JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosmarin, A. G.
Right arrow Articles by Simkevich, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosmarin, A. G.
Right arrow Articles by Simkevich, C. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 21, 13097-13103, May 22, 1998


Sp1 Cooperates with the ets Transcription Factor, GABP, to Activate the CD18 (beta 2 Leukocyte Integrin) Promoter*

Alan G. RosmarinDagger , Menglin Luo, David G. Caprio§, Jing Shang, and Carl P. Simkevich

From the Division of Hematology, Brown University Department of Medicine and the Division of Hematology/Oncology, The Miriam Hospital, Providence, Rhode Island 02906

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

CD18, the beta  chain of the leukocyte integrins, plays a crucial role in immune and inflammatory responses. CD18 is expressed exclusively by leukocytes, and it is transcriptionally regulated during the differentiation of myeloid cells. The ets factors, PU.1 and GABP, bind to three ets sites in the CD18 promoter, which are essential for high level myeloid expression of CD18. We now identify two binding sites for the transcription factor, Sp1, that flank these ets sites. Sp1 is the only factor from myeloid cells that binds to these sites in a sequence-specific manner. Mutagenesis of these sites abrogates Sp1 binding and significantly reduces the activity of the transfected CD18 promoter in myeloid cells. Transfection of Sp1 into Drosophila Schneider cells, which otherwise lack Sp1, activates the CD18 promoter dramatically. GABP also activates the CD18 promoter in Schneider cells. Co-transfection of Sp1 and GABP activates CD18 more than the sum of their individual effects, indicating that these factors cooperate to transcriptionally activate myeloid expression of CD18. These studies support a model of high level, lineage-restricted gene expression mediated by cooperative interactions between widely expressed transcription factors.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Monocytes and granulocytes, which are collectively known as myeloid cells, play crucial roles in immune and inflammatory responses. As myeloid cells differentiate from immature bone marrow precursor cells, they express characteristic genes that are required in their roles as immune effector cells. Most genes that are expressed during myeloid differentiation are regulated at the level of transcription (1). Characterization of the DNA sequences and transcription factors that control myeloid gene expression has provided important insights into the molecular basis of normal myeloid differentiation.

CD18 (beta 2 leukocyte integrin) is a cell surface adhesion molecule that forms heterodimers with CD11a, CD11b, or CD11c to generate the antigens LFA-1, Mo-1 (Mac-1), and p150/95, respectively. These leukocyte-specific receptors mediate cell-cell and cell-matrix interactions and play important roles in immune and inflammatory responses (2). The clinical significance of CD18 is illustrated by leukocyte adhesion deficiency, in which insufficient CD18 causes recurrent bacterial and fungal infections and can lead to premature death (3).

Expression of CD18 is restricted to myeloid cells and lymphocytes. CD18 expression increases significantly during myeloid differentiation due to increased transcription (4-7). We (4) and others (8, 9) have cloned the gene that encodes CD18 and characterized its promoter. The transfected CD18 promoter exhibits the leukocyte-specific and myeloid-inducible activity of the endogenous CD18 gene (10). We have previously shown that two ets-related transcription factors, PU.1 and GABP, bind to the CD18 promoter and cooperate to activate leukocyte-specific expression of CD18 (10, 11).

Sp1 is a DNA-binding nuclear protein that functions as a transcriptional activator (12-14). We now define two functionally important Sp1 binding sites which flank the three ets sites in the CD18 promoter. Although Sp1 is a member of a family of transcription factors that bind to related GC-rich sequences, Sp1 is the only protein from myeloid nuclear extracts that binds to these sites. Mutagenesis of these sites abrogates Sp1 binding and substantially reduces activity of the CD18 promoter in myeloid cells. Transfection of Sp1 into Drosophila Schneider cells, which otherwise lack Sp1, substantially activates the CD18 promoter. GABP also activates the CD18 promoter in Schneider cells. Finally, Sp1 functionally cooperates with GABP to activate the CD18 promoter. Thus, Sp1 is essential for high level myeloid expression of CD18 and it cooperates with the ets factor, GABP, to achieve high level myeloid expression of the CD18 promoter.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cell Culture and Transfection-- U937 (ATCC no. CRL 1593) cells were passaged twice weekly in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% fetal calf serum (ICN, Costa Mesa, CA) in an atmosphere of 5% CO2. About 5 × 106 cells were transfected, as described previously, with 20 µg of CD18/luciferase constructs and 1 µg of cytomegalovirus promoter/human growth hormone construct (CMV/hGH),1 and promoter activity is expressed as normalized relative light units (4). Transfection results represent the mean and S.E. from three or more separate experiments.

Schneider cells (ATCC CRL-1963; Drosophila melanogaster embryo line 2) were passaged weekly at 22-24 °C in Schneider's Drosophila Medium (Sigma) supplemented with 10% fetal calf serum. Cells were transfected by the calcium phosphate method with 5 µg of CD18/luciferase constructs and 2.5 µg of the effector molecules pPac-Sp1 (full-length Sp1 in the pPac expression vector; a gift of Robert Tjian, Berkeley, CA), pPac-GABPalpha , and/or pPac-GABPbeta (gifts of Nancy Speck, Hanover, NH), and additional carrier DNA to equalize the amount of transfected DNA in each sample. Luciferase activity was measured 48 h later and results represent data from three or more separate experiments.

