![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 21, 13097-13103, May 22, 1998
2 Leukocyte Integrin)
Promoter*
,From the Division of Hematology, Brown University Department of Medicine and the Division of Hematology/Oncology, The Miriam Hospital, Providence, Rhode Island 02906
| |
ABSTRACT |
|---|
|
|
|---|
CD18, the
chain of the leukocyte integrins,
plays a crucial role in immune and inflammatory responses. CD18 is
expressed exclusively by leukocytes, and it is transcriptionally
regulated during the differentiation of myeloid cells. The
ets factors, PU.1 and GABP, bind to three ets
sites in the CD18 promoter, which are essential for high level myeloid
expression of CD18. We now identify two binding sites for the
transcription factor, Sp1, that flank these ets sites. Sp1
is the only factor from myeloid cells that binds to these sites in a
sequence-specific manner. Mutagenesis of these sites abrogates Sp1
binding and significantly reduces the activity of the transfected CD18
promoter in myeloid cells. Transfection of Sp1 into
Drosophila Schneider cells, which otherwise lack Sp1,
activates the CD18 promoter dramatically. GABP also activates the CD18
promoter in Schneider cells. Co-transfection of Sp1 and GABP activates
CD18 more than the sum of their individual effects, indicating that
these factors cooperate to transcriptionally activate myeloid
expression of CD18. These studies support a model of high level,
lineage-restricted gene expression mediated by cooperative interactions
between widely expressed transcription factors.
| |
INTRODUCTION |
|---|
|
|
|---|
Monocytes and granulocytes, which are collectively known as myeloid cells, play crucial roles in immune and inflammatory responses. As myeloid cells differentiate from immature bone marrow precursor cells, they express characteristic genes that are required in their roles as immune effector cells. Most genes that are expressed during myeloid differentiation are regulated at the level of transcription (1). Characterization of the DNA sequences and transcription factors that control myeloid gene expression has provided important insights into the molecular basis of normal myeloid differentiation.
CD18 (
2 leukocyte integrin) is a cell surface adhesion
molecule that forms heterodimers with CD11a, CD11b, or CD11c to
generate the antigens LFA-1, Mo-1 (Mac-1), and p150/95, respectively.
These leukocyte-specific receptors mediate cell-cell and cell-matrix interactions and play important roles in immune and inflammatory responses (2). The clinical significance of CD18 is illustrated by
leukocyte adhesion deficiency, in which insufficient CD18 causes recurrent bacterial and fungal infections and can lead to premature death (3).
Expression of CD18 is restricted to myeloid cells and lymphocytes. CD18 expression increases significantly during myeloid differentiation due to increased transcription (4-7). We (4) and others (8, 9) have cloned the gene that encodes CD18 and characterized its promoter. The transfected CD18 promoter exhibits the leukocyte-specific and myeloid-inducible activity of the endogenous CD18 gene (10). We have previously shown that two ets-related transcription factors, PU.1 and GABP, bind to the CD18 promoter and cooperate to activate leukocyte-specific expression of CD18 (10, 11).
Sp1 is a DNA-binding nuclear protein that functions as a transcriptional activator (12-14). We now define two functionally important Sp1 binding sites which flank the three ets sites in the CD18 promoter. Although Sp1 is a member of a family of transcription factors that bind to related GC-rich sequences, Sp1 is the only protein from myeloid nuclear extracts that binds to these sites. Mutagenesis of these sites abrogates Sp1 binding and substantially reduces activity of the CD18 promoter in myeloid cells. Transfection of Sp1 into Drosophila Schneider cells, which otherwise lack Sp1, substantially activates the CD18 promoter. GABP also activates the CD18 promoter in Schneider cells. Finally, Sp1 functionally cooperates with GABP to activate the CD18 promoter. Thus, Sp1 is essential for high level myeloid expression of CD18 and it cooperates with the ets factor, GABP, to achieve high level myeloid expression of the CD18 promoter.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Cell Culture and Transfection-- U937 (ATCC no. CRL 1593) cells were passaged twice weekly in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% fetal calf serum (ICN, Costa Mesa, CA) in an atmosphere of 5% CO2. About 5 × 106 cells were transfected, as described previously, with 20 µg of CD18/luciferase constructs and 1 µg of cytomegalovirus promoter/human growth hormone construct (CMV/hGH),1 and promoter activity is expressed as normalized relative light units (4). Transfection results represent the mean and S.E. from three or more separate experiments.
