Assembly of the six-chain T cell antigen
receptor-CD3 complex takes place by pairwise interactions. Thus,
CD3-
interacts with either CD3-
or CD3-
, and these dimers then
associate with the TCR heterodimer (
·
or
·
) and the
CD3-
homodimer to constitute a full complex. We have now mapped the
site in CD3-
responsible for the interaction with CD3-
and
CD3-
by analysis of a series of deletional mutants encompassing the
most conserved regions. We found that the highly conserved
juxtamembrane domain is mainly responsible for the interaction. Thus,
deletion of this 16-amino acid extracellular sequence resulted in the
inhibition of up to 95% of the CD3-
/
interaction. A highly
conserved sequence is also present in both CD3-
and CD3-
,
suggesting that the domain in these two chains may reciprocally be
involved in the interaction with CD3-
. Indeed, an immobilized
synthetic peptide corresponding to the CD3-
sequence specifically
associated to a bacterially expressed CD3-
protein, suggesting the
16-amino acid domain is sufficient to promote CD3-
/CD3-
assembly.
The conservation of the motif in the CD3 chains suggest that, in
addition to CD3-
/CD3-
and CD3-
/CD3-
interactions, it may
also mediate homotypic interactions. Indeed, it is shown that it
mediates the formation of disulfide-linked homodimers and that the
formation of homo- and heterodimers are mutually excluded. Finally,
this domain contains a Cys-X-X-Cys sequence
that resembles that of p56lck, which is responsible for the
interaction with the cytoplasmic tails of CD4 and CD8. Since the
replacement of the two cysteines (Cys97 and
Cys100) in CD3-
by alanines strongly inhibited pair
formation, the existence of a Cys-X-X-Cys motif
involved in protein-protein interactions is suggested.
 |
INTRODUCTION |
The T cell antigen receptor complex
(TCR-CD3)1 is composed, in
most mature T cells, of six subunits (TCR-
, TCR-
, CD3-
,
CD3-
, CD3-
, and CD3-
) that serve the dual function of peptide
antigen/major histocompatibility complex recognition and signal
transduction to the cytoplasm (for reviews, see Refs. 1-4). The TCR
and CD3 components of the receptor have specialized roles in
determining both functions; while antigen/major histocompatibility
complex binding resides in the TCR-
·
heterodimer, the CD3
chains are able to interact with intracellular proteins involved in
signal transduction. The expression of TCR-CD3 on the cell surface is regulated in mature T cells in such a way that when one subunit is
absent the remaining complex is not expressed (for a review, see Ref.
4). However, the identity and the number of subunits that compose a
minimal TCR-CD3 complex remains controversial. In addition to the
existence of a TCR-
·
receptor that replaces the TCR-
·
,
other alternative forms of the receptor have been found, first by
identification of complexes containing an alternative splice form of
CD3-
, CD3-
, and/or the
-chain of the Fc
RI (5, 6). These two
chains can form heterodimers with CD3-
and replace CD3-
partially
or completely. Second, it has been suggested that the homologous chains
CD3-
and CD3-
can also form alternative complexes and that,
therefore, one can be expressed on the cell surface of T cells in the
absence of the other (7).
A different TCR-CD3 complex has been revealed in immature thymocytes,
where a surrogate TCR-
chain has been found associated to TCR-
and CD3 chains in thymocytes with prerearranged TCR-
(8). Complexes
of CD3 subunits not associated to TCR chains have also been found in
certain thymomas (9). Moreover, murine pro-T cells in
RAG-1
/
mice also have been shown to contain
TCR-independent CD3-
·
dimers on the cell surface that can be
stimulated by in vivo administration of anti-CD3 antibodies
to differentiate into pre-T cells (10). In addition,
·
dimers
and, to a lesser extent, 
dimers have been found associated to
calnexin in SCID thymocytes and on early thymocytes from normal mice
through the CD4+CD8+ stage (11, 12).
Assembly of the TCR-CD3 complex has been suggested to take place by
pairwise interactions that allow the formation of CD3
·
,
·
, and
·
dimers as well as TCR-
·
(12). The
association between TCR and CD3 chains seems to depend largely on the
interaction among transmembrane domains, where the basic amino acid
residues of the TCR chains and the acidic residues of the CD3 chains
are involved, perhaps forming salt bridges (13, 14). The importance of
the basic and acidic residues of the transmembrane domains is
highlighted by the conservation of the lysine residue in TCR-
and
TCR-
and especially by the conservation of the arginine and lysine
residues and their positions in TCR-
and its equivalents (TCR-
and pT
) (15). The transmembrane domain has also been shown to be
important in CD3-
dimerization (16). However, very little is known
of the mechanisms that govern the assembly of the CD3-
, -
, and
-
chains. CD3-
can interact with either CD3-
or CD3-
, but
CD3-
and CD3-
do not interact directly. Interestingly, the
removal of the acidic amino acids in the transmembrane domain of
CD3-
or CD3-
results in the formation of CD3-
·
heterodimers (17).
We have screened a collection of human CD3-
deletional mutants for
their ability to interact with CD3-
and CD3-
. We found that a
region in the extracellular domain of CD3-
, highly conserved in
CD3-
and CD3-
, is responsible for CD3-
and CD3-
dimer formation as well as the formation of homodimers.
 |
EXPERIMENTAL PROCEDURES |
Cells and Antibodies--
The COS-7 African green monkey cell
line was grown in Dulbecco's modified Eagle's medium supplemented
with 5% newborn calf serum (Life Technologies, Inc.).
