Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ballester, A.
Right arrow Articles by Alemany, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ballester, A.
Right arrow Articles by Alemany, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 23, 14099-14106, June 5, 1998


Cot Kinase Activates Tumor Necrosis Factor-alpha Gene Expression in a Cyclosporin A-resistant Manner*

Alicia BallesterDagger , Ana VelascoDagger §, Rafael Tobeña§, and Susana Alemany

From the Instituto de Investigaciones Biomédicas, CSIC, Facultad Medicina Universidad Autónoma de Madrid, Arturo Duperier 4, 28029 Madrid, Spain

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cot kinase is a protein serine/threonine kinase, classified as a mitogen-activated protein kinase kinase kinase, implicated in T lymphocyte activation. Here we show that an increase in Cot kinase expression promotes tumor necrosis factor-alpha (TNF-alpha ) production in Jurkat T cells stimulated by soluble anti-CD3 or by low concentrations of phorbol 12,13-dibutyrate (PDBu) and calcium ionophore. Overexpression of Cot kinase in Jurkat cells activates TNF-alpha gene expression. Cot kinase promotes TNF-alpha promoter activation to a similar extent as calcium ionophore and PDBu or soluble anti-CD28 and PDBu. Neither phorbol esters nor calcium ionophore can replace Cot kinase on TNF-alpha promoter-driven transcription. Expression of a dominant negative form of Cot kinase inhibits TNF-alpha promoter activation induced by stimulation with either calcium ionophore and PDBu, soluble anti-CD28 and PDBu, or soluble anti-CD3 and PDBu. TNF-alpha promoter-driven transcription by Cot kinase is partially mediated by MAPK/ERK kinase and is cyclosporin A-resistant. Cot kinase increases at least the AP-1 and AP-2 response elements. These data indicate that Cot kinase plays a critical role in TNF-alpha production.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Tpl-2/Cot kinase is a mitogen-activated protein kinase kinase kinase that activates both the ERK1 and JNK signal transduction pathways (1-4). The COT kinase gene was first cloned in a truncated form in transformed foci induced in SHOK cells by transfection of the genomic DNA of a human thyroid carcinoma cell line (5). The human COT gene is unique in the genomic sequence (5). The normal human cellular homologue has an open reading frame encoding 467 amino acids, being the first 397 identical to the truncated form, whereas the 69 amino acids from the C terminus are replaced by 18 amino acids in the truncated form (6-8). The rat homologue gene was identified as an oncogene associated with the progression of Moloney murine leukemia virus-induced T cell lymphomas in rats (Tpl-2) (9, 10). The provirus insertion occurs in the last intron of the Tpl-2 gene. Transgenic mice expressing the truncated oncogenic protein in thymocytes develop T cell lymphomas (11). As occurs with the human homologue, the disruption of the last coding exon of Tpl-2 appears to unmask the oncogenic potential of the protein (6, 10-12). However, overexpression of the human normal gene is also capable of conferring the transformed phenotype in established cell lines (6, 8).

At the amino acid level the identity between the human Cot kinase and the rat Tpl-2 homologue is >95% (1). Transient expression of Cot/Tpl-2 kinase activates ERK1 (1, 13, 14). Overexpression of the rat homologue in human Jurkat T cells also phosphorylates and activates JNKK, and consequently JNK is also phosphorylated and activated (1). This activation of JNK by Cot kinase leads to the phosphorylation of c-jun in its N-terminal region (1).

A variety of stimuli induce TNF-alpha production in many cell types (15, 16), including T cells (17-22). Phorbol esters (23-25), calcium (26, 27), anti-CD3 antibody (20), or phorbol esters and anti-CD3 induce TNF-alpha promoter transcription (21, 28). Enterotoxin (22), anti-AIM/CD 69 (29), or anti-CD2 pathway (30) also regulate TNF-alpha promoter activity. The regulation of TNF-alpha gene transcription is cell type-specific (15, 16, 19, 25), and different response elements such as AP-1 (25, 31), AP-2 (25, 31), CRE (cAMP response element) (19, 20, 32), SP-1 (19, 20, 24, 25), Krox-24 (25, 33), NF-kappa B (34-37), and NFAT (nuclear factor activated T cells) (19, 20, 26, 38) have been identified in the TNF-alpha promoter.