Schneider cells (ATCC CRL-1963; Drosophila melanogaster embryo line 2) were passaged weekly at 22-24 °C in Schneider's Drosophila Medium (Sigma) supplemented with 10% fetal calf serum. Cells were transfected by the calcium phosphate method with 5 µg of CD18/luciferase constructs and 2.5 µg of the effector molecules pPac-Sp1 (full-length Sp1 in the pPac expression vector; a gift of Robert Tjian, Berkeley, CA), pPac-GABP
, and/or pPac-GABP
(gifts of Nancy Speck, Hanover, NH), and additional carrier DNA
to equalize the amount of transfected DNA in each sample. Luciferase
activity was measured 48 h later and results represent data from
three or more separate experiments.
Electrophoretic Mobility Shift Assay (EMSA)--
The sequence of
the CD18 promoter and the locations of the Sp1 and ets
binding sites are presented in Fig.
1A. EMSA was performed with
the following DNA probes, and their complementary strands: wild type
distal Sp1 site (
89/
76): TCGAGTGCAACCCACCACA; mutant distal Sp1 site (
89/
76): TCGAGTGCAACCATCCACA; wild type
proximal Sp1 site (
32/+3):
TCACGACCCGCGCCTCCAGCTGAGGTTTCTAGACG; and mutant proximal
Sp1 site (
32/+3):
TCACGACCGAATTCTCCAGCTGAGGTTTCTAGACG. The probes
include overhanging ends that permit labeling with [
-32P]dCTP (ICN) by the Klenow fragment of DNA
polymerase I (New England Biolabs, Beverly, MA).
|
-mercaptoethanol, 1% Ficoll and
poly(dI·dC) (Pharmacia Biotech Inc.; 2.0 µg for nuclear extracts,
1.5 µg for purified Sp1). Binding reactions with purified Sp1 also
included 1.5 µg of bovine serum albumin, as recommended by the
manufacturer.
Where indicated, binding competition was performed with a 100-fold
molar excess of the following double-stranded, unlabeled DNA probes:
homologous probe, mutant probes described above, or irrelevant probe
that lacks an Sp1 binding site (corresponding to CD18
903/
883,
GCGAAGCTTGCAGTGAGCTGAGATCACGGATCCGCG, and its complement). Products
were electrophoresed at 180 V in a 5% acrylamide/bisacrylamide (19:1)
gel in 0.25× TBE (1× TBE is 90 mM Tris base, 90 mM boric acid, 2 mM EDTA) prior to
autoradiography. For supershift experiments, reactions were
preincubated for 10 min on ice with 1 µl of polyclonal rabbit
antiserum raised against Sp1 (Santa Cruz Biotechnology, Santa Cruz, CA)
or preimmune serum.
Mutagenesis of Sp1 Sites in CD18 Promoter--
Polymerase chain
reaction (PCR) was used to generate CD18 promoter constructs with the
same Sp1 site mutations that were incorporated into the EMSA probes,
described above. The mutant distal Sp1 site construct was prepared with
CD18/luciferase (4) as template and the following oligonucleotides:
GCGGAGCTCACGGTGGTGCAACCATCCACTTCCTCCA (which includes a
SacI restriction site linked to CD18 promoter sequence from
96 to
68 and incorporates the underlined CA
AT
distal Sp1 site mutation at
81/
80) and
GCGAAGCTTGACGTCTAGAAACCTCAGCTGG (which includes a HindIII
site linked to the CD18 antisense sequence from
1/
17). The
resultant PCR product and the luciferase containing vector, pXpI
Bam
(16) were digested with SacI and HindIII,
ligated, and transformed into Escherichia coli.