Mouse monoclonal antibodies APA1/1 and APA1/2, specific for human
CD3-
and CD3-
, respectively, were obtained from purified CD3
proteins isolated from human thymus (7). The anti-CD3 antibody UCHT1
was generously donated by Dr. P. Beverley (Imperial Cancer Research
Fund, London). HMT3.2 is a hamster monoclonal antibody reactive toward
human CD3-
and murine CD3-
and CD3-
(7) that was generously
given by Dr. R. Kubo (National Jewish Center, Denver, CO).
Plasmids--
The pSR
-
, pSR
-
, and pSR
-
constructs were made as described (7). Deletions 1-13 in CD3-
were
generated by loop-out mutagenesis as described previously (18). The
CD3-
mutant 14 was constructed after two PCR amplifications. The
first amplification utilized primer 8 (XhoI restriction
site) as the 5'-primer (CCCCCTCGAGATGCAGTCGGGCACT) and an internal
oligonucleotide 126 (CGCTGCAGCGGCCGCAGCTTCAGATCCAGGATACTG) containing
alanine substitutions as the 3'-primer. The second part of the molecule
was amplified using a 5'-primer complementary to 126 (GCTGCGGCCGCTGCAGCGGATAAAAACATAGGCGGT) together with oligonucleotide 61 (containing a BamHI restriction site) as the 3'-primer
(GGGGATCCTCAGATGCGTCTCTGATT). Primer 61 corresponds to the most
carboxyl-terminal region. After hybridization of the previously
amplified fragments, a second round of PCR was performed with the
external primers 8 and 61. This fragment was cloned into the
XhoI and BamHI sites of the expression vector
pSR
. The double cysteine substitution in CD3-
was made as above
with the oligonucleotide 131 (CATCTCCATGGCGTTCTCAGCCACTCTTGC) and its
complementary form as internal primers. CD3-
deletion A was
generated with the internal primers 123 (CACAAGTCAGTTCTTGATAG) and 124 (CTATCAAGAACTGACTTGTG) that incorporate the mutant alanines followed by
amplification of the complete CD3-
with oligonucleotide 73 (CCCCTCGAGGACATGGAACAGGGGAAG) as the 5'-primer and oligonucleotide 112 (GGGGATCCTCTGAGTCCTGAGTTCA) as the 3'-primer. Because CD3-
cDNA
has an internal XhoI site, it was cloned into the pSR
vector by partial digestion. All constructs described were sequenced by
the fmol DNA Sequencing System (Promega Corp., Madison, WI) to exclude
the possible introduction of unwanted mutations.
COS Cell Transfections--
COS cells were transfected by
electroporation. Briefly, the cells were trypsinized, counted, and
resuspended at 10 × 106 cells/ml in Dulbecco's
modified Eagle's medium plus 10% fetal bovine serum and 10 mM HEPES, pH 7.4. A total of 200 µl of the cell
suspension was transferred to an electroporation cuvette (Bio-Rad), and
5 µg of the plasmid mixture was added as well as 20 µg of PUC-19
plasmid DNA (Promega) as a carrier. Cells were electroporated at 200 V,
960 microfarads in a Bio-Rad gene pulser, diluted with complete
Dulbecco's modified Eagle's medium, and plated on coverslips.
Immunofluorescence--
COS cells were fixed, 24-48 h after
transfection, with 2% paraformaldehyde for 20 min, washed with PBS,
blocked and permeabilized with 1% bovine serum albumin plus 0.1%
saponin in PBS for 1 h at room temperature, and incubated for
1 h with the anti-CD3 monoclonal antibodies. Afterward, the
coverslips were rinsed with PBS and incubated for an additional hour
with a fluorescein-conjugated goat anti-mouse Ig or a goat anti-hamster
Ig secondary antibody (Southern Biotechnology). The coverslips were
mounted with Mowiol, and cells were visualized on a Zeiss Axioskop
microscope. Photographs were taken on Kodak T-Max 400 film.
Radiolabeling--
Metabolic labeling was carried out on
transfected COS cells plated on 100-mm Petri dishes. Forty-eight hours
after transfection, the cells were washed with PBS and incubated for 30 min in methionine and cysteine-free Dulbecco's modified Eagle's
medium at 37 °C. Subsequently, 250 µCi of a
[35S]methionine and [35S]cysteine mixture
(Amersham Pharmacia Biotech) were added for 4 h. Afterward, the
cells were washed with PBS and lysed in 1% Nonidet P-40-containing
lysis buffer (1% Nonidet P-40, 150 mM NaCl, 20 mM Tris-HCl, pH 7.8, 10 mM iodoacetamide, 1 mM phenylmethylsulfonyl fluoride, and a 1 µg/ml
concentration each of leupeptin and aprotinin).
Immunoprecipitation and Deglycosylation Procedure--
In
immunoprecipitation studies, 1% Nonidet P-40 or radioimmune
precipitation buffer (20 mM Tris, pH 8.0, 0.15 M NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% deoxycholate, 1 mM EDTA, 1 mM EGTA, 1 mM
phenylmethylsulfonyl fluoride, and 1 µg/ml concentration of
leupeptin, aprotinin, and chemostatin) lysates were precleared three
times by incubation for 1 h with nonimmune mouse serum coupled to
protein A- and protein G-Sepharose beads (Sigma) followed by centrifugation at 12,000 × g in an Eppendorf
centrifuge. The precleared supernatants were subsequently incubated for
4 h at 4 °C with 2-4 µg of the specific antibodies coupled
to protein A- or protein G-Sepharose beads. Then the beads were washed
five times with 1 ml of lysis buffer and resuspended in Laemmli sample
buffer. SDS-polyacrylamide gel electrophoresis was performed on 13%
polyacrylamide gels. Two-dimensional electrophoresis under
nonreducing/reducing conditions was performed as described (7).