Electrophoretic Mobility Shift Assay (EMSA)-- The sequence of the CD18 promoter and the locations of the Sp1 and ets binding sites are presented in Fig. 1A. EMSA was performed with the following DNA probes, and their complementary strands: wild type distal Sp1 site (-89/-76): TCGAGTGCAACCCACCACA; mutant distal Sp1 site (-89/-76): TCGAGTGCAACCATCCACA; wild type proximal Sp1 site (-32/+3): TCACGACCCGCGCCTCCAGCTGAGGTTTCTAGACG; and mutant proximal Sp1 site (-32/+3): TCACGACCGAATTCTCCAGCTGAGGTTTCTAGACG. The probes include overhanging ends that permit labeling with [alpha -32P]dCTP (ICN) by the Klenow fragment of DNA polymerase I (New England Biolabs, Beverly, MA).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1.   The human CD18 promoter. A, the sequence of the proximal CD18 promoter, which is sufficient to direct myeloid gene expression, is depicted. Boxes enclose the distal and proximal Sp1 binding sites. The location and orientation of the CD18 ets binding sites are indicated by the arrows. The probes used for EMSA are bracketed and the sequences introduced into the mutant probes are indicated. B, DNA sequencing of the wild type and mutant distal and proximal Sp1 sites is shown, and the derived sequences are presented alongside. The Sp1 sites are in bold and the vertical bars indicate the mutations that were introduced into these regions.

Nuclear extracts were prepared from U937 myeloid cells as we have previously described (15). Affinity-purified Sp1 was purchased from Promega (Madison, WI). Radiolabeled probe (0.25 ng) was incubated for 30 min on ice with 1 footprinting unit of purified Sp1 protein, or 10 µg of nuclear extract in a 15-µl reaction containing 10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM beta -mercaptoethanol, 1% Ficoll and poly(dI·dC) (Pharmacia Biotech Inc.; 2.0 µg for nuclear extracts, 1.5 µg for purified Sp1). Binding reactions with purified Sp1 also included 1.5 µg of bovine serum albumin, as recommended by the manufacturer.

Where indicated, binding competition was performed with a 100-fold molar excess of the following double-stranded, unlabeled DNA probes: homologous probe, mutant probes described above, or irrelevant probe that lacks an Sp1 binding site (corresponding to CD18 -903/-883, GCGAAGCTTGCAGTGAGCTGAGATCACGGATCCGCG, and its complement). Products were electrophoresed at 180 V in a 5% acrylamide/bisacrylamide (19:1) gel in 0.25× TBE (1× TBE is 90 mM Tris base, 90 mM boric acid, 2 mM EDTA) prior to autoradiography. For supershift experiments, reactions were preincubated for 10 min on ice with 1 µl of polyclonal rabbit antiserum raised against Sp1 (Santa Cruz Biotechnology, Santa Cruz, CA) or preimmune serum.

Mutagenesis of Sp1 Sites in CD18 Promoter-- Polymerase chain reaction (PCR) was used to generate CD18 promoter constructs with the same Sp1 site mutations that were incorporated into the EMSA probes, described above. The mutant distal Sp1 site construct was prepared with CD18/luciferase (4) as template and the following oligonucleotides: GCGGAGCTCACGGTGGTGCAACCATCCACTTCCTCCA (which includes a SacI restriction site linked to CD18 promoter sequence from -96 to -68 and incorporates the underlined CA right-arrow AT distal Sp1 site mutation at -81/-80) and GCGAAGCTTGACGTCTAGAAACCTCAGCTGG (which includes a HindIII site linked to the CD18 antisense sequence from -1/-17). The resultant PCR product and the luciferase containing vector, pXpIDelta Bam (16) were digested with SacI and HindIII, ligated, and transformed into Escherichia coli.

The mutated proximal Sp1 site promoter construct was prepared by PCR with wild type CD18/luciferase(4) as template and the following oligonucleotides: GCGAAGCTTGACGTCTAGAAACCTCAGCTGGAGAATTCGGTCGTGAAG (which includes a HindIII site linked to CD18 antisense sequence from -1/-34 but incorporates the antisense sequence that generates the CGCGC right-arrow GAATT proximal Sp1 mutation at -24/-20) and GCGGAGCTCACGGTGGTGCAACCCA (which includes a SacI restriction site linked to the CD18 promoter from -96/-80).

The construct with mutations in both proximal and distal Sp1 sites was generated by performing PCR with both of the mutated Sp1 site oligonucleotides, described above. Successful mutagenesis of each construct was confirmed by DNA sequencing with Sequenase version 2.0 (Amersham Life Science, Inc.) and is presented in Fig. 1B.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The leukocyte-specific and myeloid-inducible gene expression of CD18 (beta 2 leukocyte integrin) requires three essential ets sites in the CD18 promoter. The ets transcription factors, PU.1 and GABP, bind to these sites and cooperate to activate the CD18 promoter (10). In order to identify other DNA elements and transcription factors that regulate myeloid expression of CD18, we used PCR-based mutagenesis (17) to prepare a series of scanning mutants of the CD18 promoter (18). Disruption of the region from -30 to -21 relative to the start site of CD18 transcription, which includes an element that resembles an Sp1 binding site, dramatically reduced CD18 promoter activity (data not shown). We identified a second potential binding site for Sp1 immediately upstream of the crucial ets sites in the CD18 promoter. Based on their relative distance from the start site of transcription, we refer to them as the proximal (-26/-16) and distal (-83/-76) Sp1 sites. The locations of these two potential Sp1 sites which flank the three CD18 ets sites are illustrated in Fig. 1A.

