JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borroto, A.
Right arrow Articles by Alarcón, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borroto, A.
Right arrow Articles by Alarcón, B.

J Biol Chem, Vol. 273, Issue 21, 12807-12816, May 22, 1998


Characterization of the Region Involved in CD3 Pairwise Interactions within the T Cell Receptor Complex*

Aldo BorrotoDagger , Arrate MallabiabarrenaDagger , Juan P. Albar§, Carlos Martínez-A.§, and Balbino AlarcónDagger

From the Dagger  Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid-Consejo Superior de Investigaciones Científicas, Cantoblanco, Madrid 28049, Spain and § Department of Immunology and Oncology, Centro Nacional de Biotecnología, Cantoblanco, Madrid 28049, Spain

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Assembly of the six-chain T cell antigen receptor-CD3 complex takes place by pairwise interactions. Thus, CD3-epsilon interacts with either CD3-gamma or CD3-delta , and these dimers then associate with the TCR heterodimer (alpha ·beta or gamma ·delta ) and the CD3-zeta homodimer to constitute a full complex. We have now mapped the site in CD3-epsilon responsible for the interaction with CD3-gamma and CD3-delta by analysis of a series of deletional mutants encompassing the most conserved regions. We found that the highly conserved juxtamembrane domain is mainly responsible for the interaction. Thus, deletion of this 16-amino acid extracellular sequence resulted in the inhibition of up to 95% of the CD3-epsilon /gamma interaction. A highly conserved sequence is also present in both CD3-gamma and CD3-delta , suggesting that the domain in these two chains may reciprocally be involved in the interaction with CD3-epsilon . Indeed, an immobilized synthetic peptide corresponding to the CD3-gamma sequence specifically associated to a bacterially expressed CD3-epsilon protein, suggesting the 16-amino acid domain is sufficient to promote CD3-epsilon /CD3-gamma assembly. The conservation of the motif in the CD3 chains suggest that, in addition to CD3-epsilon /CD3-gamma and CD3-epsilon /CD3-delta interactions, it may also mediate homotypic interactions. Indeed, it is shown that it mediates the formation of disulfide-linked homodimers and that the formation of homo- and heterodimers are mutually excluded. Finally, this domain contains a Cys-X-X-Cys sequence that resembles that of p56lck, which is responsible for the interaction with the cytoplasmic tails of CD4 and CD8. Since the replacement of the two cysteines (Cys97 and Cys100) in CD3-epsilon by alanines strongly inhibited pair formation, the existence of a Cys-X-X-Cys motif involved in protein-protein interactions is suggested.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The T cell antigen receptor complex (TCR-CD3)1 is composed, in most mature T cells, of six subunits (TCR-alpha , TCR-beta , CD3-gamma , CD3-delta , CD3-epsilon , and CD3-zeta ) that serve the dual function of peptide antigen/major histocompatibility complex recognition and signal transduction to the cytoplasm (for reviews, see Refs. 1-4). The TCR and CD3 components of the receptor have specialized roles in determining both functions; while antigen/major histocompatibility complex binding resides in the TCR-alpha ·beta heterodimer, the CD3 chains are able to interact with intracellular proteins involved in signal transduction. The expression of TCR-CD3 on the cell surface is regulated in mature T cells in such a way that when one subunit is absent the remaining complex is not expressed (for a review, see Ref. 4). However, the identity and the number of subunits that compose a minimal TCR-CD3 complex remains controversial. In addition to the existence of a TCR-gamma ·delta receptor that replaces the TCR-alpha ·beta , other alternative forms of the receptor have been found, first by identification of complexes containing an alternative splice form of CD3-zeta , CD3-eta , and/or the gamma -chain of the Fcepsilon RI (5, 6). These two chains can form heterodimers with CD3-zeta and replace CD3-zeta partially or completely. Second, it has been suggested that the homologous chains CD3-gamma and CD3-delta can also form alternative complexes and that, therefore, one can be expressed on the cell surface of T cells in the absence of the other (7).

A different TCR-CD3 complex has been revealed in immature thymocytes, where a surrogate TCR-alpha chain has been found associated to TCR-beta and CD3 chains in thymocytes with prerearranged TCR-alpha (8). Complexes of CD3 subunits not associated to TCR chains have also been found in certain thymomas (9). Moreover, murine pro-T cells in RAG-1-/- mice also have been shown to contain TCR-independent CD3-gamma ·epsilon dimers on the cell surface that can be stimulated by in vivo administration of anti-CD3 antibodies to differentiate into pre-T cells (10). In addition, gamma ·epsilon dimers and, to a lesser extent, delta epsilon dimers have been found associated to calnexin in SCID thymocytes and on early thymocytes from normal mice through the CD4+CD8+ stage (11, 12).

Assembly of the TCR-CD3 complex has been suggested to take place by pairwise interactions that allow the formation of CD3 gamma ·epsilon , delta ·epsilon , and zeta ·zeta dimers as well as TCR-alpha ·beta (12). The association between TCR and CD3 chains seems to depend largely on the interaction among transmembrane domains, where the basic amino acid residues of the TCR chains and the acidic residues of the CD3 chains are involved, perhaps forming salt bridges (13, 14). The importance of the basic and acidic residues of the transmembrane domains is highlighted by the conservation of the lysine residue in TCR-beta and TCR-gamma and especially by the conservation of the arginine and lysine residues and their positions in TCR-alpha and its equivalents (TCR-delta and pTalpha ) (15). The transmembrane domain has also been shown to be important in CD3-zeta dimerization (16). However, very little is known of the mechanisms that govern the assembly of the CD3-gamma , -delta , and -epsilon chains. CD3-epsilon can interact with either CD3-gamma or CD3-delta , but CD3-gamma and CD3-delta do not interact directly. Interestingly, the removal of the acidic amino acids in the transmembrane domain of CD3-gamma or CD3-delta results in the formation of CD3-gamma ·delta heterodimers (17).