1/
34 but incorporates the antisense sequence that generates the CGCGC
GAATT proximal Sp1 mutation at
24/
20) and
GCGGAGCTCACGGTGGTGCAACCCA (which includes a SacI restriction
site linked to the CD18 promoter from
96/
80).
The construct with mutations in both proximal and distal Sp1 sites was
generated by performing PCR with both of the mutated Sp1 site
oligonucleotides, described above. Successful mutagenesis of each
construct was confirmed by DNA sequencing with Sequenase version 2.0 (Amersham Life Science, Inc.) and is presented in Fig.
1B.
| |
RESULTS |
|---|
|
|
|---|
The leukocyte-specific and myeloid-inducible gene expression of
CD18 (
2 leukocyte integrin) requires three essential ets sites in the CD18 promoter. The ets transcription factors,
PU.1 and GABP, bind to these sites and cooperate to activate the CD18 promoter (10). In order to identify other DNA elements and
transcription factors that regulate myeloid expression of CD18, we used
PCR-based mutagenesis (17) to prepare a series of scanning mutants of the CD18 promoter (18). Disruption of the region from
30 to
21
relative to the start site of CD18 transcription, which includes an
element that resembles an Sp1 binding site, dramatically reduced CD18
promoter activity (data not shown). We identified a second potential
binding site for Sp1 immediately upstream of the crucial ets
sites in the CD18 promoter. Based on their relative distance from the
start site of transcription, we refer to them as the proximal
(
26/
16) and distal (
83/
76) Sp1 sites. The locations of these
two potential Sp1 sites which flank the three CD18 ets sites
are illustrated in Fig. 1A.
Sp1 Binds to the Proximal CD18 Promoter--
A double-stranded DNA
probe that corresponds to
32/+3 of the CD18 promoter, a region that
includes the proximal Sp1 site, was radiolabeled with
[
-32P]dCTP. EMSA was performed with this probe and
purified Sp1 transcription factor. Fig.
2A demonstrates that purified
Sp1 bound to this probe as a single species (lane 2;
arrow). Binding by Sp1 was abrogated by a 100-fold molar
excess of unlabeled homologous probe (lane 3), but not by
the same probe with a 5-nt mutation of the Sp1 site (CGCGC
GAATT at
24/
20; lane 4), or by an irrelevant probe (lane
5, corresponding to a region of the CD18 promoter that lacks an
Sp1 binding site). Binding by Sp1 was abrogated and supershifted by
anti-Sp1 antiserum (lane 6), but preimmune serum did not
disrupt Sp1 binding (lane 7). Sp1 did not bind to a
radiolabeled
32/+3 probe with the same 5-nt mutation of the proximal
Sp1 site (lane 9). Thus, Sp1 binds to the proximal CD18
promoter site in a sequence-specific manner.
|
32/+3 probe and a nuclear extract prepared from U937
cells (Fig. 2B). Several species from U937 cells bound to
the proximal Sp1 probe and one prominent species co-migrated with
purified Sp1 (compare lane 3 to lane 2;
arrow).
We examined the specificity of binding of the myeloid nuclear proteins
that bound to the
32/+3 probe. Fig. 2C indicates that binding by the protein species from U937 nuclear extract that co-migrated with Sp1 (lane 2; arrow) was
abrogated by a 100-fold molar excess of unlabeled homologous probe
(lane 3), but not by the mutant probe (lane 4) or
by irrelevant probe (lane 5). Although other binding
species were seen, they represent nonspecific binding species for they
were not abrogated by homologous, irrelevant, or mutant probes
(lanes 3-5). Anti-Sp1 antiserum abrogated binding by this
species and a faint supershifted species appeared (lane 6);
preimmune serum also resulted in a low mobility species but did not
disrupt binding by Sp1 (lane 7). There was no binding by Sp1
to a radiolabeled
32/+3 probe with a 5-nt mutation of the proximal
Sp1 site, even though the other binding species were unaffected by
disruption of the Sp1 site (lane 9; arrow). Thus, Sp1 is the only protein from U937 myeloid nuclear extract that binds in
a sequence-specific manner to the Sp1 site in the
32/+3 region of the
CD18 promoter, and its binding is sequence dependent.