Sp1 Binds to the Proximal CD18 Promoter-- A double-stranded DNA probe that corresponds to -32/+3 of the CD18 promoter, a region that includes the proximal Sp1 site, was radiolabeled with [alpha -32P]dCTP. EMSA was performed with this probe and purified Sp1 transcription factor. Fig. 2A demonstrates that purified Sp1 bound to this probe as a single species (lane 2; arrow). Binding by Sp1 was abrogated by a 100-fold molar excess of unlabeled homologous probe (lane 3), but not by the same probe with a 5-nt mutation of the Sp1 site (CGCGC right-arrow GAATT at -24/-20; lane 4), or by an irrelevant probe (lane 5, corresponding to a region of the CD18 promoter that lacks an Sp1 binding site). Binding by Sp1 was abrogated and supershifted by anti-Sp1 antiserum (lane 6), but preimmune serum did not disrupt Sp1 binding (lane 7). Sp1 did not bind to a radiolabeled -32/+3 probe with the same 5-nt mutation of the proximal Sp1 site (lane 9). Thus, Sp1 binds to the proximal CD18 promoter site in a sequence-specific manner.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   Sp1 binds to the CD18 proximal Sp1 binding site. A, EMSA was performed with 32P-labeled, double-stranded oligonucleotide probes, which include the CD18 proximal Sp1 site (-32/+3; lanes 1-7), or the same probe with a 5-nt mutation in the Sp1 site (mut; lanes 8 and 9). Binding by Sp1 to the -32/+3 probe (lane 2; arrow) was competed with 100-fold molar excess of homologous unlabeled probe (lane 3, Self Competitor), but not by the mutant probe (lane 4, Mut Competitor), or probe from an irrelevant region of the CD18 promoter (lane 5, Irrel Competitor). EMSA was performed in the presence of antiserum to Sp1 (lane 6) or preimmune serum (lane 7). EMSA was also performed with the radiolabeled mut probe (lanes 8 and 9) and purified Sp1 (lane 9). B, EMSA was performed with the radiolabeled CD18 -32/+3 probe and purified Sp1 (lane 2) or U937 nuclear extract (lane 3). C, EMSA was performed with the radiolabeled CD18 -32/+3 probe and U937 nuclear extract (lanes 2-7). Binding by Sp1 (arrows) was competed by a 100-fold molar excess of homologous unlabeled probe (lane 3), but not by the mutant probe (lane 4) or irrelevant probe (lane 5). EMSA was performed in the presence of antiserum to Sp1 (lane 6) or preimmune serum (lane 7). EMSA was also performed with the radiolabeled mut probe (lanes 8 and 9) and U937 nuclear extract (lane 9).

U937 myeloid cells express high levels of CD18. We performed EMSA with the radiolabeled -32/+3 probe and a nuclear extract prepared from U937 cells (Fig. 2B). Several species from U937 cells bound to the proximal Sp1 probe and one prominent species co-migrated with purified Sp1 (compare lane 3 to lane 2; arrow).

We examined the specificity of binding of the myeloid nuclear proteins that bound to the -32/+3 probe. Fig. 2C indicates that binding by the protein species from U937 nuclear extract that co-migrated with Sp1 (lane 2; arrow) was abrogated by a 100-fold molar excess of unlabeled homologous probe (lane 3), but not by the mutant probe (lane 4) or by irrelevant probe (lane 5). Although other binding species were seen, they represent nonspecific binding species for they were not abrogated by homologous, irrelevant, or mutant probes (lanes 3-5). Anti-Sp1 antiserum abrogated binding by this species and a faint supershifted species appeared (lane 6); preimmune serum also resulted in a low mobility species but did not disrupt binding by Sp1 (lane 7). There was no binding by Sp1 to a radiolabeled -32/+3 probe with a 5-nt mutation of the proximal Sp1 site, even though the other binding species were unaffected by disruption of the Sp1 site (lane 9; arrow). Thus, Sp1 is the only protein from U937 myeloid nuclear extract that binds in a sequence-specific manner to the Sp1 site in the -32/+3 region of the CD18 promoter, and its binding is sequence dependent.

Sp1 Binds to a Second, Distal Site in the CD18 Promoter-- Immediately upstream of the CD18 ets binding sites we identified a second sequence that resembles an Sp1 site (Fig. 1A). We had previously noted that an unidentified species bound to EMSA probes which included this upstream region of the CD18 promoter (10).