In deglycosylation studies, the immunoprecipitates were resuspended
after the last wash in 60 µl of a 0.15 M sodium citrate buffer, pH 5.5, containing 1 mM phenylmethylsulfonyl
fluoride and 0.25% SDS. The samples were boiled for 2 min, and 1 milliunit of endo-
-acetylgycosaminidase H (Boehringer Mannheim) was
added to half of each sample. The samples were incubated overnight at 37 °C and electrophoresed.
Western Blot Analysis--
Immunoprecipitated samples were run
on 13% acrylamide gels and were transferred onto nitrocellulose
membrane (Bio-Rad). The membrane was blocked in 10% nonfat milk in PBS
for 1 h and incubated with the desired antibody, diluted in
washing solution (PBS plus 0.1% Tween 20), for 1 h.
The membranes were washed five times with PBS-Tween and incubated for
another hour with a peroxidase-labeled species-specific anti-Ig
antibody (Amersham Pharmacia Biotech) diluted in PBS-Tween. Last, the
membrane was washed five times with PBS-Tween, and protein bands were
visualized with the enhanced chemiluminescence method (ECL, Amersham
Pharmacia Biotech). Densitometry analysis was performed in a Computing
Densitometer model 300A.
Immobilized Ligand Binding Assay--
A total of 1.4 mg of a
19-mer synthetic peptide (LQVYYRMCQNCIELNGSGK) that corresponds to
amino acids 79-93 (LQVYYRMCQNCIELN) of the human mature CD3-
protein were covalently coupled to a 1-ml HiTrap NHS-activated
agarose column (Amersham Pharmacia Biotech) through a 4-amino acid
spacer (GSGK). A control column was prepared by coupling a similar
amount of an irrelevant peptide (ERRRGKGHDGLYQGLSTATKDTYD) that
corresponds to an intracellular sequence of CD3-
. The efficiency of
coupling was estimated to be 80% in both cases by optical
absorbance.
To prepare the 35S-labeled extracellular domain of CD3-
,
a sequence encoding for amino acids 1-105 of the mature protein was obtained by PCR using oligonucleotide
GGCCTCGAGCATATGGATGGTAATGAGGAAATGGG as 5'-primer and oligonucleotide
GGGGGATCCTATCACGACATCACATCCATCTC as 3'-primer. The PCR product was
inserted into the NdeI and BamHI sites of the
pET3ax vector (New England Biolabs, Beverly, MA), and the resulting
construct was fully sequenced using the fmol DNA sequencing kit
(Promega) in order to verify the lack of PCR-induced errors. The
desired clone was transformed into the lysogenic Escherichia coli strain BL-21(DE3), and the correct expression of the
recombinant peptide was tested by immunoblotting and
immunoprecipitation of the induced protein with antibody SP34, which
specifically recognizes the extracellular part of CD3-
. Induction
and extraction of the protein was carried as follows: an overnight
culture of the clone was diluted 20-fold in M9 medium supplemented with
50 µg/ml ampicillin and 34 µg/ml chloramphenicol. After 4 h,
expression of the clone gene was induced with 1 mM
isopropyl-1-thio-
-D-galactopyranoside (Sigma) in the
presence of 50 µg/ml rifampicin (Sigma). Two hours later, bacteria
were labeled with [35S]methionine (0.5 µCi/ml)
(Amersham Pharmacia Biotech) for 15 min at 37 °C and subsequently
collected by centrifugation and resuspended in 2 ml of extraction
buffer (50 mM Tris, pH 8.0, 1 mM EDTA, 1%
Triton X-100) per 25 ml of culture. Afterward, 25 µl of 10%
deoxicolic acid and 20 µl of 1 mg/ml DNAse I were added and incubated
at 37 °C for 15 min with occasional shaking. Bacterial cell lysates
were centrifuged to eliminate the cell debris, and the supernatant (1 ml per column) was injected and incubated for 45 min on ice. The
columns were then rapidly rinsed with 10 column volumes of the
extraction buffer, and the bound material was eluted with three column
volumes of 50 mM triethylamine, pH 11.0. The eluates were
rapidly neutralized, and 100 µl were counted in a
-scintillation
counter. Equal volumes of both CD3-
column and control column
eluates were subjected to SDS-polyacrylamide gel electrophoresis.
For the peptide binding assay, 30 µg each of a synthetic peptide
corresponding to amino acids 89-105 of the human mature CD3-
protein (YLYLRARVCENCMEMDV) and of the irrelevant
-peptide were 125I-labeled by the chloramine T method (19). The iodinated
peptides were diluted to 1 × 106 cpm/ml in 1%
Nonidet P-40 immunoprecipitation buffer, and 1 ml of each was injected
into the CD3-
and CD3-
columns. After a 45-min incubation on ice,
the columns were rapidly rinsed with 10 column volumes of the
immunoprecipitation buffer, and bound material was eluted with 5 column
volumes of 50 mM triethylamine, pH 11.0. The eluates were
then counted in a
-scintillation counter.
 |
RESULTS |
Mapping the Region of CD3-
Involved in the Association with
CD3-
and CD3-
--
Previously, we had determined that CD3-
and CD3-
compete for binding to CD3-
, suggesting that both chains
bind to the same site in CD3-
(7). To determine the CD3-
and
CD3-
binding site in CD3-
, a series of human CD3-
deletional
mutants (Fig. 1) were used in
transfection studies, together with wild type CD3-
and CD3-
.