We have screened a collection of human CD3-epsilon deletional mutants for their ability to interact with CD3-gamma and CD3-delta . We found that a region in the extracellular domain of CD3-epsilon , highly conserved in CD3-gamma and CD3-delta , is responsible for CD3-gamma epsilon and CD3-delta epsilon dimer formation as well as the formation of homodimers.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cells and Antibodies-- The COS-7 African green monkey cell line was grown in Dulbecco's modified Eagle's medium supplemented with 5% newborn calf serum (Life Technologies, Inc.).

Mouse monoclonal antibodies APA1/1 and APA1/2, specific for human CD3-epsilon and CD3-delta , respectively, were obtained from purified CD3 proteins isolated from human thymus (7). The anti-CD3 antibody UCHT1 was generously donated by Dr. P. Beverley (Imperial Cancer Research Fund, London). HMT3.2 is a hamster monoclonal antibody reactive toward human CD3-gamma and murine CD3-gamma and CD3-delta (7) that was generously given by Dr. R. Kubo (National Jewish Center, Denver, CO).

Plasmids-- The pSRalpha -gamma , pSRalpha -delta , and pSRalpha -epsilon constructs were made as described (7). Deletions 1-13 in CD3-epsilon were generated by loop-out mutagenesis as described previously (18). The CD3-epsilon mutant 14 was constructed after two PCR amplifications. The first amplification utilized primer 8 (XhoI restriction site) as the 5'-primer (CCCCCTCGAGATGCAGTCGGGCACT) and an internal oligonucleotide 126 (CGCTGCAGCGGCCGCAGCTTCAGATCCAGGATACTG) containing alanine substitutions as the 3'-primer. The second part of the molecule was amplified using a 5'-primer complementary to 126 (GCTGCGGCCGCTGCAGCGGATAAAAACATAGGCGGT) together with oligonucleotide 61 (containing a BamHI restriction site) as the 3'-primer (GGGGATCCTCAGATGCGTCTCTGATT). Primer 61 corresponds to the most carboxyl-terminal region. After hybridization of the previously amplified fragments, a second round of PCR was performed with the external primers 8 and 61. This fragment was cloned into the XhoI and BamHI sites of the expression vector pSRalpha . The double cysteine substitution in CD3-epsilon was made as above with the oligonucleotide 131 (CATCTCCATGGCGTTCTCAGCCACTCTTGC) and its complementary form as internal primers. CD3-gamma deletion A was generated with the internal primers 123 (CACAAGTCAGTTCTTGATAG) and 124 (CTATCAAGAACTGACTTGTG) that incorporate the mutant alanines followed by amplification of the complete CD3-gamma with oligonucleotide 73 (CCCCTCGAGGACATGGAACAGGGGAAG) as the 5'-primer and oligonucleotide 112 (GGGGATCCTCTGAGTCCTGAGTTCA) as the 3'-primer. Because CD3-gamma cDNA has an internal XhoI site, it was cloned into the pSRalpha vector by partial digestion. All constructs described were sequenced by the fmol DNA Sequencing System (Promega Corp., Madison, WI) to exclude the possible introduction of unwanted mutations.

COS Cell Transfections-- COS cells were transfected by electroporation. Briefly, the cells were trypsinized, counted, and resuspended at 10 × 106 cells/ml in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum and 10 mM HEPES, pH 7.4. A total of 200 µl of the cell suspension was transferred to an electroporation cuvette (Bio-Rad), and 5 µg of the plasmid mixture was added as well as 20 µg of PUC-19 plasmid DNA (Promega) as a carrier. Cells were electroporated at 200 V, 960 microfarads in a Bio-Rad gene pulser, diluted with complete Dulbecco's modified Eagle's medium, and plated on coverslips.

Immunofluorescence-- COS cells were fixed, 24-48 h after transfection, with 2% paraformaldehyde for 20 min, washed with PBS, blocked and permeabilized with 1% bovine serum albumin plus 0.1% saponin in PBS for 1 h at room temperature, and incubated for 1 h with the anti-CD3 monoclonal antibodies. Afterward, the coverslips were rinsed with PBS and incubated for an additional hour with a fluorescein-conjugated goat anti-mouse Ig or a goat anti-hamster Ig secondary antibody (Southern Biotechnology). The coverslips were mounted with Mowiol, and cells were visualized on a Zeiss Axioskop microscope. Photographs were taken on Kodak T-Max 400 film.

Radiolabeling-- Metabolic labeling was carried out on transfected COS cells plated on 100-mm Petri dishes. Forty-eight hours after transfection, the cells were washed with PBS and incubated for 30 min in methionine and cysteine-free Dulbecco's modified Eagle's medium at 37 °C. Subsequently, 250 µCi of a [35S]methionine and [35S]cysteine mixture (Amersham Pharmacia Biotech) were added for 4 h. Afterward, the cells were washed with PBS and lysed in 1% Nonidet P-40-containing lysis buffer (1% Nonidet P-40, 150 mM NaCl, 20 mM Tris-HCl, pH 7.8, 10 mM iodoacetamide, 1 mM phenylmethylsulfonyl fluoride, and a 1 µg/ml concentration each of leupeptin and aprotinin).

Immunoprecipitation and Deglycosylation Procedure-- In immunoprecipitation studies, 1% Nonidet P-40 or radioimmune precipitation buffer (20 mM Tris, pH 8.0, 0.15 M NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% deoxycholate, 1 mM EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, and 1 µg/ml concentration of leupeptin, aprotinin, and chemostatin) lysates were precleared three times by incubation for 1 h with nonimmune mouse serum coupled to protein A- and protein G-Sepharose beads (Sigma) followed by centrifugation at 12,000 × g in an Eppendorf centrifuge. The precleared supernatants were subsequently incubated for 4 h at 4 °C with 2-4 µg of the specific antibodies coupled to protein A- or protein G-Sepharose beads. Then the beads were washed five times with 1 ml of lysis buffer and resuspended in Laemmli sample buffer. SDS-polyacrylamide gel electrophoresis was performed on 13% polyacrylamide gels. Two-dimensional electrophoresis under nonreducing/reducing conditions was performed as described (7).