A double-stranded DNA probe that corresponds to -89/-76 of the CD18 promoter was radiolabeled with [alpha -32P]dCTP; this probe includes the distal Sp1 site but excludes the adjacent ets binding sites. Purified Sp1 bound to this probe in a sequence-specific manner (Fig. 3, lane 2; arrow), for it is abrogated by a 100-fold excess of unlabeled homologous probe but not by irrelevant probe (compare lane 3 to lane 4). Binding by purified Sp1 was abrogated and supershifted by anti-Sp1 antiserum (lane 5). A species from U937 nuclear extract bound to this probe and co-migrated with purified Sp1 (lane 6). This binding was abrogated by unlabeled homologous probe (lane 7), but not by irrelevant probe (lane 8); two additional nonspecific binding species are also seen. Antiserum to Sp1 abrogated and supershifted this band (lane 9). Mutation of the distal Sp1 site (CA right-arrow AT at -81/-80) abrogated binding of both purified Sp1 and Sp1 from U937 (lanes 11 and 12, respectively). Thus, we conclude that purified Sp1 and Sp1 from U937 nuclear extract bind in a sequence-specific manner to both proximal and distal sites in the CD18 promoter.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3.   Purified Sp1 and Sp1 from U937 nuclei bind to the distal Sp1 site. A double-stranded oligonucleotide probe corresponding to -89/-76 of the CD18 promoter which contains the distal Sp1 site was radiolabeled with 32P (lanes 1-9). EMSA was performed with 1 footprinting unit of affinity purified Sp1 (lanes 2-5). Binding by Sp1 (lane 2; arrow) was competed by 100-fold molar excess of consensus Sp1 binding site probe (lane 3) but not by nonspecific probe (lane 4). This species was abrogated and supershifted by antiserum to Sp1 (lane 5). A binding species from U937 nuclear extract co-migrated with purified Sp1 (lane 6; arrow), and its binding was competed by 100-fold molar excess of consensus Sp1 binding site probe (lane 7), but not by nonspecific probe (lane 8); this species was abrogated and supershifted by anti-Sp1 antiserum (lane 9). Although two other binding species from U937 nuclear extract were also seen, neither represented specific binding for they were not competed by either probe. A radiolabeled double-stranded probe that incorporates the distal Sp1 site mutation (lanes 10-12) was not bound by either purified Sp1 or Sp1 from U937 nuclear extract (lanes 11 and 12, respectively).

Mutagenesis of Sp1 Sites Significantly Reduces Myeloid Activity of CD18 Promoter-- We sought to characterize the functional effect of the Sp1 binding sites in the CD18 promoter. PCR was used to introduce the same mutations that abrogated Sp1 binding into the context of the CD18 promoter. The luciferase reporter gene was linked to the wild-type CD18 (-96) promoter, to promoter constructs that contain individual mutations of the distal Sp1 site and the proximal Sp1 site, and to the CD18 (-96) promoter with mutations in both Sp1 sites.

The wild-type and mutant CD18 promoter constructs were transfected into U937 cells and the activity of the mutant constructs is presented relative to that of the wild-type promoter (Fig. 4). Disruption of either the proximal or the distal Sp1 site individually significantly reduced promoter activity (20 and 35%, respectively). Disruption of both Sp1 sites reduced CD18 promoter myeloid activity to one-half of the activity of the wild type CD18 (-96) promoter. We conclude that each of the Sp1 sites is required for high level myeloid expression of CD18.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   Mutation of the CD18 Sp1 sites reduces myeloid activity of the CD18 promoter. U937 myeloid cells were transfected with 20 µg of CD18 (-96)/luciferase (wild type promoter), or with CD18 (-96) promoter constructs that include mutations in proximal Sp1 site, distal Sp1 site, or both Sp1 sites, as indicated. Luciferase activity was measured 14 h after transfection and normalized to growth hormone expression directed by the CMV/hGH internal control. Activity is expressed relative to that of the wild type promoter. Data from three independent experiments in duplicate are shown as mean and S.E.

Sp1 Activates the CD18 Promoter-- In order to characterize the role of Sp1 in activating the CD18 promoter under defined conditions, we transfected CD18 promoter constructs into Drosophila Schneider cells, which lack endogenous Sp1-like activity. We co-transfected pPac-Sp1 (Sp1 in a Drosophila expression vector) along with wild type and mutant CD18 promoter constructs linked to the luciferase reporter gene.

When CD18 (-96)/luciferase, which contains both Sp1 binding sites, was transfected into SL2 cells along with pPac-Sp1, luciferase activity increased more than 20-fold compared with the CD18 reporter in the absence of co-transfected pPac-Sp1 (Fig. 5). Thus, Sp1 dramatically activated CD18 expression in the context of a cell which otherwise lacks Sp1 activity. However, mutation of the proximal Sp1 site reduced activation by pPac-Sp1 by approximately one-fourth. Mutation of the distal Sp1 site reduced Sp1 activation of the CD18 promoter by one-half. Disruption of both of the CD18 Sp1 sites reduced promoter activation to only one-third of that of the wild-type promoter. Thus, disruption of both Sp1 sites in the CD18 promoter significantly impaired the ability of co-transfected Sp1 to activate expression. However, activation by pPac-Sp1 was not completely abrogated by these mutations, presumably because the mutations did not completely eliminate all binding by Sp1 in vivo. We conclude that each of the Sp1 sites contributes to activation of CD18 transcription by Sp1.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 5.   Sp1 activates the CD18 promoter in Drosophila Schneider cells. Schneider cells, which otherwise lack Sp1, were transfected by the calcium phosphate method with 5 µg of CD18/luciferase wild type or mutant constructs and 2.5 µg of pPac-Sp1 (full-length Sp1 in the pPac expression vector), and luciferase activity was measured 48 h later. Results represent mean and S.E. from three or more separate experiments.