Sp1 Binds to a Second, Distal Site in the CD18 Promoter-- Immediately upstream of the CD18 ets binding sites we identified a second sequence that resembles an Sp1 site (Fig. 1A). We had previously noted that an unidentified species bound to EMSA probes which included this upstream region of the CD18 promoter (10).
A double-stranded DNA probe that corresponds to
89/
76 of the CD18
promoter was radiolabeled with [
-32P]dCTP; this probe
includes the distal Sp1 site but excludes the adjacent ets
binding sites. Purified Sp1 bound to this probe in a sequence-specific
manner (Fig. 3, lane 2;
arrow), for it is abrogated by a 100-fold excess of
unlabeled homologous probe but not by irrelevant probe (compare
lane 3 to lane 4). Binding by purified Sp1 was
abrogated and supershifted by anti-Sp1 antiserum (lane 5). A
species from U937 nuclear extract bound to this probe and co-migrated
with purified Sp1 (lane 6). This binding was abrogated by
unlabeled homologous probe (lane 7), but not by irrelevant probe (lane 8); two additional nonspecific binding species
are also seen. Antiserum to Sp1 abrogated and supershifted this band (lane 9). Mutation of the distal Sp1 site (CA
AT at
81/
80) abrogated binding of both purified Sp1 and Sp1 from U937
(lanes 11 and 12, respectively). Thus, we
conclude that purified Sp1 and Sp1 from U937 nuclear extract bind in a
sequence-specific manner to both proximal and distal sites in the CD18
promoter.
|
Mutagenesis of Sp1 Sites Significantly Reduces Myeloid Activity of
CD18 Promoter--
We sought to characterize the functional effect of
the Sp1 binding sites in the CD18 promoter. PCR was used to introduce
the same mutations that abrogated Sp1 binding into the context of the
CD18 promoter. The luciferase reporter gene was linked to the wild-type
CD18 (
96) promoter, to promoter constructs that contain individual
mutations of the distal Sp1 site and the proximal Sp1 site, and to the
CD18 (
96) promoter with mutations in both Sp1 sites.
96) promoter. We conclude that each of the Sp1
sites is required for high level myeloid expression of CD18.
|
Sp1 Activates the CD18 Promoter-- In order to characterize the role of Sp1 in activating the CD18 promoter under defined conditions, we transfected CD18 promoter constructs into Drosophila Schneider cells, which lack endogenous Sp1-like activity. We co-transfected pPac-Sp1 (Sp1 in a Drosophila expression vector) along with wild type and mutant CD18 promoter constructs linked to the luciferase reporter gene.
When CD18 (
96)/luciferase, which contains both Sp1 binding sites, was
transfected into SL2 cells along with pPac-Sp1, luciferase activity
increased more than 20-fold compared with the CD18 reporter in the
absence of co-transfected pPac-Sp1 (Fig.
5). Thus, Sp1 dramatically activated CD18
expression in the context of a cell which otherwise lacks Sp1 activity.
However, mutation of the proximal Sp1 site reduced activation by
pPac-Sp1 by approximately one-fourth. Mutation of the distal Sp1 site
reduced Sp1 activation of the CD18 promoter by one-half. Disruption of
both of the CD18 Sp1 sites reduced promoter activation to only
one-third of that of the wild-type promoter. Thus, disruption of both
Sp1 sites in the CD18 promoter significantly impaired the ability of
co-transfected Sp1 to activate expression. However, activation by
pPac-Sp1 was not completely abrogated by these mutations, presumably
because the mutations did not completely eliminate all binding by Sp1 in vivo. We conclude that each of the Sp1 sites contributes
to activation of CD18 transcription by Sp1.
|
Sp1 and GABP Cooperate to Activate the CD18 Promoter--
We have
previously shown that GABP activates the CD18 promoter in human myeloid
and non-hematopoietic cells (10). We sought to determine if Sp1
cooperates with GABP to activate the CD18 promoter. We transfected
GABP
and GABP
(in the pPac expression vector) and pPac-Sp1 along
with the CD18 (
96) promoter construct into Schneider cells (Fig.