In deglycosylation studies, the immunoprecipitates were resuspended after the last wash in 60 µl of a 0.15 M sodium citrate buffer, pH 5.5, containing 1 mM phenylmethylsulfonyl fluoride and 0.25% SDS. The samples were boiled for 2 min, and 1 milliunit of endo-beta -acetylgycosaminidase H (Boehringer Mannheim) was added to half of each sample. The samples were incubated overnight at 37 °C and electrophoresed.

Western Blot Analysis-- Immunoprecipitated samples were run on 13% acrylamide gels and were transferred onto nitrocellulose membrane (Bio-Rad). The membrane was blocked in 10% nonfat milk in PBS for 1 h and incubated with the desired antibody, diluted in washing solution (PBS plus 0.1% Tween 20), for 1 h.

The membranes were washed five times with PBS-Tween and incubated for another hour with a peroxidase-labeled species-specific anti-Ig antibody (Amersham Pharmacia Biotech) diluted in PBS-Tween. Last, the membrane was washed five times with PBS-Tween, and protein bands were visualized with the enhanced chemiluminescence method (ECL, Amersham Pharmacia Biotech). Densitometry analysis was performed in a Computing Densitometer model 300A.

Immobilized Ligand Binding Assay-- A total of 1.4 mg of a 19-mer synthetic peptide (LQVYYRMCQNCIELNGSGK) that corresponds to amino acids 79-93 (LQVYYRMCQNCIELN) of the human mature CD3-gamma protein were covalently coupled to a 1-ml HiTrap NHS-activated agarose column (Amersham Pharmacia Biotech) through a 4-amino acid spacer (GSGK). A control column was prepared by coupling a similar amount of an irrelevant peptide (ERRRGKGHDGLYQGLSTATKDTYD) that corresponds to an intracellular sequence of CD3-zeta . The efficiency of coupling was estimated to be 80% in both cases by optical absorbance.

To prepare the 35S-labeled extracellular domain of CD3-epsilon , a sequence encoding for amino acids 1-105 of the mature protein was obtained by PCR using oligonucleotide GGCCTCGAGCATATGGATGGTAATGAGGAAATGGG as 5'-primer and oligonucleotide GGGGGATCCTATCACGACATCACATCCATCTC as 3'-primer. The PCR product was inserted into the NdeI and BamHI sites of the pET3ax vector (New England Biolabs, Beverly, MA), and the resulting construct was fully sequenced using the fmol DNA sequencing kit (Promega) in order to verify the lack of PCR-induced errors. The desired clone was transformed into the lysogenic Escherichia coli strain BL-21(DE3), and the correct expression of the recombinant peptide was tested by immunoblotting and immunoprecipitation of the induced protein with antibody SP34, which specifically recognizes the extracellular part of CD3-epsilon . Induction and extraction of the protein was carried as follows: an overnight culture of the clone was diluted 20-fold in M9 medium supplemented with 50 µg/ml ampicillin and 34 µg/ml chloramphenicol. After 4 h, expression of the clone gene was induced with 1 mM isopropyl-1-thio-beta -D-galactopyranoside (Sigma) in the presence of 50 µg/ml rifampicin (Sigma). Two hours later, bacteria were labeled with [35S]methionine (0.5 µCi/ml) (Amersham Pharmacia Biotech) for 15 min at 37 °C and subsequently collected by centrifugation and resuspended in 2 ml of extraction buffer (50 mM Tris, pH 8.0, 1 mM EDTA, 1% Triton X-100) per 25 ml of culture. Afterward, 25 µl of 10% deoxicolic acid and 20 µl of 1 mg/ml DNAse I were added and incubated at 37 °C for 15 min with occasional shaking. Bacterial cell lysates were centrifuged to eliminate the cell debris, and the supernatant (1 ml per column) was injected and incubated for 45 min on ice. The columns were then rapidly rinsed with 10 column volumes of the extraction buffer, and the bound material was eluted with three column volumes of 50 mM triethylamine, pH 11.0. The eluates were rapidly neutralized, and 100 µl were counted in a beta -scintillation counter. Equal volumes of both CD3-gamma column and control column eluates were subjected to SDS-polyacrylamide gel electrophoresis.