Sp1 and GABP Cooperate to Activate the CD18 Promoter-- We have previously shown that GABP activates the CD18 promoter in human myeloid and non-hematopoietic cells (10). We sought to determine if Sp1 cooperates with GABP to activate the CD18 promoter. We transfected GABPalpha and GABPbeta (in the pPac expression vector) and pPac-Sp1 along with the CD18 (-96) promoter construct into Schneider cells (Fig. 6). Although neither GABPalpha nor GABPbeta alone activated the CD18 (-96), transfection of GABPalpha and GABPbeta together activated the promoter 11-fold. Transfection of Sp1 alone activated the CD18 reporter 10-fold. However, transfection of both components of GABP along with Sp1 activated the CD18 promoter 36-fold, an effect that is more than the sum of their individual effects. Thus, we conclude that Sp1 and GABP cooperate to activate the CD18 promoter.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6.   Sp1 cooperates with GABP to activate the CD18 promoter in Schneider cells. Schneider cells were transfected by the calcium phosphate method with 5 µg of CD18/luciferase wild type constructs and 2.5 µg of effector molecules pPac-Sp1 and/or pPac-GABPalpha /pPac-GABPbeta , as indicated. Luciferase activity was measured 48 h later and results represent data from four separate experiments.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Myeloid genes are regulated by combinatorial patterns of both lineage-restricted and more widely expressed transcription factors (1). We previously cloned the gene that encodes CD18 (4) and characterized a minimal promoter that directs leukocyte-specific and myeloid-inducible expression (11). The ets transcription factors, PU.1 and GABP, bind to three sites in the CD18 promoter and cooperate to activate CD18 transcription (10, 11). We now describe two Sp1 binding sites that are required for high level myeloid expression of CD18. Sp1 is the only protein from myeloid nuclear extracts that binds to these sites in a sequence-specific manner. Sp1 activates the CD18 promoter via these binding sites and cooperates with GABP to achieve high level myeloid gene expression.

Sp1 is the founding member of a growing family of proteins with highly homologous zinc finger domains that bind to GC or GT boxes (19-23). Sp1 is an abundant nuclear protein in most cell types, but its level of expression changes during development and varies in different cell types; hematopoietic cells are particularly rich in Sp1 (14). Although other members of this transcription factor family bind to related DNA sequences, Sp1 is the only protein from myeloid nuclear extracts that binds to the CD18 promoter sites. It has been difficult to define the biological role of Sp1 because of potentially redundant or antagonistic actions of the related family members. However, Sp1 was recently shown to be required for normal embryogenesis because disruption of Sp1 by homologous recombination caused embryonic death. The observation that cell growth was perturbed only after lineage commitment and cellular differentiation suggests that other family members may substitute for Sp1 in early embryogenesis, but Sp1 may be indispensable in more differentiated cells (24).

Sp1 is a phosphorylated and highly glycosylated nuclear protein that contains three Cys-2-His-2 zinc finger motifs (25, 26). The N terminus of Sp1 contains glutamine- and serine/threonine-rich domains which are essential for its transcriptional activation (27). The C-terminal domain of Sp1 is involved in synergistic activation and interaction with other transcription factors (28). Sp1 functionally and physically interacts with other classes of transcription factors including Egr-1 (29, 30), GATA-1 (31, 32), OTF-1 (33), NFkappa B (34, 35), and AP-1/AP-2 (36). Sp1 cooperates with AP-1 to activate the myeloid promoter CD11c (37). Sp1 also directly interacts with components of the basal transcriptional machinery, including TBP (38) and TAF 110, a TBP accessory factor (39). Furthermore, when bound to distant sites in cis, Sp1 interacts with itself and loops out the intervening DNA (28, 40). The presence of two functionally important Sp1 sites in the CD18 proximal promoter suggests that such a looping interaction might alter the configuration of the CD18 promoter and thereby facilitate its interactions with the ets factors, PU.1 and GABP.

Sp1 sites are found in proximity to ets binding sites in numerous promoters and enhancers. An Sp1 element in the immunoglobulin kappa 3' enhancer requires PU.1 (41), and adjacent Sp1 and ets sites contribute to the lymphoid-specific expression of the mouse perforin gene (42). Ets factors enhance Sp1 binding to the alpha IIb integrin promoter and enhance its transcriptional activation (43). GABP may cooperate with Sp1 on the promoters of the widely expressed genes, COX IV (44) and FBP (45). Finally, there is evidence that Ets-1 and Sp1 physically interact and form a ternary complex on the PTHrP promoter (46) and HTLVI LTR (47). Although we demonstrated that Sp1 functionally interacts with GABP, we detected no direct, physical interaction between these proteins in EMSA studies (data not shown).

Most myeloid promoters are relatively compact. Typically, 100 nucleotides or fewer are sufficient to direct myeloid expression in transient transfection assays. Sp1 has previously been shown to be functionally important for myeloid promoters such as CD11b (48), CD11c (37), CD14 (49), myeloperoxidase (50), and c-fes (51). Many myeloid promoters lack a classic TATA box and Sp1 sites are often found in the TATA-less promoters of both lineage-restricted and more widely expressed genes. Sp1 may contribute to the regulation of TATA-less genes by its direct interactions with components of the basal transcriptional machinery, such as TBP and TAF110.

How might the widely expressed Sp1 transcription factor contribute to lineage specificity and inducibility? Although it is widely expressed, Sp1 contacts the CD11b promoter in myeloid cells but not in nonhematopoietic cells (48). In vivo footprinting indicates that Sp1 does not contact the CD11c promoter in undifferentiated myeloid HL-60 cells which do not express CD11c. However, treatment of HL-60 cells with 12-O-tetradecanoylphorbol-13-acetate, which strongly increases CD11c expression, results in direct contact of DNA by Sp1 (37). Although high levels of Sp1 are expressed in hematopoietic cells (14), there are no differences in the amount of Sp1 or in its phosphorylation state in myeloid and nonmyeloid cells (48). These observations suggest that alterations in chromatin structure may determine the ability of Sp1 to contact DNA. Accessory factors such as the inhibitory factor, Sp1-I, (52) may limit access of Sp1 to DNA control elements, and thereby contribute to regulated gene expression. Furthermore, Sp1 may mediate known signal transduction pathways that control gene expression because Sp1 mediates Erb-B2 and v-ras controlled down-regulation of alpha 2-integrin expression in mammary epithelial cells (53).

