34), and the cytoskeleton-related "bridging" protein paxillin (35). Our results demonstrate a close correlation between alpha vbeta 3-mediated cell spreading and tyrosine phosphorylation of FAK and paxillin, and highlight a distinct involvement of the NPLY747 and NITY759 sequences in these post-ligand binding events. Considering the membrane-distal NITY759 motif, deletion of this motif was sufficient to completely prevent alpha vbeta 3-dependent focal contact formation, cell spreading, as well as FAK/paxillin tyrosine phosphorylation. A Y759A substitution also resulted in a strong inhibitory phenotype. In contrast, the more conservative, but still phosphorylation-defective Y759F mutation was able to restore wild type receptor function. These data suggest that the structural integrity of the NITY759 motif, rather than the phosphorylation status of Tyr759, is important for beta 3-mediated cytoskeleton reorganization or tyrosine phosphorylation of FAK and paxillin. Concerning the membrane-proximal NPLY747 sequence, our mutagenesis studies demonstrate that an alanine substitution of the highly conserved tyrosyl residue at 747 completely abolished alpha vbeta 3-dependent formation of focal adhesion plaques and cell spreading, and prevented FAK and paxillin tyrosine phosphorylation, while a Y747F substitution, compared with the Y759F substitution, only partially restored these receptor functions, suggesting that phosphorylation of residue Tyr747 might be require