For the peptide binding assay, 30 µg each of a synthetic peptide corresponding to amino acids 89-105 of the human mature CD3-epsilon protein (YLYLRARVCENCMEMDV) and of the irrelevant zeta -peptide were 125I-labeled by the chloramine T method (19). The iodinated peptides were diluted to 1 × 106 cpm/ml in 1% Nonidet P-40 immunoprecipitation buffer, and 1 ml of each was injected into the CD3-gamma and CD3-zeta columns. After a 45-min incubation on ice, the columns were rapidly rinsed with 10 column volumes of the immunoprecipitation buffer, and bound material was eluted with 5 column volumes of 50 mM triethylamine, pH 11.0. The eluates were then counted in a beta -scintillation counter.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Mapping the Region of CD3-epsilon Involved in the Association with CD3-gamma and CD3-delta -- Previously, we had determined that CD3-gamma and CD3-delta compete for binding to CD3-epsilon , suggesting that both chains bind to the same site in CD3-epsilon (7). To determine the CD3-gamma and CD3-delta binding site in CD3-epsilon , a series of human CD3-epsilon deletional mutants (Fig. 1) were used in transfection studies, together with wild type CD3-gamma and CD3-delta . Because these deletions affected the most conserved regions of the known CD3-epsilon proteins (20-25) and because human and murine CD3 chains are able to form interspecific hybrid complexes, it is believed that the deleted sequences should contain the binding site. To explore the ability of CD3-gamma and CD3-delta to associate with the CD3-epsilon mutants, COS cells were cotransfected with either CD3-gamma or CD3-delta and each one of the mutants. The transfected cells were then stained with UCHT1, an antibody previously shown to recognize the dimers of CD3-epsilon with CD3-gamma or CD3-delta but not the isolated subunits (26). As shown in Fig. 2 (panels A and B), the cells transfected with deletions 1, 5, 6, and 14 and either CD3-gamma or CD3-delta were not stained with antibody UCHT1, although the individual transfected chains were recognized by subunit-specific antibodies APA1/1 (anti-epsilon ), APA1/2 (anti-delta ), and HMT3.2 (anti-gamma ). Other antibodies that recognize epsilon ·gamma and epsilon ·delta dimers (e.g. Leu4, OKT3) were also unable to recognize cells cotransfected with either CD3-gamma or CD3-delta and any one of the CD3-epsilon deletional mutants 1, 5, 6, and 14 (data not shown). All other deletion mutants were stained with UCHT1 when they were cotransfected with CD3-gamma or CD3-delta , suggesting that they formed epsilon ·gamma and epsilon ·delta complexes (data not shown). Even those deletional mutants that should have important conformational alterations, such as deletions 2 and 4, which lack the putative intrachain disulfide loop characteristic of the immunoglobulin fold, and deletion 13, which lacks the membrane anchor, were able to associate to CD3-gamma and CD3-delta .


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of the mature CD3-epsilon protein sequences from different species. The CD3-epsilon sequences from human, dog, sheep, cow, mouse, pig, and chicken were aligned for comparison using the Pileup program. Amino acids involved in deletions 1-13 and in mutation 14 in human CD3-epsilon are underlined. Conserved residues are in boldface type. Deletion 13 spans the transmembrane domain.


View larger version (103K):
[in this window]
[in a new window]
 
Fig. 2.   Immunofluorescence analysis of the association of CD3-epsilon with CD3-gamma and CD3-delta . COS cells were transfected with expression vectors encoding for wild type or the indicated mutants of CD3-epsilon and either CD3-gamma (A) or CD3-delta (B). Indirect immunofluorescent staining was performed with antibodies APA1/1 (anti-CD3-epsilon ), HMT3.2 (anti-CD3-gamma ), APA1/2 (anti-CD3-delta ), and UCHT1 (specific for CD3-epsilon ·gamma and CD3-epsilon ·delta dimers). Photographs were taken at a × 400 magnification.

These experiments suggested that deletions 1, 5, 6, and 14 prevented the association of CD3-epsilon with CD3-gamma and CD3-delta or, alternatively, that they altered the binding site for antibodies UCHT1, Leu 4, etc. In order to distinguish between both possibilities, an immunoprecipitation experiment with subunit-specific antibodies was performed. COS cells were transfected with different CD3-epsilon constructs, together with CD3-gamma , and were metabolically labeled with a [35S]methionine and [35S]cysteine mixture. For these experiments, a double deletional mutant of regions 5 and 6 was produced that, as expected, was not stained by conformation-dependent antibodies when cotransfected with either CD3-gamma or CD3-delta (data not shown). Radioimmune precipitation buffer lysates from doubly transfected cells were immunoprecipitated with antibodies HMT3.2 and APA1/1 that recognize isolated CD3-gamma and CD3-epsilon chains, respectively. Half of each immunoprecipitate was treated with endo-beta -acetylglycosaminidase H to better distinguish between glycosylated CD3-gamma and the nonglycosylated CD3-epsilon . As shown in Fig. 3A, the immunoprecipitation with APA1/1 from cells cotransfected with CD3-gamma and wild type CD3-epsilon resulted in the coprecipitation of CD3-gamma , which characteristically runs as 25 kDa in untreated samples and as a 17-kDa protein when it is deglycosylated (dgamma ). Upon deglycosylation, the 23-kDa CD3-epsilon chain remained unmodified. Of note, the mobilities of CD3-epsilon mutants were frequently different from that of the wild type form, and their position is indicated with arrowheads in Fig. 3. Only two deletions, deletion 5 + 6 and deletion 9 seemed to affect binding to CD3-gamma , since immunoprecipitation with APA1/1 did not coprecipitate any detectable CD3-gamma . However, the reverse immunoprecipitation with anti-CD3-gamma antibody HMT3.2 showed similar levels of deletion 9 and epsilon wt, suggesting that, indeed, deletion 9 did not affect the association with CD3-gamma (data not shown). Furthermore, the immunoprecipitation with APA1/1 had not shown any detectable CD3-epsilon , strongly suggesting that the sequence eliminated in deletion 9 constitutes the recognition site for APA1/1. Interestingly, deletion 5 + 6 was the only deletion that considerably affected the epsilon /gamma interaction, as shown by immunoprecipitation with anti-epsilon and anti-gamma antibodies (Fig. 3, A and B). Deletion mutants 1 and 14 were clearly coprecipitated by the anti-gamma antibodies (Fig. 3B), and conversely, CD3-gamma was clearly coprecipitated by the anti-epsilon antibody in cells cotransfected with these mutants (Fig. 3A). These results suggest that the only deletion that had a major effect on the interaction with CD3-gamma corresponded to regions 5 + 6. Nevertheless, because region 6 contains two of a total of four methionines and two of a total of five cysteines, it is difficult to quantitate the amount of protein relative to the wild type control in the experiments shown in Fig. 3. In order to generate quantifiable results, the immunoprecipitation with subunit-specific anti-epsilon and anti-gamma antibodies was followed by immunoblotting with the opposite antibody. As shown in Fig. 4, immunoprecipitation with anti-gamma antibody (HMT3.2) resulted in less deletion 5 + 6 coprecipitated as compared with that of the wild type. To control the efficiency of transfection, the membrane was stripped and reprobed with the anti-gamma antibody. Densitometric scans of the bands corresponding to CD3-epsilon and CD3-gamma showed that the level of the coprecipitated deletion 5 + 6 mutant was one-third of that of the wild type, whereas deletions 1 and 14 had only a marginal effect. The immunoprecipitation with the anti-epsilon antibody followed by immunoblotting with the anti-gamma antibody showed comparatively similar results, although the effects were more pronounced. CD3-gamma was barely coprecipitated in cells transfected with deletion 5 + 6, although the levels of CD3-epsilon detected after reprobing the membrane with APA1/1 showed in all cases similar levels of transfected CD3-epsilon . A densitometric scan of the CD3-epsilon and CD3-gamma bands revealed that deletions 1 and 14 inhibited the association to CD3-gamma by 2-3-fold, whereas deletion 5 + 6 inhibited it by 20-fold. The fact that deletion 5 + 6 causes a 3-fold reduction in formation of CD3-epsilon ·CD3-gamma heterodimers when immunoprecipitation was carried out with anti-gamma antibody and a 20-fold reduction when immunoprecipitation was performed with anti-epsilon could be due to an excess of expression of one transfected product over the other. As a control for the specificity of the immunoprecipitations, COS cells were transfected with epsilon wt and a CD4 chimera that is endoplasmic reticulum-retained (18). The immunoprecipitation with either anti-CD4 or anti-CD3-epsilon antibodies did not show any evidence of association (data not shown).