Because these deletions affected the most conserved regions of the
known CD3-
proteins (20-25) and because human and murine CD3 chains
are able to form interspecific hybrid complexes, it is believed that
the deleted sequences should contain the binding site. To explore the
ability of CD3-
and CD3-
to associate with the CD3-
mutants,
COS cells were cotransfected with either CD3-
or CD3-
and each
one of the mutants. The transfected cells were then stained with UCHT1,
an antibody previously shown to recognize the dimers of CD3-
with
CD3-
or CD3-
but not the isolated subunits (26). As shown in Fig.
2 (panels A and B),
the cells transfected with deletions 1, 5, 6, and 14 and either CD3-
or CD3-
were not stained with antibody UCHT1, although the
individual transfected chains were recognized by subunit-specific
antibodies APA1/1 (anti-
), APA1/2 (anti-
), and HMT3.2 (anti-
).
Other antibodies that recognize
·
and
·
dimers
(e.g. Leu4, OKT3) were also unable to recognize cells
cotransfected with either CD3-
or CD3-
and any one of the CD3-
deletional mutants 1, 5, 6, and 14 (data not shown). All other deletion
mutants were stained with UCHT1 when they were cotransfected with
CD3-
or CD3-
, suggesting that they formed
·
and
·
complexes (data not shown). Even those deletional mutants that should
have important conformational alterations, such as deletions 2 and 4, which lack the putative intrachain disulfide loop characteristic of the
immunoglobulin fold, and deletion 13, which lacks the membrane anchor,
were able to associate to CD3-
and CD3-
.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 1.
Comparison of the mature CD3- protein
sequences from different species. The CD3- sequences from
human, dog, sheep, cow, mouse, pig, and chicken were aligned for
comparison using the Pileup program. Amino acids involved in deletions
1-13 and in mutation 14 in human CD3- are underlined.
Conserved residues are in boldface type. Deletion 13 spans
the transmembrane domain.
|
|

View larger version (103K):
[in this window]
[in a new window]
|
Fig. 2.
Immunofluorescence analysis of the
association of CD3- with CD3- and CD3- . COS cells were
transfected with expression vectors encoding for wild type or the
indicated mutants of CD3- and either CD3- (A) or
CD3- (B). Indirect immunofluorescent staining was
performed with antibodies APA1/1 (anti-CD3- ), HMT3.2 (anti-CD3- ),
APA1/2 (anti-CD3- ), and UCHT1 (specific for CD3- · and
CD3- · dimers). Photographs were taken at a × 400 magnification.
|
|
These experiments suggested that deletions 1, 5, 6, and 14 prevented
the association of CD3-
with CD3-
and CD3-
or, alternatively, that they altered the binding site for antibodies UCHT1, Leu 4, etc. In
order to distinguish between both possibilities, an immunoprecipitation experiment with subunit-specific antibodies was performed. COS cells
were transfected with different CD3-
constructs, together with
CD3-
, and were metabolically labeled with a
[35S]methionine and [35S]cysteine mixture.
For these experiments, a double deletional mutant of regions 5 and 6 was produced that, as expected, was not stained by
conformation-dependent antibodies when cotransfected with
either CD3-
or CD3-
(data not shown). Radioimmune precipitation buffer lysates from doubly transfected cells were immunoprecipitated with antibodies HMT3.2 and APA1/1 that recognize isolated CD3-
and
CD3-
chains, respectively. Half of each immunoprecipitate was
treated with endo-
-acetylglycosaminidase H to better distinguish between glycosylated CD3-
and the nonglycosylated CD3-
. As
shown in Fig. 3A, the
immunoprecipitation with APA1/1 from cells cotransfected with CD3-
and wild type CD3-
resulted in the coprecipitation of CD3-
, which
characteristically runs as 25 kDa in untreated samples and as a 17-kDa
protein when it is deglycosylated (d
). Upon
deglycosylation, the 23-kDa CD3-
chain remained unmodified. Of note,
the mobilities of CD3-
mutants were frequently different from that
of the wild type form, and their position is indicated with
arrowheads in Fig. 3. Only two deletions, deletion 5 + 6 and
deletion 9 seemed to affect binding to CD3-
, since
immunoprecipitation with APA1/1 did not coprecipitate any detectable
CD3-
. However, the reverse immunoprecipitation with anti-CD3-
antibody HMT3.2 showed similar levels of deletion 9 and
wt,
suggesting that, indeed, deletion 9 did not affect the association with
CD3-
(data not shown). Furthermore, the immunoprecipitation with
APA1/1 had not shown any detectable CD3-
, strongly suggesting that
the sequence eliminated in deletion 9 constitutes the recognition site
for APA1/1. Interestingly, deletion 5 + 6 was the only deletion that considerably affected the
/
interaction, as shown by
immunoprecipitation with anti-
and anti-
antibodies (Fig. 3,
A and B). Deletion mutants 1 and 14 were clearly
coprecipitated by the anti-
antibodies (Fig. 3B), and
conversely, CD3-
was clearly coprecipitated by the anti-
antibody
in cells cotransfected with these mutants (Fig. 3A). These
results suggest that the only deletion that had a major effect on the
interaction with CD3-
corresponded to regions 5 + 6. Nevertheless,
because region 6 contains two of a total of four methionines and two of
a total of five cysteines, it is difficult to quantitate the amount of
protein relative to the wild type control in the experiments shown in
Fig. 3. In order to generate quantifiable results, the
immunoprecipitation with subunit-specific anti-
and anti-
antibodies was followed by immunoblotting with the opposite antibody.