The data shown here demonstrate that overexpression of Cot kinase enhances TNF-alpha secretion in Jurkat cells. Transfection of Cot kinase in Jurkat T cells promotes TNF-alpha gene expression. We also demonstrate that a dominant negative form of Cot kinase inhibits TNF-alpha promoter-driven transcription. Our data also further demonstrate that Cot kinase activates TNF-alpha promoter-driven transcription in a CSA-resistant way and that Cot kinase regulates at least the AP-1 and AP-2 response elements.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

DNA Constructs-- The DraI fragment (222-1871 nt) of cot (8) was subcloned in the eukaryotic expression vector pEF-BOS, previously digested with BamHI, treated with CIP, and subsequently with Klenow enzyme. A pEF-BOS-cot construct, in the 5'-3' orientation relative to the EF promoter, was selected. A similar pEF-BOS-trunc-cot construct, in the 5'-3' orientation relative to the EF promoter, was obtained by digesting truncated cot with DraI (30-1302 nt) (5).

The inactive kinase form of full-length cot was generated by PCR. The AvaI-HindIII fragment of cot was cloned into the AvaI-HindIII sites of a normal pUC19 vector. A PCR with the mutagenic primers AGAATGGCGTGTGCACTGATCCCA and TAGTCTACCGAATTTAACTAGATG encompassing the substitution Lys-168 to Ala-168 was performed using this construct as template. Separately, cot cDNA (8) was ligated to a pUC19 vector devoid of AvaI and HindIII sites. The AvaI-HindIII fragment of cot was replaced by the mutated AvaI-HindIII fragment obtained by PCR, yielding inactive cot (inac-cot), which was subsequently cloned in the pEF-BOS vector as described for cot kinase and obtaining pEF-BOS-inac-cot(5'-3'). DNA sequencing of inac-cot was performed to verify the construct.

Different constructs of the TNF-alpha promoter linked to the luc gene (-1185 pTNFalpha -Luc, -615 pTNFalpha -Luc, and -36 pTNFalpha -Luc) were generously provided by Dr. J. S. Economou (25); the -362 pTNFalpha -Luc and -105 pTNFalpha -Luc constructs were generously provided by Dr. M. Lopez Cabrera. The collagenase promoter constructs -73 pcol-Luc and -63 pcol-Luc generously provided by Dr. A. Aranda, were described in Ref. 39. The NFAT-AP-1 composite element of the IL-2 promoter linked to the Luc gene was provided by Dr. G. Crabtree (40).

Generation of Antibodies-- The anti-CD3 monoclonal antibody was obtained by injecting 106 T3b hybridoma cells (41, 42), generously provided by Dr. F. Sanchez-Madrid in Balb/c mice, previously pristanized. Immunoglobulin from the ascitic fluid was purified by Sepharose-protein A chromatography.

Cells and Medium-- The human leukemia T cell line Jurkat was obtained from Dr. Abelardo López-Rivas and maintained in RPMI 1640 medium supplemented with 10% fetal calf serum (Life Technologies, Inc.), gentamycin (50 µg/ml), and L-glutamine (2 mM) (complete medium).

TNF-alpha Production Assay-- DNA-mediated gene transfer into Jurkat cells was accomplished by electroporation (43). Exponentially growing cells were washed and resuspended in complete medium at a concentration of 2 × 107/ml, and 1 ml of the cell suspension was transferred into a 0.4-cm electroporation cuvette (Bio-Rad), and unless otherwise indicated, 10 µg of the different pEF-BOS constructs and 5 µg of the different pTNFalpha -Luc constructs were added. Electroporation was accomplished with a Gene Pulser apparatus (Bio-Rad) with a capacitance of 960 microfarads and an electrical field of 300 V. The electroporated cells were transferred into tissue culture flasks (Costar) in complete medium at a concentration of 106 cells/ml. After 2 h in culture, transfected cells were stimulated with calcium ionophore A23187 (Boehringer Mannheim) and different concentrations of PDBu (Sigma) or with soluble anti-CD3 for 24 h. Culture supernatants were tested for TNF-alpha production with the human TNF-alpha quantification enzyme-linked immunosorbent assay kit (Genzyme), following the manufacturer's instructions. The detection limit according to the standard curve was over 73 pmol.

The transfection efficiency of electroporation, as tested by expression of the fluorescent protein from the pTR-UF2 construct (44), was about 35%.