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 3.   Deletion of regions 5 and 6 inhibit the interaction with CD3-gamma . COS cells were transfected with expression vectors encoding for wild type CD3-epsilon (epsilon wt) or the indicated mutants of CD3-epsilon plus wild type CD3-gamma . Cells were metabolically labeled with a [35S]methionine-cysteine mixture, and proteins were immunoprecipitated with antibodies against CD3-epsilon (APA1/1; panel A) or anti CD3-gamma (HMT3.2; panel B). Half of each sample was incubated with endo-beta -acetylgycosaminidase H (+) or left untreated (-). The positions of the CD3-epsilon mutants are indicated by arrowheads. dgamma , deglycosylated CD3-gamma ; nms, nonimmune serum.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4.   Quantitation of epsilon /gamma interactions by Western blot analysis. Deletions 1, 5 + 6, and 14 were cotransfected with CD3-gamma in COS cells. The samples were divided, and immunoprecipitation was performed with anti CD3-gamma , HMT3.2 (left) or anti CD3-epsilon , APA1/1 (right), followed by immunoblotting with the indicated antibody. The quantity of CD3-gamma and CD3-epsilon specifically immunoprecipitated in each case was estimated by reprobing the membranes with the antibodies used for immunoprecipitation. The ratios of coprecipitated proteins were analyzed by densitometry and are shown at the bottom as percentages of the coprecipitating chains obtained with wild type CD3-epsilon . The positions of CD3-gamma , CD3-epsilon , and immunoglobulin light chain (L) are indicated.

Dietrich et al. (27) have described that two sites in human CD3-gamma mediated binding to CD3-epsilon . One, that they named site 17, corresponds to part of regions 1 and 2 of CD3-epsilon and involved five amino acids (Fig. 5A). The other site, named 56, of CD3-gamma homologous to region 3 of CD3-epsilon involved four amino acids. According to our results, of the CD3-epsilon deletions that affected the corresponding regions in CD3-gamma (deletions 1, 2, and 3), only deletion 1 had an effect on the association to CD3-gamma (Figs. 2 and 4). However, this was only a minor effect (Figs. 3 and 4). In order to solve this discrepancy, we made a deletion in CD3-gamma that eliminated the five amino acids of site 17, and this mutant (CD3-gamma delA) was then cotransfected with epsilon wt into COS cells. After metabolic labeling and immunoprecipitation with anti-gamma and anti-epsilon antibodies, no difference was detected in the ability of gamma delA and gamma wt to associate with epsilon wt (Fig. 5B).


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of mutation of site 17 in CD3-gamma on the association with CD3-epsilon . A, Amino acid sequence of human CD3-gamma , indicating sites 17 and 56 (boldface type) according to Dietrich et al. (27) and their corresponding CD3-epsilon deletions. The five amino acids of site 17 were replaced by alanines (CD3-gamma A). B, COS cells were transfected with the expression vector encoding for wild type CD3-epsilon plus CD3-gamma A and metabolically labeled with [35S]methionine/cysteine mixture. Antibodies APA1/1 (anti-CD3-epsilon ) and HMT3.2 (anti CD3-gamma ) were used for immunoprecipitation. Half of the samples were untreated (-) or treated (+) with endo-beta -acetylgycosaminidase H (endoH) and resolved on 13% acrylamide gels. Positions of CD3-epsilon , CD3-gamma , and deglycosylated CD3-gamma (dgamma ) are indicated.