Previous studies have shown that Sp1 binds to a consensus sequence GGGGCGGG (and its complement CCCGCCCC) (13), but numerous functionally important variant binding sites have been described (37, 41, 43, 46, 54-58). Both of the Sp1 binding sites that we identified in the CD18 promoter are such variant sites, for the distal site is CCCACCAC and the proximal site is CCCGCGCCTCC. Despite their variant sequences, each of these sites is bound by Sp1, as shown by EMSA; each site can be activated by Sp1, as shown by transfection into Schneider cells; and each is functionally important, as demonstrated by transfection into myeloid cells.

The CD18 Sp1 sites appear to have a lower affinity for Sp1 binding because neither site is as efficient as the consensus Sp1 sequence for competition in EMSA studies (data not shown). A simple 2-nt mutation of the distal Sp1 site was sufficient to fully disrupt Sp1 binding and functional activity. Similarly, a 5-nt mutation of the proximal site fully disrupted Sp1 binding and functional activity. However, the introduction of two different 2-nt mutations into the proximal site was not sufficient to fully disrupt Sp1 binding and functional activity (data not shown). The requirement for a larger mutation of the proximal site may reflect the more extended length of the GC/GT-rich region in this site.

Although we have identified two Sp1 binding sites that flank the crucial ets sites in the CD18 promoter, Sp1 and GABP were not found to physically interact in EMSA studies. There are several mechanisms by which Sp1 may contribute to increased CD18 expression. The ability of Sp1 to form homodimers may loop out regions of DNA and such reconfiguration of the CD18 promoter may enhance accessibility of the promoter to GABP. Conversely, binding to the CD18 promoter by either PU.1 or GABP might facilitate access by Sp1 and thereby increase gene transcription. Finally, Sp1 and these ets factors may cooperatively activate gene transcription via indirect interactions with accessory factors. We propose that indirect interactions of Sp1 and ets factors are crucial for high level expression of CD18 and other myeloid genes.

    ACKNOWLEDGEMENTS

We thank Robert Tjian, Berkley, CA, for pPac-Sp1 and Nancy Speck, Dartmouth University, Hanover NH, for pPac-GABPalpha and pPac-GABPbeta .

    FOOTNOTES

* This work was supported in part by the American Heart Association, Rhode Island Affiliate Fellowship (to C. P. S.), and National Institutes of Health, NIDDK Grant R29 DK 44728 and American Cancer Society Grant RPG-92-002-04-DHP (both to A. G. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: The Miriam Hospital, Research 215, 164 Summit Ave., Providence, RI 02906. Tel.: 401-793-4648; Fax: 401-751-2398; E-mail: rosmarin{at}brown.edu.

§ Current address: University of Colorado Health Science Center, 4200 E. 9th Ave., Denver, CO 80262.