RT-PCR Assay-- Jurkat cells were electroporated with pEF-BOS (10 µg/ml), pEF-BOS-cot(5'-3') (10 µg/ml), or no plasmid. After 30 min incubation cells were stimulated for 6 h, with 0.25 µM calcium ionophore and 50 ng/ml PDBu or 0.1 µM calcium ionophore and 5 ng/ml PDBu, and total RNA was extracted using Ultraspec (Biotech), according to the manufacturer's instructions.

To perform the RT reaction (45), 2 µg of total RNA from nonstimulated or stimulated cells were heated at 37 °C for 30 min in the presence of 100 mM dithiothreitol, 0.5 mM dNTPs, 50 units of ribonuclease inhibitor (Life Technologies, Inc.), 2.5 units of DNase (Life Technologies, Inc.) and RT buffer (Life Technologies, Inc.), and then treated at 95 °C for 5 min. Ten µM random primers (Life Technologies, Inc.) were subsequently added, and the mixture was heated at 70 °C for 10 min. After chilling on ice, 200 units of reverse transcriptase (Superscript RNase H-, Life Technologies, Inc.) were added, and the reaction was continued at 42 °C for 60 min. The reaction was finished by heating at 99 °C for 5 min.

To perform the PCR the specific oligonucleotides, 5' AGCCTCTTCTCCTTCCTGAT (277-297 nt) and 3' AGTAGATGAGGGTCCAGGAG (575-595 nt), deduced from the human TNF-alpha cDNA, and 5' AGCACAATGAAGATCAAGAT (1292-1311 nt) and 3' TGTAACGCAACTAAGTCATA (1460-1479 nt), deduced from the human beta -actin cDNA were used. The first round was performed for 25 cycles, with 10 µM TNF-alpha primers, 1 µM beta -actin primers, and with 1 µl of the RT, and at an annealing temperature of 57 °C. The second round was performed in the same conditions, using 0.2 µl of the first PCR as template, except that 10 µM of the 4 primers were used. The reactions were analyzed in 1% agarose gels.

TNF-alpha Promoter-driven Transcription Assay-- DNA-mediated gene transfer into Jurkat cells was performed as explained above. Jurkat cells were cotransfected with different TNF-alpha promoter-Luc reporter constructs (5 µg/ml) together with control construct (pEF-BOS) (10 µg/ml) or different pEF-BOS-cot constructs (10 µg/ml). After 30 min in culture, cells were stimulated for 12 h with different stimuli as follows: soluble anti-CD3, soluble anti-CD28 9.3 antibody (generously donated by Dr. C. June), calcium ionophore A23187, or PHA (Sigma) in the presence or absence of different concentrations of PDBu (Sigma). 8-Br-cAMP (Boehringer Mannheim), Dex (Sigma), CSA, or PD 98059 (MEK inhibitor) (Calbiochem) were added to the cells 30 min after electroporation and then the cells were stimulated 2 h later. Twelve hours after stimulation cells were collected by centrifugation, and Luc activity was determined by the luciferase assay kit (Promega), according to the manufacturer's instructions. Cell extracts were normalized by protein measurements with the Dc protein assay (Bio-Rad).

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cot Kinase Promotes TNF-alpha Production in Submaximally Stimulated Jurkat T Cells-- Table I illustrates the effect of Cot expression in Jurkat T cells on TNF-alpha production. Jurkat cells stimulated with 0.25 µM calcium ionophore and 50 ng/ml PDBu (maximum stimulation) produced about 240 pmol/5 × 105 cells of TNF-alpha , independently of whether cells were electroporated with pEF-BOS-cot(5'-3'), pEF-BOS, or no plasmid. Stimulation with suboptimal concentrations of calcium ionophore and PDBu only increased TNF-alpha production in cells overexpressing Cot kinase (Table I). Soluble anti-CD3 (10 µg/ml) alone did not stimulate TNF-alpha production in pEF-BOS or non-plasmid electroporated cells. However, with this stimulus TNF-alpha production was detected in pEF-BOS-cot(5'-3')-electroporated cells. In the absence of any stimuli pEF-BOS-cot(5'-3')-transfected cells were not able to produce TNF-alpha , indicating that overexpression of Cot kinase by itself was not able to induce TNF-alpha production.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Regulation of TNF-alpha production by Cot kinase
Jurkat cells (2 × 107) were electroporated with 10 µg/ml pEF-BOS-cot(5'-3'), 10 µg/ml pEF-BOS, or no DNA (---) as described under "Experimental Procedures" and stimulated with calcium ionophore A23187 (0.25 µM) and PDBu (50 ng/ml) (maximum stimulation), with calcium ionophore A23187 (0.1 µM) and PDBu (5 ng/ml), with calcium ionophore A23187 (0.1 µM) and PDBu (0.5 ng/ml), or with soluble anti-CD3 (10 µg/ml) for 24 h, and TNF-alpha production was measured in the supernatant. The data expressed in pmol/5 × 105 cells show the mean of three experiments performed in duplicate.