A Peptide from the CD3-gamma Equivalent to CD3-epsilon 's Region 5 + 6 Is Sufficient to Promote Interaction with CD3-epsilon -- The results shown in Figs. 2-4 suggest that the 16 amino acids of the extracellular domain of CD3-epsilon most proximal to the transmembrane domain constitute the major region involved in CD3-gamma binding and, according to the immunofluorescence stainings (Fig. 2), in CD3-delta binding. This region is contained in the equivalent to the connecting peptide region found in the immunoglobulin family and constitutes the stretch of highest homology with CD3-gamma and CD3-delta . Thus, in region 5 + 6 human CD3-epsilon shares 37% identical amino acids with CD3-gamma and 31% with CD3-delta (Fig. 6A) as compared with an overall homology of 22 and 20% respectively, for the whole extracellular domains. Furthermore, taking into consideration the number of identical positions and conservative substitutions in the 5 + 6 region (Leu for Val, Val for Met, Glu for Gln, Met for Ile and Val, and Asp for Asn), the homology with CD3-gamma increases to 75% and with CD3-delta to 69%. It would not be surprising then that if the 5 + 6 sequence of CD3-epsilon is involved in the association with CD3-gamma and CD3-delta , the equivalent regions in CD3-gamma and CD3-delta were involved in CD3-epsilon binding. To confirm this hypothesis, a synthetic peptide corresponding to the CD3-gamma sequence was covalently coupled to an agarose column, and a [35S]methionine-labeled bacterial extract expressing the full extracellular domain of the mature CD3-epsilon protein (amino acids 1-105) was passed through the column. As a control of binding, a column made with an irrelevant peptide was incubated, rinsed, and eluted in the same conditions. As shown in Fig. 6B, CD3-epsilon bound efficiently and specifically to the CD3-gamma sequence. To determine whether the immobilized CD3-gamma peptide actually bound the connecting peptide region of CD3-epsilon , a similar experiment to the one shown in Fig. 6B was carried out. In this case, a 125I-labeled peptide corresponding to the connecting peptide region of CD3-epsilon was passed through the CD3-gamma column. As control for specificity, the same peptide was passed through the irrelevant peptide (zeta ) column. As shown in Fig. 6C, the CD3-epsilon peptide bound to the CD3-gamma and not to the irrelevant column. An additional control was established by passing a 125I-labeled preparation of the irrelevant peptide through both columns. The CD3-gamma column bound the CD3-epsilon peptide but not the irrelevant one (Fig. 6C). In summary, the data shown in Fig. 6, B and C, demonstrate that the region in CD3-gamma equivalent to 5 + 6 in CD3-epsilon is also involved in CD3-epsilon binding and that the sequence is by itself sufficient to promote binding. Therefore, the region 5 + 6 delineates a conserved sequence in the CD3 chains that is both necessary and sufficient to promote CD3 interactions. Nevertheless, although weak, the effect of deletions 1 and 14 on CD3 pair formation (Fig. 4) suggests that other regions may be minor contributors to assembly.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6.   The equivalent in CD3-gamma to region 5 + 6 of CD3-epsilon is sufficient to promote the association of CD3-epsilon . A, sequence comparison of region 5 + 6 of CD3-epsilon with its counterpart in CD3-gamma and CD3-delta . Residues that are conserved in at least two subunits are shown in boldface type. B, the CD3-gamma connecting peptide is sufficient to bind the extracellular portion of CD3-epsilon . A 35S-labeled bacterial cell lysate expressing the extracellular domain of CD3-epsilon was passed through a column containing a covalently bound peptide corresponding to the connecting peptide of CD3-gamma (lanes 2 and 4) or containing an irrelevant control peptide (lanes 1 and 3). The columns were rinsed, and equal volumes of the unbound material were loaded in lanes 1 and 2, whereas the bound material was eluted from both columns and equal volumes were loaded in lanes 3 and 4. The column with immobilized CD3-gamma peptide bound 16% of the loaded radioactivity, whereas the control column bound only a 3%. C, the CD3-gamma connecting peptide binds the equivalent region in CD3-epsilon . 125I-Labeled peptides corresponding to amino acids 89-105 of CD3-epsilon (epsilon ) and to an irrelevant sequence (zeta ) were passed through columns containing immobilized the CD3-gamma peptide (gamma ) or the irrelevant peptide (zeta ). The columns were rinsed, and the bound material was eluted and counted. A total of 1 × 106 cpm of labeled peptides were loaded per column.

Two Cysteines in Region 6 of CD3-epsilon Are Involved in the Association with CD3-gamma and CD3-delta and May Form an Intrachain Disulfide Loop-- The two cysteines of the CD3 association region are conserved not only in all described CD3-epsilon cDNAs (Fig. 1) but also in all CD3-gamma and CD3-delta chains (not shown). To prove the possible involvement of the two cysteines in CD3 pair formation, we made a double mutation of the two cysteines (positions 97 and 100 of the human mature protein) to alanines (Fig. 6A). The double mutant was transfected in COS cells together with CD3-gamma or CD3-delta , and the effect on the association was analyzed by immunoprecipitation with anti-epsilon followed by blotting with anti-gamma or anti-delta antibodies. As shown in Fig. 7, the double cysteine mutant associated much less efficiently to both CD3-gamma and CD3-delta than the wild type. The inhibition caused by the double cysteine mutation was in the range of the inhibition obtained with the deletional mutant 5 + 6. These results further support the idea that regions 5 and 6 of CD3-epsilon constitute the major binding site for CD3-gamma and CD3-delta and that either one or both of the conserved cysteines are involved in that interaction.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 7.   Role of Cys97 and Cys100 of CD3-epsilon in the association with CD3-gamma and CD3-delta . COS cells were transfected with CD3-gamma or CD3-delta and either wild type CD3-epsilon or CD3-epsilon doubly mutated in Cys97 and Cys100 to alanine (mut). Samples were immunoprecipitated with APA1/1 (anti-epsilon ), and blotting was performed with HMT3.2 (anti-gamma ) or APA1/2 (anti-delta ). The two panels at the bottom show the result of stripping and reprobing the same membrane with APA1/1 as a control for the efficiency of transfection. The percentage of coprecipitated CD3-gamma and CD3-delta chains is calculated in reference to the amount of transfected CD3-epsilon and considering the level obtained with wild type CD3-epsilon as 100%.