1 The abbreviations used are: CMV, cytomegalovirus; hGH, human growth hormone; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; SL2, Schneider cells, Drosophila melanogaster embryo line 2; nt, nucleotide.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Shivdasani, R. A., and Orkin, S. H. (1996) Blood 87, 4025-4039[Free Full Text]
  2. Arnaout, M. A. (1990) Blood 75, 1037-1050[Free Full Text]
  3. Springer, T. A., Thompson, W. S., Miller, L. J., Schmalsteig, F. C., and Anderson, D. C. (1984) J. Exp. Med. 160, 1901-1918[Abstract/Free Full Text]
  4. Rosmarin, A. G., Levy, R., and Tenen, D. G. (1992) Blood 79, 2598-2604[Abstract/Free Full Text]
  5. Pahl, H. L., Rosmarin, A. G., and Tenen, D. G. (1992) Blood 79, 865-870[Abstract/Free Full Text]
  6. Hickstein, D. D., Hickey, M. J., and Collins, S. J. (1988) J. Biol. Chem. 263, 13863-13867[Abstract/Free Full Text]
  7. Rosmarin, A. G., Weil, S. C., Rosner, G. L., Griffin, J. D., Arnaout, M. A., and Tenen, D. G. (1989) Blood 73, 131-136[Abstract/Free Full Text]
  8. Agura, E. D., Howard, M., and Collins, S. J. (1992) Blood 79, 602-609[Abstract/Free Full Text]
  9. Bottinger, E. P., Shelley, C. S., Farokhzad, O. C., and Arnaout, M. A. (1994) Mol. Cell. Biol. 14, 2604-2615[Abstract/Free Full Text]
  10. Rosmarin, A. G., Caprio, D. G., Kirsch, D. G., Handa, H., and Simkevich, C. P. (1995) J. Biol. Chem. 270, 23627-23633[Abstract/Free Full Text]
  11. Rosmarin, A. G., Caprio, D., Levy, R., and Simkevich, C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 801-805[Abstract/Free Full Text]
  12. Dynan, W. S., and Tjian, R. (1983) Cell 32, 669-680[CrossRef][Medline] [Order article via Infotrieve]
  13. Letovsky, J., and Dynan, W. S. (1989) Nucleic Acids Res. 17, 2639-2653[Abstract/Free Full Text]
  14. Saffer, J. D., Jackson, S. P., and Annarella, M. B. (1991) Mol. Cell. Biol. 11, 2189-2199[Abstract/Free Full Text]
  15. Rosmarin, A. G., Caprio, D., Levy, R., and Simkevich, C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 801-805
  16. Nordeen, S. K. (1988) BioTechniques 6, 454-458[Medline] [Order article via Infotrieve]
  17. Zaret, K. S., Liu, J. K., and DiPersio, C. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5469-5473[Abstract/Free Full Text]
  18. Rosmarin, A. G., Caprio, D. G., and Simkevich, C. P. (1997) BioTechniques 22, 434-436[Medline] [Order article via Infotrieve]
  19. Hagen, G., Muller, S., Beato, M., and Suske, G. (1992) Nucleic Acids Res. 20, 5519-5525[Abstract/Free Full Text]
  20. Kingsley, C., and Winoto, A. (1992) Mol. Cell. Biol. 12, 4251-4261[Abstract/Free Full Text]
  21. Miller, I. J., and Bieker, J. J. (1993) Mol. Cell. Biol. 13, 2776-2786[Abstract/Free Full Text]
  22. Crossley, M., Whitelaw, E., Perkins, A., Williams, G., Fujiwara, Y., and Orkin, S. H. (1996) Mol. Cell. Biol. 16, 1695-1705[Abstract]
  23. Imataka, H., Sogawa, K., Yasumoto, K., Kikuchi, Y., Sasano, K., Kobayashi, A., Hayami, M., and Fujii-Kuriyama, Y. (1992) EMBO J. 11, 3663-3671[Medline] [Order article via Infotrieve]
  24. Marin, M., Karis, A., Visser, P., Grosveld, F., and Philipsen, S. (1997) Cell 89, 619-628[CrossRef][Medline] [Order article via Infotrieve]
  25. Jackson, S. P., MacDonald, J. J., Lees-Miller, S., and Tjian, R. (1990) Cell 63, 155-165[CrossRef][Medline] [Order article via Infotrieve]
  26. Jackson, S. P., and Tjian, R. (1988) Cell 55, 125-133[CrossRef][Medline] [Order article via Infotrieve]
  27. Courey, A. J., Holtzman, D. A., Jackson, S. P., and Tjian, R. (1989) Cell 59, 827-836[CrossRef][Medline] [Order article via Infotrieve]
  28. Li, R., Knight, J. D., Jackson, S. P., Tjian, R., and Botchan, M. R. (1991) Cell 65, 493-505[CrossRef][Medline] [Order article via Infotrieve]
  29. Khachigian, L. M., Lindner, V., Williams, A. J., and Collins, T. (1996) Science 271, 1427-1431[Abstract]
  30. Ebert, S. N., and Wong, D. L. (1995) J. Biol. Chem. 270, 17299-17305[Abstract/Free Full Text]
  31. Fischer, K. D., Haese, A., and Nowock, J. (1993) J. Biol. Chem. 268, 23915-23923[Abstract/Free Full Text]
  32. Merika, M., and Orkin, S. H. (1995) Mol. Cell. Biol. 15, 2437-2447[Abstract]
  33. Janson, L., and Pettersson, U. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4732-4736[Abstract/Free Full Text]
  34. Perkins, N. D., Edwards, N. L., Duckett, C. S., Agranoff, A. B., Schmid, R. M., and Nabel, G. J. (1993) EMBO J. 12, 3551-3558[Medline] [Order article via Infotrieve]
  35. Perkins, N. D., Agranoff, A. B., Pascal, E., and Nabel, G. J. (1994) Mol. Cell. Biol. 14, 6570-6583[Abstract/Free Full Text]
  36. Andersson, G., Pahlman, S., Parrow, V., Johansson, I., and Hammerling, U. (1994) Cell Growth Differ. 5, 27-36[Abstract]
  37. Noti, J. D., Reinemann, B. C., and Petrus, M. N. (1996) Mol. Immunol. 33, 115-127[CrossRef][Medline] [Order article via Infotrieve]
  38. Emili, A., Greenblatt, J., and Ingles, C. J. (1994) Mol. Cell. Biol. 14, 1582-1593[Abstract/Free Full Text]
  39. Gill, G., Pascal, E., Tseng, Z. H., and Tjian, R. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 192-196[Abstract/Free Full Text]
  40. Su, W., Jackson, S., Tjian, R., and Echols, H. (1991) Genes Dev. 5, 820-826[Abstract/Free Full Text]
  41. Costa, M. W., and Atchison, M. L. (1996) Biochemistry 35, 8662-8669[CrossRef][Medline] [Order article via Infotrieve]