Cot Kinase Induces TNF-alpha Gene Expression in Jurkat T Cells-- We then decided to investigate whether Cot kinase regulated TNF-alpha gene expression in Jurkat cells. RNA from pEF-BOS, pEF-BOS-cot(5'-3'), or non-plasmid electroporated cells stimulated or not with different concentrations of calcium ionophore and PDBu was isolated to perform RT-PCR assays. In the different electroporated cells stimulated with 0.25 µM calcium ionophore and 50 ng/ml PDBu (maximum stimulation), TNF-alpha mRNA was detected (Fig. 1). A similar amount of TNF-alpha PCR product was obtained in Cot-transfected cells stimulated with 0.1 µM calcium ionophore and 5 ng/ml PDBu (submaximal stimulation). However, in pEF-BOS or no plasmid-transfected cells incubated with these concentrations of stimuli, a significant decrease in the intensity of the band corresponding to the TNF-alpha PCR product was detected. Without stimuli, the TNF-alpha PCR product was only detected in cells overexpressing Cot kinase (Fig. 1).


View larger version (37K):
[in this window]
[in a new window]
  		Fig. 1.   Cot kinase induces TNF-alpha mRNA levels in Jurkat cells. Total RNA from Jurkat cells electroporated with pEF-BOS-cot(5'-3') (10 µg/ml), pEF-BOS (10 µg/ml), or no plasmid and incubated for 6 h with calcium ionophore (0.25 µM) and PDBu (50 ng/ml) (Max. Sti.), or calcium ionophore (0.1 µM) and PDBu (5 ng/ml) (Submax. Sti.), or nonstimulated (C) was used for the RT-PCR as described under "Experimental Procedures." Ten µl of second PCRs were loaded on a 1% agarose gel.

Cot Kinase Activates -1185 TNF-alpha Promoter-driven Transcription in Jurkat T Cells-- Next, we decided to determine whether Cot kinase enhanced TNF-alpha promoter-driven transcription. Jurkat cells electroporated with -1185 pTNFalpha -Luc alone or together with pEF-BOS-cot(5'-3') or pEF-BOS were subjected to different stimuli, and Luc activity was measured.

In -1185 pTNFalpha -Luc alone or together with pEF-BOS electroporated cells, it is necessary to add both calcium ionophore (0.25 µM) and PDBu (50 ng/ml) (maximum stimulation) to observe an increase (about 25-fold) in TNF-alpha promoter-driven transcription (Fig. 2A). Cells transfected with Cot kinase together with the -1185 pTNFalpha -Luc exhibited a similar Luc activity in the absence of any stimulus (Fig. 2A). Jurkat cells overexpressing Cot kinase treated with calcium ionophore (0.25 µM) and PDBu (50 ng/ml) (maximum stimulation) or calcium ionophore (0.25 µM) alone resulted in a further increase in the Luc activity. Stimulation of these cells with 50 ng/ml PDBu, or with suboptimal doses of calcium ionophore and PDBu (0.1 µM and 5 ng/ml respectively), or with 2 µg/ml of PHA did not further enhance Cot kinase-induced TNF-alpha promoter activation (Fig. 2A).