As shown in Fig. 4, immunoprecipitation
with anti-
antibody (HMT3.2) resulted in less deletion 5 + 6 coprecipitated as compared with that of the wild type. To control the
efficiency of transfection, the membrane was stripped and reprobed with
the anti-
antibody. Densitometric scans of the bands corresponding
to CD3-
and CD3-
showed that the level of the coprecipitated
deletion 5 + 6 mutant was one-third of that of the wild type, whereas
deletions 1 and 14 had only a marginal effect. The immunoprecipitation
with the anti-
antibody followed by immunoblotting with the anti-
antibody showed comparatively similar results, although the effects
were more pronounced. CD3-
was barely coprecipitated in cells
transfected with deletion 5 + 6, although the levels of CD3-
detected after reprobing the membrane with APA1/1 showed in all cases
similar levels of transfected CD3-
. A densitometric scan of the
CD3-
and CD3-
bands revealed that deletions 1 and 14 inhibited
the association to CD3-
by 2-3-fold, whereas deletion 5 + 6 inhibited it by 20-fold. The fact that deletion 5 + 6 causes a 3-fold
reduction in formation of CD3-
·CD3-
heterodimers when
immunoprecipitation was carried out with anti-
antibody and a
20-fold reduction when immunoprecipitation was performed with anti-
could be due to an excess of expression of one transfected product over
the other. As a control for the specificity of the
immunoprecipitations, COS cells were transfected with
wt and a CD4
chimera that is endoplasmic reticulum-retained (18). The
immunoprecipitation with either anti-CD4 or anti-CD3-
antibodies did
not show any evidence of association (data not shown).

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 3.
Deletion of regions 5 and 6 inhibit the
interaction with CD3- . COS cells were transfected with
expression vectors encoding for wild type CD3- ( wt) or the
indicated mutants of CD3- plus wild type CD3- . Cells were
metabolically labeled with a [35S]methionine-cysteine
mixture, and proteins were immunoprecipitated with antibodies against
CD3- (APA1/1; panel A) or anti CD3- (HMT3.2;
panel B). Half of each sample was incubated with
endo- -acetylgycosaminidase H (+) or left untreated ( ). The
positions of the CD3- mutants are indicated by
arrowheads. d , deglycosylated CD3- ;
nms, nonimmune serum.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 4.
Quantitation of / interactions by
Western blot analysis. Deletions 1, 5 + 6, and 14 were
cotransfected with CD3- in COS cells. The samples were divided, and
immunoprecipitation was performed with anti CD3- , HMT3.2
(left) or anti CD3- , APA1/1 (right), followed
by immunoblotting with the indicated antibody. The quantity of CD3-
and CD3- specifically immunoprecipitated in each case was estimated
by reprobing the membranes with the antibodies used for
immunoprecipitation. The ratios of coprecipitated proteins were
analyzed by densitometry and are shown at the bottom as percentages of
the coprecipitating chains obtained with wild type CD3- . The
positions of CD3- , CD3- , and immunoglobulin light chain
(L) are indicated.
|
|
Dietrich et al. (27) have described that two sites in human
CD3-
mediated binding to CD3-
. One, that they named site 17, corresponds to part of regions 1 and 2 of CD3-
and involved five amino acids (Fig. 5A). The
other site, named 56, of CD3-
homologous to region 3 of CD3-
involved four amino acids. According to our results, of the CD3-
deletions that affected the corresponding regions in CD3-
(deletions
1, 2, and 3), only deletion 1 had an effect on the association to
CD3-
(Figs. 2 and 4). However, this was only a minor effect (Figs. 3
and 4). In order to solve this discrepancy, we made a deletion in
CD3-
that eliminated the five amino acids of site 17, and this
mutant (CD3-
delA) was then cotransfected with
wt into COS cells.
After metabolic labeling and immunoprecipitation with anti-
and
anti-
antibodies, no difference was detected in the ability of
delA and
wt to associate with
wt (Fig. 5B).

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of mutation of site 17 in CD3- on
the association with CD3- . A, Amino acid sequence of
human CD3- , indicating sites 17 and 56 (boldface type)
according to Dietrich et al. (27) and their corresponding
CD3- deletions. The five amino acids of site 17 were replaced by
alanines (CD3- A). B, COS cells were transfected with the
expression vector encoding for wild type CD3- plus CD3- A and
metabolically labeled with [35S]methionine/cysteine
mixture. Antibodies APA1/1 (anti-CD3- ) and HMT3.2 (anti CD3- )
were used for immunoprecipitation. Half of the samples were untreated
( ) or treated (+) with endo- -acetylgycosaminidase H
(endoH) and resolved on 13% acrylamide gels. Positions of
CD3- , CD3- , and deglycosylated CD3- (d ) are
indicated.
|
|
A Peptide from the CD3-
Equivalent to CD3-
's Region 5 + 6 Is
Sufficient to Promote Interaction with CD3-
--
The results
shown in Figs. 2-4 suggest that the 16 amino acids of the
extracellular domain of CD3-
most proximal to the transmembrane domain constitute the major region involved in CD3-
binding and, according to the immunofluorescence stainings (Fig. 2), in CD3-
binding. This region is contained in the equivalent to the connecting peptide region found in the immunoglobulin family and constitutes the
stretch of highest homology with CD3-
and CD3-
. Thus, in region 5 + 6 human CD3-
shares 37% identical amino acids with CD3-
and
31% with CD3-
(Fig. 6A) as
compared with an overall homology of 22 and 20% respectively, for the
whole extracellular domains. Furthermore, taking into consideration the
number of identical positions and conservative substitutions in the 5 + 6 region (Leu for Val, Val for Met, Glu for Gln, Met for Ile and Val,
and Asp for Asn), the homology with CD3-
increases to 75% and with
CD3-
to 69%. It would not be surprising then that if the 5 + 6 sequence of CD3-
is involved in the association with CD3-
and
CD3-
, the equivalent regions in CD3-
and CD3-
were involved in
CD3-
binding. To confirm this hypothesis, a synthetic peptide
corresponding to the CD3-
sequence was covalently coupled to an
agarose column, and a [35S]methionine-labeled bacterial
extract expressing the full extracellular domain of the mature CD3-
protein (amino acids 1-105) was passed through the column. As a
control of binding, a column made with an irrelevant peptide was
incubated, rinsed, and eluted in the same conditions. As shown in Fig.