6). Although neither GABP
nor GABP
alone activated the CD18 (
96), transfection of GABP
and GABP
together activated the promoter 11-fold. Transfection of Sp1 alone activated the CD18 reporter 10-fold. However, transfection of both
components of GABP along with Sp1 activated the CD18 promoter 36-fold,
an effect that is more than the sum of their individual effects. Thus,
we conclude that Sp1 and GABP cooperate to activate the CD18
promoter.
|
| |
DISCUSSION |
|---|
|
|
|---|
Myeloid genes are regulated by combinatorial patterns of both lineage-restricted and more widely expressed transcription factors (1). We previously cloned the gene that encodes CD18 (4) and characterized a minimal promoter that directs leukocyte-specific and myeloid-inducible expression (11). The ets transcription factors, PU.1 and GABP, bind to three sites in the CD18 promoter and cooperate to activate CD18 transcription (10, 11). We now describe two Sp1 binding sites that are required for high level myeloid expression of CD18. Sp1 is the only protein from myeloid nuclear extracts that binds to these sites in a sequence-specific manner. Sp1 activates the CD18 promoter via these binding sites and cooperates with GABP to achieve high level myeloid gene expression.
Sp1 is the founding member of a growing family of proteins with highly homologous zinc finger domains that bind to GC or GT boxes (19-23). Sp1 is an abundant nuclear protein in most cell types, but its level of expression changes during development and varies in different cell types; hematopoietic cells are particularly rich in Sp1 (14). Although other members of this transcription factor family bind to related DNA sequences, Sp1 is the only protein from myeloid nuclear extracts that binds to the CD18 promoter sites. It has been difficult to define the biological role of Sp1 because of potentially redundant or antagonistic actions of the related family members. However, Sp1 was recently shown to be required for normal embryogenesis because disruption of Sp1 by homologous recombination caused embryonic death. The observation that cell growth was perturbed only after lineage commitment and cellular differentiation suggests that other family members may substitute for Sp1 in early embryogenesis, but Sp1 may be indispensable in more differentiated cells (24).
Sp1 is a phosphorylated and highly glycosylated nuclear protein that
contains three Cys-2-His-2 zinc finger motifs (25, 26). The N terminus
of Sp1 contains glutamine- and serine/threonine-rich domains which are
essential for its transcriptional activation (27). The C-terminal
domain of Sp1 is involved in synergistic activation and interaction
with other transcription factors (28). Sp1 functionally and physically
interacts with other classes of transcription factors including Egr-1
(29, 30), GATA-1 (31, 32), OTF-1 (33), NF
B (34, 35), and AP-1/AP-2
(36). Sp1 cooperates with AP-1 to activate the myeloid promoter CD11c (37). Sp1 also directly interacts with components of the basal transcriptional machinery, including TBP (38) and TAF 110, a TBP
accessory factor (39). Furthermore, when bound to distant sites in
cis, Sp1 interacts with itself and loops out the intervening DNA (28, 40). The presence of two functionally important Sp1 sites in
the CD18 proximal promoter suggests that such a looping interaction
might alter the configuration of the CD18 promoter and thereby
facilitate its interactions with the ets factors, PU.1 and
GABP.
Sp1 sites are found in proximity to ets binding sites in
numerous promoters and enhancers. An Sp1 element in the immunoglobulin
3' enhancer requires PU.1 (41), and adjacent Sp1 and ets
sites contribute to the lymphoid-specific expression of the mouse
perforin gene (42). Ets factors enhance Sp1 binding to the
IIb integrin promoter and enhance its transcriptional
activation (43). GABP may cooperate with Sp1 on the promoters of the
widely expressed genes, COX IV (44) and FBP (45). Finally, there is
evidence that Ets-1 and Sp1 physically interact and form a ternary
complex on the PTHrP promoter (46) and HTLVI LTR (47). Although we demonstrated that Sp1 functionally interacts with GABP, we detected no
direct, physical interaction between these proteins in EMSA studies
(data not shown).