Since the cysteines in region 6 that appear to be involved in the association with CD3-gamma and CD3-delta are also present in these two chains, it would be possible that in the interactions epsilon /gamma and epsilon /delta a Zn2+ cation is coordinated by the sulfhydryl groups of the four cysteines involved. To determine whether this is so, detergent lysates of COS cells doubly transfected with these chains were incubated with 10 mM phenanthroline, a well known Zn2+ chelator, before immunoprecipitation with anti-epsilon and anti-gamma antibodies. The formation of epsilon ·gamma dimers was analyzed by Western blotting with the anti-epsilon antibody. As shown in Fig. 8A, the addition of phenanthroline did not have a detectable effect on the epsilon /gamma interaction, since similar amounts of CD3-epsilon were coprecipitated by the anti-gamma antibody from the treated and the untreated samples. Thus, these results do not support the involvement of Zn2+ cations in the epsilon /gamma interaction. However, these data raise the question of how Cys97 and Cys100 intervene. Because the epsilon /gamma and epsilon /delta interactions are not covalent, these two cysteines cannot form interchain disulfide bridges. However, they may form an internal miniloop. Indeed, the immunoprecipitation buffer commonly used in our experiments contains 10 mM iodoacetamide, an alkylating agent that binds to free sulfhydryl groups and that does not affect the epsilon /gamma and epsilon /delta associations. Therefore, both sulfhydryl groups are, most likely, in a nonreduced state. To investigate the status of the sulfhydryl groups, the detergent lysate from COS cells transfected with CD3-epsilon and CD3-gamma was treated with 10 mM DTT to reduce disulfide bridges, followed by alkylation with 25 mM iodoacetamide to block the free sulfhydryl groups generated upon reduction. As shown in Fig. 8B, the combined treatment with DTT and iodoacetamide strongly inhibited (80%) the interaction of CD3-epsilon with CD3-gamma , as compared with the untreated control or to the sample treated only with iodoacetamide. Interestingly, the degree of inhibition was in the range of that obtained in the deletion of regions 5 and 6 or in the replacement of Cys97 and Cys100 by alanines (see Figs. 4 and 7). This is consistent with the idea that DTT affected the epsilon /gamma interaction via the involvement of Cys97 and Cys100. Although the DTT/iodoacetamide treatment could affect cysteines other than those of region 6, we have shown that deletions involving the other cysteines (deletions 2, 4, and 13) did not have an effect on the epsilon /gamma and epsilon /delta interactions (see Figs. 2 and 3). Nevertheless, an effect of the DTT/iodoacetamide treatment on other regions of CD3-gamma can not be dismissed.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 8.   Cysteines 97 and 100 in region 6 of CD3-epsilon form an intrachain disulfide loop. COS cells were transfected with the expression vector encoding for wild type CD3-epsilon and CD3-gamma . Immunoprecipitations using anti-CD3-epsilon (APA1/1) and anti CD3-gamma (HMT3.2) antibodies were carried out followed by immunoblotting with APA1/1 antibody. A, cell lysates were incubated with 10 mM phenanthroline for 30 min before immunoprecipitation and compared with untreated samples. B, immunoprecipitations were performed from cell lysates that had been sequentially incubated for 10 min with 10 mM DTT and then with 25 mM iodoacetamide (IAA), incubated just with 25 mM iodoacetamide, or left untreated (NT). Afterward, immunoprecipitations were performed, the immunoprecipitates were resolved by SDS-polyacrylamide gel electrophoresis, and immunoblotting was performed with APA1/1 to detect CD3-epsilon specifically precipitated with APA1/1 and coprecipitated with CD3-gamma . The positions of CD3-epsilon and immunoglobulin heavy (H) and light (L) chains are indicated.

CD3-epsilon Homodimerization Depends on the Same Region Involved in the Formation of epsilon ·gamma and epsilon ·delta Dimers-- Given the homology in regions 5 and 6 between CD3-epsilon and CD3-gamma and -delta , it would not be surprising if the region involved in the association of CD3-epsilon with CD3-gamma and CD3-delta also promotes the formation of homodimers. CD3-epsilon contains five cysteines that could participate in the formation of disulfide-linked homodimers. Two, found in regions 2 and 4, are supposedly implicated in intrachain loop formation, another one is in the transmembrane domain, and the remaining two cysteines are in region 6. To identify the cysteine residues that participate in homodimer formation, detergent lysates were obtained from COS cells transfected with wild type CD3-epsilon or with deletion mutants 2, 4, 6, and 13 that had been metabolically labeled with [35S]methionine and [35S]cysteine. CD3-epsilon proteins were immunoprecipitated from the lysates with antibody APA1/1 and run in two-dimensional diagonal gels under nonreducing/reducing conditions. In the wild type sample, as well as in deletions 2, 4, and 13, dimers and trimers of CD3-epsilon were identified as protein spots that ran below the diagonal (Fig. 9). In the sample corresponding to deletion 6, no oligomers of CD3-epsilon were detected, although the monomer was readily detected on the diagonal of the gel, suggesting that the cysteines of region 6 participate in the dimerization of CD3-epsilon .


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 9.   Formation of disulfide-linked homodimers by CD3-epsilon mutants. COS cells were transfected with the indicated mutants of CD3-epsilon , labeled with a [35S]methionine/cysteine mixture, and immunoprecipitated with APA1/1. The immunoprecipitates were resolved in diagonal gels under nonreducing (NR) and reducing (R) conditions. The monomeric, dimeric, and trimeric forms of CD3-epsilon are indicated with arrows. The relative masses of the monomer, dimer, and trimer were calculated to be 23, 38, and 63 kDa, respectively.

The above data suggest that the same region mediates the association of CD3-epsilon with CD3-gamma and CD3-delta and the formation of homodimers. This result would imply that the formation of CD3-epsilon homodimers is an alternative to the formation of epsilon ·gamma and epsilon ·delta heterodimers and that CD3-epsilon could either associate with itself or with CD3-gamma or CD3-delta . As shown in Fig. 10, in cells contransfected with wild type CD3-epsilon and CD3-gamma , and immunoprecipitated with CD3-epsilon - and CD3-gamma - specific antibodies, dimers, trimers, and other oligomers of CD3-epsilon and CD3-gamma were observed. However, only monomers of CD3-gamma were coprecipitated with the anti-epsilon antibody, and, conversely, only monomers of CD3-epsilon were coprecipitated with the anti-gamma antibody. These results suggest that CD3 homodimers do not associate with the other CD3 chains and reinforces the idea of the existence of a competition between homodimer and heterodimer formation of the CD3-gamma , -delta , and -epsilon chains, since regions 5 and 6 are involved in both processes.