6B, CD3-
bound efficiently and specifically to the
CD3-
sequence. To determine whether the immobilized CD3-
peptide
actually bound the connecting peptide region of CD3-
, a similar
experiment to the one shown in Fig. 6B was carried out. In
this case, a 125I-labeled peptide corresponding to the
connecting peptide region of CD3-
was passed through the CD3-
column. As control for specificity, the same peptide was passed through
the irrelevant peptide (
) column. As shown in Fig. 6C,
the CD3-
peptide bound to the CD3-
and not to the irrelevant
column. An additional control was established by passing a
125I-labeled preparation of the irrelevant peptide through
both columns. The CD3-
column bound the CD3-
peptide but not the
irrelevant one (Fig. 6C). In summary, the data shown in Fig.
6, B and C, demonstrate that the region in
CD3-
equivalent to 5 + 6 in CD3-
is also involved in CD3-
binding and that the sequence is by itself sufficient to promote
binding. Therefore, the region 5 + 6 delineates a conserved sequence in
the CD3 chains that is both necessary and sufficient to promote CD3
interactions. Nevertheless, although weak, the effect of deletions 1 and 14 on CD3 pair formation (Fig. 4) suggests that other regions may
be minor contributors to assembly.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6.
The equivalent in CD3- to region 5 + 6 of
CD3- is sufficient to promote the association of CD3- .
A, sequence comparison of region 5 + 6 of CD3- with its
counterpart in CD3- and CD3- . Residues that are conserved in at
least two subunits are shown in boldface type. B,
the CD3- connecting peptide is sufficient to bind the extracellular
portion of CD3- . A 35S-labeled bacterial cell lysate
expressing the extracellular domain of CD3- was passed through a
column containing a covalently bound peptide corresponding to the
connecting peptide of CD3- (lanes 2 and 4) or
containing an irrelevant control peptide (lanes 1 and
3). The columns were rinsed, and equal volumes of the
unbound material were loaded in lanes 1 and 2,
whereas the bound material was eluted from both columns and equal
volumes were loaded in lanes 3 and 4. The column
with immobilized CD3- peptide bound 16% of the loaded
radioactivity, whereas the control column bound only a 3%.
C, the CD3- connecting peptide binds the equivalent
region in CD3- . 125I-Labeled peptides corresponding to
amino acids 89-105 of CD3- ( ) and to an irrelevant sequence
( ) were passed through columns containing immobilized the CD3-
peptide ( ) or the irrelevant peptide ( ). The columns were rinsed,
and the bound material was eluted and counted. A total of 1 × 106 cpm of labeled peptides were loaded per column.
|
|
Two Cysteines in Region 6 of CD3-
Are Involved in the
Association with CD3-
and CD3-
and May Form an Intrachain
Disulfide Loop--
The two cysteines of the CD3 association region
are conserved not only in all described CD3-
cDNAs (Fig. 1) but
also in all CD3-
and CD3-
chains (not shown). To prove the
possible involvement of the two cysteines in CD3 pair formation, we
made a double mutation of the two cysteines (positions 97 and 100 of
the human mature protein) to alanines (Fig. 6A). The double
mutant was transfected in COS cells together with CD3-
or CD3-
,
and the effect on the association was analyzed by immunoprecipitation
with anti-
followed by blotting with anti-
or anti-
antibodies. As shown in Fig. 7, the
double cysteine mutant associated much less efficiently to both CD3-
and CD3-
than the wild type. The inhibition caused by the double
cysteine mutation was in the range of the inhibition obtained with the
deletional mutant 5 + 6. These results further support the idea that
regions 5 and 6 of CD3-
constitute the major binding site for
CD3-
and CD3-
and that either one or both of the conserved
cysteines are involved in that interaction.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 7.
Role of Cys97 and
Cys100 of CD3- in the association with CD3- and
CD3- . COS cells were transfected with CD3- or CD3- and
either wild type CD3- or CD3- doubly mutated in Cys97
and Cys100 to alanine (mut). Samples were
immunoprecipitated with APA1/1 (anti- ), and blotting was performed
with HMT3.2 (anti- ) or APA1/2 (anti- ). The two panels
at the bottom show the result of stripping and reprobing the
same membrane with APA1/1 as a control for the efficiency of
transfection. The percentage of coprecipitated CD3- and CD3-
chains is calculated in reference to the amount of transfected CD3-
and considering the level obtained with wild type CD3- as
100%.
|
|
Since the cysteines in region 6 that appear to be involved in the
association with CD3-
and CD3-
are also present in these two
chains, it would be possible that in the interactions
/
and
/
a Zn2+ cation is coordinated by the sulfhydryl
groups of the four cysteines involved. To determine whether this is so,
detergent lysates of COS cells doubly transfected with these chains
were incubated with 10 mM phenanthroline, a well known
Zn2+ chelator, before immunoprecipitation with anti-
and
anti-
antibodies. The formation of
·
dimers was analyzed by
Western blotting with the anti-
antibody. As shown in Fig.