Most myeloid promoters are relatively compact. Typically, 100 nucleotides or fewer are sufficient to direct myeloid expression in transient transfection assays. Sp1 has previously been shown to be functionally important for myeloid promoters such as CD11b (48), CD11c (37), CD14 (49), myeloperoxidase (50), and c-fes (51). Many myeloid promoters lack a classic TATA box and Sp1 sites are often found in the TATA-less promoters of both lineage-restricted and more widely expressed genes. Sp1 may contribute to the regulation of TATA-less genes by its direct interactions with components of the basal transcriptional machinery, such as TBP and TAF110.
How might the widely expressed Sp1 transcription factor contribute to
lineage specificity and inducibility? Although it is widely expressed,
Sp1 contacts the CD11b promoter in myeloid cells but not in
nonhematopoietic cells (48). In vivo footprinting indicates
that Sp1 does not contact the CD11c promoter in undifferentiated myeloid HL-60 cells which do not express CD11c. However, treatment of
HL-60 cells with 12-O-tetradecanoylphorbol-13-acetate, which strongly increases CD11c expression, results in direct contact of DNA
by Sp1 (37). Although high levels of Sp1 are expressed in hematopoietic
cells (14), there are no differences in the amount of Sp1 or in its
phosphorylation state in myeloid and nonmyeloid cells (48). These
observations suggest that alterations in chromatin structure may
determine the ability of Sp1 to contact DNA. Accessory factors such as
the inhibitory factor, Sp1-I, (52) may limit access of Sp1 to DNA
control elements, and thereby contribute to regulated gene expression.
Furthermore, Sp1 may mediate known signal transduction pathways that
control gene expression because Sp1 mediates Erb-B2 and
v-ras controlled down-regulation of
2-integrin expression in mammary epithelial cells
(53).
Previous studies have shown that Sp1 binds to a consensus sequence GGGGCGGG (and its complement CCCGCCCC) (13), but numerous functionally important variant binding sites have been described (37, 41, 43, 46, 54-58). Both of the Sp1 binding sites that we identified in the CD18 promoter are such variant sites, for the distal site is CCCACCAC and the proximal site is CCCGCGCCTCC. Despite their variant sequences, each of these sites is bound by Sp1, as shown by EMSA; each site can be activated by Sp1, as shown by transfection into Schneider cells; and each is functionally important, as demonstrated by transfection into myeloid cells.
The CD18 Sp1 sites appear to have a lower affinity for Sp1 binding because neither site is as efficient as the consensus Sp1 sequence for competition in EMSA studies (data not shown). A simple 2-nt mutation of the distal Sp1 site was sufficient to fully disrupt Sp1 binding and functional activity. Similarly, a 5-nt mutation of the proximal site fully disrupted Sp1 binding and functional activity. However, the introduction of two different 2-nt mutations into the proximal site was not sufficient to fully disrupt Sp1 binding and functional activity (data not shown). The requirement for a larger mutation of the proximal site may reflect the more extended length of the GC/GT-rich region in this site.
Although we have identified two Sp1 binding sites that flank the crucial ets sites in the CD18 promoter, Sp1 and GABP were not found to physically interact in EMSA studies. There are several mechanisms by which Sp1 may contribute to increased CD18 expression. The ability of Sp1 to form homodimers may loop out regions of DNA and such reconfiguration of the CD18 promoter may enhance accessibility of the promoter to GABP. Conversely, binding to the CD18 promoter by either PU.1 or GABP might facilitate access by Sp1 and thereby increase gene transcription. Finally, Sp1 and these ets factors may cooperatively activate gene transcription via indirect interactions with accessory factors. We propose that indirect interactions of Sp1 and ets factors are crucial for high level expression of CD18 and other myeloid genes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Robert Tjian, Berkley, CA, for
pPac-Sp1 and Nancy Speck, Dartmouth University, Hanover NH, for
pPac-GABP
and pPac-GABP
.
| |
FOOTNOTES |
|---|
* This work was supported in part by the American Heart Association, Rhode Island Affiliate Fellowship (to C. P. S.), and National Institutes of Health, NIDDK Grant R29 DK 44728 and American Cancer Society Grant RPG-92-002-04-DHP (both to A. G. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: The Miriam Hospital,
Research 215, 164 Summit Ave., Providence, RI 02906. Tel.: 401-793-4648; Fax: 401-751-2398; E-mail: rosmarin{at}brown.edu.