  42. Youn, B. S., Kim, K. K., and Kwon, B. S. (1996) J. Immunol. 157, 3499-3509[Abstract]
  43. Block, K. L., Shou, Y. P., and Poncz, M. (1996) Blood 88, 2071-2080[Abstract/Free Full Text]
  44. Carter, R. S., and Avadhani, N. G. (1994) J. Biol. Chem. 269, 4381-4387[Abstract/Free Full Text]
  45. Sadasivan, E., Cedeno, M. M., and Rothenberg, S. P. (1994) J. Biol. Chem. 269, 4725-4735[Abstract/Free Full Text]
  46. Dittmer, J., Gégonne, A., Gitlin, S. D., Ghysdael, J., and Brady, J. N. (1994) J. Biol. Chem. 269, 21428-21434[Abstract/Free Full Text]
  47. Gegonne, A., Bosselut, R., Bailly, R. A., and Ghysdael, J. (1993) EMBO J. 12, 1169-1178[Medline] [Order article via Infotrieve]
  48. Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E., and Tenen, D. G. (1993) J. Biol. Chem. 268, 8230-8239[Abstract/Free Full Text]
  49. Zhang, D. E., Hetherington, C. J., Gonzalez, D. A., Chen, H. M., and Tenen, D. G. (1994) J. Immunol. 153, 3276-3284[Abstract]
  50. Piedrafita, F. J., Molander, R. B., Vansant, G., Orlova, E. A., Pfahl, M., and Reynolds, W. F. (1996) J. Biol. Chem. 271, 14412-14420[Abstract/Free Full Text]
  51. Heydemann, A., Juang, G., Hennessy, K., Parmacek, M. S., and Simon, M. C. (1996) Mol. Cell. Biol. 16, 1676-1686[Abstract]
  52. Chen, L. I., Nishinaka, T., Kwan, K., Kitabayashi, I., Yokoyama, K., Fu, Y. H., Grunwald, S., and Chiu, R. (1994) Mol. Cell. Biol. 14, 4380-4389[Abstract/Free Full Text]
  53. Ye, J. P., Xu, R. H., Taylor-Papadimitriou, J., and Pitha, P. M. (1996) Mol. Cell. Biol. 16, 6178-6189[Abstract]
  54. Lee, J.-H., Jang, S.-I., Yang, J.-M., Markova, N. G., and Steinert, P. M. (1996) J. Biol. Chem. 271, 4561-4568[Abstract/Free Full Text]
  55. Parks, C. L., and Shenk, T. (1996) J. Biol. Chem. 271, 4417-4430[Abstract/Free Full Text]
  56. Majello, B., De Luca, P., Suske, G., and Lania, L. (1995) Oncogene 10, 1841-1848[Medline] [Order article via Infotrieve]
  57. Ye, J., Zhang, X., and Dong, Z. (1996) Mol. Cell. Biol. 16, 157-167[Abstract]
  58. Boisclair, Y. R., Brown, A. L., Casola, S., and Rechler, M. M. (1993) J. Biol. Chem. 268, 24892-24901[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Takahashi, N. Hayashi, T. Shimokawa, N. Umehara, S. Kaminogawa, and C. Ra
Cooperative Regulation of Fc Receptor {gamma}-Chain Gene Expression by Multiple Transcription Factors, Including Sp1, GABP, and Elf-1
J. Biol. Chem., May 30, 2008; 283(22): 15134 - 15141.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K. Zaniolo, M.-E. Gingras, M. Audette, and S. L. Guerin
Expression of the Gene Encoding Poly(ADP-ribose) Polymerase-1 Is Modulated by Fibronectin during Corneal Wound Healing.
Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4199 - 4210.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. S. Hale, T. J. Dahlem, R. L. Margraf, I. Debnath, J. J. Weis, and J. H. Weis
Transcriptional control of Pactolus: evidence of a negative control region and comparison with its evolutionary paralogue, CD18 ({beta}2 integrin)
J. Leukoc. Biol., August 1, 2006; 80(2): 383 - 398.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Yaneva, S. Kippenberger, N. Wang, Q. Su, M. McGarvey, A. Nazarian, L. Lacomis, H. Erdjument-Bromage, and P. Tempst
PU.1 and a TTTAAA Element in the Myeloid Defensin-1 Promoter Create an Operational TATA Box That Can Impose Cell Specificity onto TFIID Function.
J. Immunol., June 1, 2006; 176(11): 6906 - 6917.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. S. Udayakumar, M. Belakavadi, K.-H. Choi, P. K. Pandey, and J. D. Fondell
Regulation of Aurora-A Kinase Gene Expression via GABP Recruitment of TRAP220/MED1
J. Biol. Chem., May 26, 2006; 281(21): 14691 - 14699.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. K. Resendes and A. G. Rosmarin
GA-Binding Protein and p300 Are Essential Components of a Retinoic Acid-Induced Enhanceosome in Myeloid Cells
Mol. Cell. Biol., April 15, 2006; 26(8): 3060 - 3070.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. T. Smith, R. D. Nicholls, and D. Reines
The gene encoding the fragile X RNA-binding protein is controlled by nuclear respiratory factor 2 and the CREB family of transcription factors
Nucleic Acids Res., February 25, 2006; 34(4): 1205 - 1215.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. MacLean II, M. K. Rao, K. M.H. Doyle, J. S. Richards, and M. F. Wilkinson
Regulation of the Rhox5 Homeobox Gene in Primary Granulosa Cells: Preovulatory Expression and Dependence on SP1/SP3 and GABP
Biol Reprod, December 1, 2005; 73(6): 1126 - 1134.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Shimokawa and C. Ra
C/EBP{alpha} functionally and physically interacts with GABP to activate the human myeloid IgA Fc receptor (Fc{alpha}R, CD89) gene promoter
Blood, October 1, 2005; 106(7): 2534 - 2542.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Tsuchimochi, N. Yagishita, S. Yamasaki, T. Amano, Y. Kato, K.-i. Kawahara, S. Aratani, H. Fujita, F. Ji, A. Sugiura, et al.
Identification of a Crucial Site for Synoviolin Expression
Mol. Cell. Biol., August 15, 2005; 25(16): 7344 - 7356.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Noti, A. K. Johnson, and J. D. Dillon
The Leukocyte Integrin Gene CD11d Is Repressed by Gut-enriched Kruppel-like Factor 4 in Myeloid Cells
J. Biol. Chem., February 4, 2005; 280(5): 3449 - 3457.
[Abstract] [Full Text] [PDF]