8A, the addition of
phenanthroline did not have a detectable effect on the
/
interaction, since similar amounts of CD3-
were coprecipitated by
the anti-
antibody from the treated and the untreated samples. Thus,
these results do not support the involvement of Zn2+
cations in the
/
interaction. However, these data raise the question of how Cys97 and Cys100 intervene.
Because the
/
and
/
interactions are not covalent, these
two cysteines cannot form interchain disulfide bridges. However, they
may form an internal miniloop. Indeed, the immunoprecipitation buffer
commonly used in our experiments contains 10 mM
iodoacetamide, an alkylating agent that binds to free sulfhydryl groups
and that does not affect the
/
and
/
associations.
Therefore, both sulfhydryl groups are, most likely, in a nonreduced
state. To investigate the status of the sulfhydryl groups, the
detergent lysate from COS cells transfected with CD3-
and CD3-
was treated with 10 mM DTT to reduce disulfide bridges,
followed by alkylation with 25 mM iodoacetamide to block
the free sulfhydryl groups generated upon reduction. As shown in Fig.
8B, the combined treatment with DTT and iodoacetamide
strongly inhibited (80%) the interaction of CD3-
with CD3-
, as
compared with the untreated control or to the sample treated only with
iodoacetamide. Interestingly, the degree of inhibition was in the range
of that obtained in the deletion of regions 5 and 6 or in the
replacement of Cys97 and Cys100 by alanines
(see Figs. 4 and 7). This is consistent with the idea that DTT affected
the
/
interaction via the involvement of Cys97
and Cys100. Although the DTT/iodoacetamide treatment could
affect cysteines other than those of region 6, we have shown that
deletions involving the other cysteines (deletions 2, 4, and 13) did
not have an effect on the
/
and
/
interactions (see Figs. 2
and 3). Nevertheless, an effect of the DTT/iodoacetamide treatment
on other regions of CD3-
can not be dismissed.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 8.
Cysteines 97 and 100 in region 6 of CD3-
form an intrachain disulfide loop. COS cells were transfected with
the expression vector encoding for wild type CD3- and CD3- .
Immunoprecipitations using anti-CD3- (APA1/1) and anti CD3-
(HMT3.2) antibodies were carried out followed by immunoblotting with
APA1/1 antibody. A, cell lysates were incubated with 10 mM phenanthroline for 30 min before immunoprecipitation and
compared with untreated samples. B, immunoprecipitations
were performed from cell lysates that had been sequentially incubated
for 10 min with 10 mM DTT and then with 25 mM
iodoacetamide (IAA), incubated just with 25 mM
iodoacetamide, or left untreated (NT). Afterward,
immunoprecipitations were performed, the immunoprecipitates were
resolved by SDS-polyacrylamide gel electrophoresis, and immunoblotting
was performed with APA1/1 to detect CD3- specifically precipitated
with APA1/1 and coprecipitated with CD3- . The positions of CD3-
and immunoglobulin heavy (H) and light (L) chains
are indicated.
|
|
CD3-
Homodimerization Depends on the Same Region Involved in the
Formation of
·
and
·
Dimers--
Given the homology in
regions 5 and 6 between CD3-
and CD3-
and -
, it would not be
surprising if the region involved in the association of CD3-
with
CD3-
and CD3-
also promotes the formation of homodimers. CD3-
contains five cysteines that could participate in the formation of
disulfide-linked homodimers. Two, found in regions 2 and 4, are
supposedly implicated in intrachain loop formation, another one is in
the transmembrane domain, and the remaining two cysteines are in region
6. To identify the cysteine residues that participate in homodimer
formation, detergent lysates were obtained from COS cells transfected
with wild type CD3-
or with deletion mutants 2, 4, 6, and 13 that
had been metabolically labeled with [35S]methionine and
[35S]cysteine. CD3-
proteins were immunoprecipitated
from the lysates with antibody APA1/1 and run in two-dimensional
diagonal gels under nonreducing/reducing conditions. In the wild type
sample, as well as in deletions 2, 4, and 13, dimers and trimers of
CD3-
were identified as protein spots that ran below the diagonal
(Fig. 9). In the sample corresponding to
deletion 6, no oligomers of CD3-
were detected, although the monomer
was readily detected on the diagonal of the gel, suggesting that the
cysteines of region 6 participate in the dimerization of CD3-
.

View larger version (73K):
[in this window]
[in a new window]
|
Fig. 9.
Formation of disulfide-linked homodimers by
CD3- mutants. COS cells were transfected with the indicated
mutants of CD3- , labeled with a
[35S]methionine/cysteine mixture, and immunoprecipitated
with APA1/1. The immunoprecipitates were resolved in diagonal gels
under nonreducing (NR) and reducing (R)
conditions. The monomeric, dimeric, and trimeric forms of CD3- are
indicated with arrows. The relative masses of the monomer,
dimer, and trimer were calculated to be 23, 38, and 63 kDa,
respectively.
|
|
The above data suggest that the same region mediates the association of
CD3-
with CD3-
and CD3-
and the formation of homodimers. This
result would imply that the formation of CD3-
homodimers is an
alternative to the formation of
·
and
·
heterodimers and that CD3-
could either associate with itself or with CD3-
or
CD3-
. As shown in Fig. 10, in cells
contransfected with wild type CD3-
and CD3-
, and
immunoprecipitated with CD3-
- and CD3-
- specific antibodies,
dimers, trimers, and other oligomers of CD3-
and CD3-
were
observed. However, only monomers of CD3-
were coprecipitated with
the anti-
antibody, and, conversely, only monomers of CD3-
were
coprecipitated with the anti-
antibody. These results suggest that
CD3 homodimers do not associate with the other CD3 chains and
reinforces the idea of the existence of a competition between homodimer
and heterodimer formation of the CD3-
, -
, and -
chains, since
regions 5 and 6 are involved in both processes.