View larger version (74K):
[in this window]
[in a new window]
 
Fig. 10.   Association of CD3-gamma with monomeric forms of CD3-epsilon . COS cells were transfected with either CD3-epsilon alone or CD3-epsilon plus CD3-gamma and were immunoprecipitated with antibodies APA1/1 (anti-epsilon ) or HMT3.2 (anti-gamma ). The immunoprecipitates were analyzed in diagonal gels under nonreducing/reducing conditions. The positions of monomeric and oligomeric forms of CD3-epsilon and CD3-gamma are indicated. The arrowheads show the positions of carbonic anhydrase (31 kDa) and trypsin inhibitor (21.5 kDa) used as molecular mass markers.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In the present study, we have mapped the region in CD3-epsilon that is responsible for binding to the CD3-gamma and CD3-delta chains. Previous reports have shown that CD3-gamma and CD3-delta compete for binding to CD3-epsilon , suggesting that CD3-gamma and CD3-delta are bound to the same site in CD3-epsilon (7). This has been now confirmed using a set of deletional mutants of CD3-epsilon . Four deletions resulted in inhibition of both CD3-gamma and CD3-delta binding. The four mutants corresponded to deletions in the extracellular domain of CD3-epsilon , suggesting that this domain is responsible for the interaction with CD3-gamma and CD3-delta . Indeed, deletions affecting the whole transmembrane domain or the cytoplasmic tail did not have an effect on CD3-epsilon /gamma and CD3-epsilon /delta interactions. Of the four deletion mutants (deletions 1, 14, 5, and 6), two were contiguous and corresponded to what is known as the connecting peptide in other immunoglobulin superfamily members. This sequence is located between the putative beta -barrel of CD3-epsilon and the transmembrane domain. The combined deletion of regions 5 and 6 resulted in a major effect on the epsilon /gamma interaction (64-95% inhibition), whereas the effect of the other two deletions (deletions 1 and 14) was minor (11-68% inhibition). These results point to the connecting peptide as the major region involved in epsilon /gamma and epsilon /delta interactions, although other regions must also contribute, since the double deletion 5 + 6 did not result in a complete inhibition. Nevertheless, a peptide corresponding to the equivalent region in CD3-gamma bound to CD3-epsilon , suggesting that this region is sufficient to promote CD3 interactions. Our results do not support those of Dietrich et al. (27). Using protein structure predictions, these authors made two mutants in sequences located between the A and B beta -sheets (site 17) and between the E and F sheets (site 56) of the putative immunoglobulin fold of CD3-gamma . They found that these two mutants were unable to associate to the other CD3 subunits. Site 56 corresponds to our deletion 3 in CD3-epsilon , which did not have an effect on the interaction with CD3-gamma , and site 17 corresponds to a sequence in CD3-epsilon found between our deletions 1 and 2. Deletion 2 did not affect the interaction with CD3-gamma , whereas deletion 1 only had a minor effect. Indeed, in our system, a deletion of site 17 in CD3-gamma did not alter the association with CD3-epsilon . The discrepancy between our results and those of Dietrich et al. could be explained by their utilization of UCHT1 as an anti-CD3-epsilon antibody when it has been previously established that it is a quaternary structure-dependent antibody that recognizes epsilon ·gamma and epsilon ·delta dimers (26). Therefore, the possibility cannot be excluded that mutations in sites 17 and 56 alter the epitope recognized by the conformation-dependent antibodies. Along this line, we cannot exclude that the major effect of deletions 1 and 14 in CD3-epsilon is to alter the epitope recognized by the conformation-dependent antibodies. In fact, a sequence proximal to region 14 has been proposed in chicken CD3-epsilon as the site for antibody CT3 recognition (24).

The 16-amino acid region (connecting peptide) involved in deletion 5 + 6 is highly conserved among the CD3-gamma , -delta , and -epsilon chains, both in terms of amino acid identity and of conservative replacements. This is particularly important, especially when considering that there is very little homology between the remaining extracellular domain of CD3-epsilon and the other CD3 chains. This region is not only involved in the formation of heterodimers but also, as a consequence of the sequence homology with CD3-gamma and CD3-delta , in homodimerization. Indeed, as shown here, both processes occur in an alternate manner, because the dimers and oligomers of CD3-epsilon were not associated with CD3-gamma .

According to their proximity in the genome (28, 29), the conservation of the exon/intron organization and sequence homology, it seems clear that CD3-epsilon , CD3-gamma , and CD3-delta have originated from two duplication events, of which, the process that generated CD3-gamma and CD3-delta is the most recent (30). Indeed, birds appear to have one chain that is homologous to both CD3-gamma and CD3-delta (31). The utilization of the same region in CD3-epsilon for the formation of homodimers and heterodimers with CD3-gamma and CD3-delta could be reminiscent of the evolutionary process, since, in a primitive ancestor when only one of the CD3 chains existed, the homodimers of this chain played the roles that the CD3-epsilon ·CD3-gamma and CD3-epsilon ·CD3-delta dimers play in mammalian T cells.

If the formation of homodimers of CD3 chains is a consequence of the high degree of conservation existing in the region involved in CD3/CD3 heterologous interactions, then it is unclear why CD3-gamma and CD3-delta do not interact directly. Although this interaction has not been detected in wild type proteins, it has been shown in CD3-gamma and CD3-delta mutants lacking the glutamic and aspartic acid residues located in their transmembrane region (17). These results support the notion that CD3-gamma and CD3-delta have the potential to associate but the interaction is impeded by the transmembrane domain acidic residues. It is more difficult to explain, however, the absence of such a negative effect in the CD3-