§ Current address: University of Colorado Health Science Center, 4200 E. 9th Ave., Denver, CO 80262.
1 The abbreviations used are: CMV, cytomegalovirus; hGH, human growth hormone; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; SL2, Schneider cells, Drosophila melanogaster embryo line 2; nt, nucleotide.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Takahashi, N. Hayashi, T. Shimokawa, N. Umehara, S. Kaminogawa, and C. Ra Cooperative Regulation of Fc Receptor {gamma}-Chain Gene Expression by Multiple Transcription Factors, Including Sp1, GABP, and Elf-1 J. Biol. Chem., May 30, 2008; 283(22): 15134 - 15141. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zaniolo, M.-E. Gingras, M. Audette, and S. L. Guerin Expression of the Gene Encoding Poly(ADP-ribose) Polymerase-1 Is Modulated by Fibronectin during Corneal Wound Healing. Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4199 - 4210. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Hale, T. J. Dahlem, R. L. Margraf, I. Debnath, J. J. Weis, and J. H. Weis Transcriptional control of Pactolus: evidence of a negative control region and comparison with its evolutionary paralogue, CD18 ({beta}2 integrin) J. Leukoc. Biol., August 1, 2006; 80(2): 383 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yaneva, S. Kippenberger, N. Wang, Q. Su, M. McGarvey, A. Nazarian, L. Lacomis, H. Erdjument-Bromage, and P. Tempst PU.1 and a TTTAAA Element in the Myeloid Defensin-1 Promoter Create an Operational TATA Box That Can Impose Cell Specificity onto TFIID Function. J. Immunol., June 1, 2006; 176(11): 6906 - 6917. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. Udayakumar, M. Belakavadi, K.-H. Choi, P. K. Pandey, and J. D. Fondell Regulation of Aurora-A Kinase Gene Expression via GABP Recruitment of TRAP220/MED1 J. Biol. Chem., May 26, 2006; 281(21): 14691 - 14699. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Resendes and A. G. Rosmarin GA-Binding Protein and p300 Are Essential Components of a Retinoic Acid-Induced Enhanceosome in Myeloid Cells Mol. Cell. Biol., April 15, 2006; 26(8): 3060 - 3070. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Smith, R. D. Nicholls, and D. Reines The gene encoding the fragile X RNA-binding protein is controlled by nuclear respiratory factor 2 and the CREB family of transcription factors Nucleic Acids Res., February 25, 2006; 34(4): 1205 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. MacLean II, M. K. Rao, K. M.H. Doyle, J. S. Richards, and M. F. Wilkinson Regulation of the Rhox5 Homeobox Gene in Primary Granulosa Cells: Preovulatory Expression and Dependence on SP1/SP3 and GABP Biol Reprod, December 1, 2005; 73(6): 1126 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimokawa and C. Ra C/EBP{alpha} functionally and physically interacts with GABP to activate the human myeloid IgA Fc receptor (Fc{alpha}R, CD89) gene promoter Blood, October 1, 2005; 106(7): 2534 - 2542. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsuchimochi, N. Yagishita, S. Yamasaki, T. Amano, Y. Kato, K.-i. Kawahara, S. Aratani, H. Fujita, F. Ji, A. Sugiura, et al. Identification of a Crucial Site for Synoviolin Expression Mol. Cell. Biol., August 15, 2005; 25(16): 7344 - 7356. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Noti, A. K. Johnson, and J. D. Dillon The Leukocyte Integrin Gene CD11d Is Repressed by Gut-enriched Kruppel-like Factor 4 in Myeloid Cells J. Biol. Chem., February 4, 2005; 280(5): 3449 - 3457. [Abstract] [Full Text] [PDF] |