View larger version (74K):
[in this window]
[in a new window]
|
Fig. 10.
Association of CD3- with monomeric forms
of CD3- . COS cells were transfected with either CD3- alone
or CD3- plus CD3- and were immunoprecipitated with antibodies
APA1/1 (anti- ) or HMT3.2 (anti- ). The immunoprecipitates were
analyzed in diagonal gels under nonreducing/reducing conditions. The
positions of monomeric and oligomeric forms of CD3- and CD3- are
indicated. The arrowheads show the positions of carbonic
anhydrase (31 kDa) and trypsin inhibitor (21.5 kDa) used as molecular
mass markers.
|
|
 |
DISCUSSION |
In the present study, we have mapped the region in CD3-
that is
responsible for binding to the CD3-
and CD3-
chains. Previous reports have shown that CD3-
and CD3-
compete for binding to CD3-
, suggesting that CD3-
and CD3-
are bound to the same site in CD3-
(7). This has been now confirmed using a set of deletional mutants of CD3-
. Four deletions resulted in inhibition of both CD3-
and CD3-
binding. The four mutants corresponded to deletions in the extracellular domain of CD3-
, suggesting that this domain is
responsible for the interaction with CD3-
and CD3-
. Indeed, deletions affecting the whole transmembrane domain or the cytoplasmic tail did not have an effect on CD3-
/
and CD3-
/
interactions. Of the four deletion mutants (deletions 1, 14, 5, and 6),
two were contiguous and corresponded to what is known as the connecting peptide in other immunoglobulin superfamily members. This sequence is
located between the putative
-barrel of CD3-
and the
transmembrane domain. The combined deletion of regions 5 and 6 resulted
in a major effect on the
/
interaction (64-95% inhibition),
whereas the effect of the other two deletions (deletions 1 and 14) was minor (11-68% inhibition). These results point to the connecting peptide as the major region involved in
/
and
/
interactions, although other regions must also contribute, since the
double deletion 5 + 6 did not result in a complete inhibition.
Nevertheless, a peptide corresponding to the equivalent region in
CD3-
bound to CD3-
, suggesting that this region is sufficient to
promote CD3 interactions. Our results do not support those of Dietrich et al. (27). Using protein structure predictions, these
authors made two mutants in sequences located between the A and B
-sheets (site 17) and between the E and F sheets (site 56) of the
putative immunoglobulin fold of CD3-
. They found that these two
mutants were unable to associate to the other CD3 subunits. Site 56 corresponds to our deletion 3 in CD3-
, which did not have an effect
on the interaction with CD3-
, and site 17 corresponds to a sequence in CD3-
found between our deletions 1 and 2. Deletion 2 did not affect the interaction with CD3-
, whereas deletion 1 only had a
minor effect. Indeed, in our system, a deletion of site 17 in CD3-
did not alter the association with CD3-
. The discrepancy between our
results and those of Dietrich et al. could be explained by
their utilization of UCHT1 as an anti-CD3-
antibody when it has been
previously established that it is a quaternary
structure-dependent antibody that recognizes
·
and
·
dimers (26). Therefore, the possibility cannot be excluded
that mutations in sites 17 and 56 alter the epitope recognized by the
conformation-dependent antibodies. Along this line, we
cannot exclude that the major effect of deletions 1 and 14 in CD3-
is to alter the epitope recognized by the
conformation-dependent antibodies. In fact, a sequence
proximal to region 14 has been proposed in chicken CD3-
as the site
for antibody CT3 recognition (24).
The 16-amino acid region (connecting peptide) involved in deletion 5 + 6 is highly conserved among the CD3-
, -
, and -
chains, both in
terms of amino acid identity and of conservative replacements. This is
particularly important, especially when considering that there is very
little homology between the remaining extracellular domain of CD3-
and the other CD3 chains. This region is not only involved in the
formation of heterodimers but also, as a consequence of the sequence
homology with CD3-
and CD3-
, in homodimerization. Indeed, as
shown here, both processes occur in an alternate manner, because the
dimers and oligomers of CD3-
were not associated with CD3-
.
According to their proximity in the genome (28, 29), the conservation
of the exon/intron organization and sequence homology, it seems clear
that CD3-
, CD3-
, and CD3-
have originated from two duplication
events, of which, the process that generated CD3-
and CD3-
is the
most recent (30). Indeed, birds appear to have one chain that is
homologous to both CD3-
and CD3-
(31). The utilization of the
same region in CD3-
for the formation of homodimers and heterodimers
with CD3-
and CD3-
could be reminiscent of the evolutionary
process, since, in a primitive ancestor when only one of the CD3 chains
existed, the homodimers of this chain played the roles that the
CD3-
·CD3-
and CD3-
·CD3-
dimers play in mammalian T
cells.
If the formation of homodimers of CD3 chains is a consequence of the
high degree of conservation existing in the region involved in CD3/CD3
heterologous interactions, then it is unclear why CD3-
and CD3-
do not interact directly. Although this interaction has not been
detected in wild type proteins, it has been shown in CD3-
and
CD3-
mutants lacking the glutamic and aspartic acid residues located
in their transmembrane region (17). These results support the notion
that CD3-
and CD3-
have the potential to associate but the
interaction is impeded by the transmembrane domain acidic residues. It
is more difficult to explain, however, the absence of such a negative
effect in the CD3-