View larger version (36K):
[in this window]
[in a new window]
  		Fig. 2.   TNF-alpha promoter activation by Cot kinase. Jurkat cells were transfected with the -1185 TNF-alpha promoter-Luc construct (5 µg/ml) together with pEF-BOS-cot(5'-3') (10 µg/ml), pEF-BOS (10 µg/ml), or no pEF-BOS construct (A); pEF-BOS-trunc-cot(3'-5') (10 µg/ml), pEF-BOS-cot(5'-3') (10 µg/ml), pEF-BOS (10 µg/ml), or no pEF-BOS construct (B). A, after addition of different stimuli calcium ionophore (0.25 µM) and PDBu (50 ng/ml) (Max. Sti.), PDBu (50 ng/ml), calcium ionophore (0.25 µM), PHA (2 µM), or calcium ionophore (0.1 µM) and PDBu (5 ng/ml) (Submax. Sti) Luc activity was measured. C, nonstimulated cells; I, calcium ionophore. The graph shows the mean of fold induction of three different experiments, giving a value of 1 to cells electroporated with the -1185 TNF-alpha promoter-Luc construct and not stimulated. B, 8-Br-cAMP (0.5 mM), Dex (10-7 M), CSA (100 ng/ml), or MEK inhibitor (20 µg/ml) were added to the different cells. Cells electroporated with the -1185 TNF-alpha promoter-Luc construct alone or together with the pEF-BOS construct were stimulated 2 h later with calcium ionophore (0.25 µM) and PDBu (50 ng/ml). After stimulation Luc activity was measured. The graph shows the mean induction of three different experiments, giving a value of 100% of Luc activity to the different transfected cells without addition of inhibitors, C.

Similar results were obtained when Jurkat cells were transfected with pEF-BOS-trunc-cot(5'-3') instead of pEF-BOS-cot(5'-3') (data not shown). Jurkat cells overexpressing the kinase-inactive form of Cot, by transfection of pEF-BOS-inac-cot(5'-3'), did not enhance the -1185 pTNFalpha -driven transcription of the Luc gene (data not shown). These data indicate that the kinase activity of Cot is necessary for TNF-alpha promoter activation.

Regulation of -1185 TNFalpha Promoter-driven Transcription by 8-Br-cAMP, Dex, CSA, and MEK Inhibitor in Cot Kinase and Truncated Cot Kinase-transfected Jurkat Cells-- Several compounds were used to study if overexpression of Cot kinase stimulated the TNF-alpha promoter-driven transcription through the same mechanism as PDBu and calcium ionophore. Cells electroporated with -1185 pTNFalpha -Luc and either pEF-BOS-cot(5'-3'), pEF-BOS-trunc-cot(5'-3'), pEF-BOS, or no additional plasmid were incubated with 8-Br-cAMP, Dex, CSA, or MEK inhibitor. Cells transfected with -1185 pTNFalpha -Luc alone or together with pEF-BOS were also incubated with 50 ng/ml PDBu and 0.25 µM calcium ionophore.

Addition of 8-Br-cAMP (0.5 mM) or Dex (10-7 M) at concentrations that have been described to inhibit IL-2 promoter transcription in Jurkat T cells (46-48) did not inhibit TNF-alpha promoter-driven transcription (Fig. 2B) in the different transfected cells, and MEK inhibitor (20 µM) reduced the Luc activity of all the electroporated cells by about 50%.

CSA added at a concentration of 100 ng/ml inhibited the TNF-alpha promoter-driven transcription in cells electroporated with pEF-BOS and -1185 pTNFalpha -Luc or only with pTNFalpha -Luc by 90%. CSA, used at the same concentration, did not significantly inhibit the TNF-alpha promoter transcription activity in Jurkat cells overexpressing truncated Cot kinase or Cot kinase (Fig. 2B).

Soluble Anti-CD28 or Soluble Anti-CD3 Does Not Cooperate with Cot Kinase for Transactivation of the TNF-alpha Promoter-- To determine whether stimulation with soluble anti-CD28 (1 µg/ml) or with soluble anti-CD3 (10 µg/ml) further enhanced Cot kinase activation of the TNF-alpha promoter, cells were electroporated with either pEF-BOS-cot(5'-3') or pEF-BOS, and -1185 pTNFalpha Luc or only with the -1185 pTNFalpha -Luc, and different stimuli were added.

Soluble anti-CD3 (10 µg/ml) or soluble anti-CD28 (1 µg/ml) did not enhance the TNF-alpha promoter-driven transcription in cells overexpressing Cot kinase. However, addition of both stimuli together, or anti-CD28 (1 µg/ml) and PDBu (20 ng/ml), increased the Cot kinase-induced TNF-alpha promoter-driven transcription by about 2-fold (Fig. 3). CSA inhibited TNF-alpha promoter activity by about 30% in Cot kinase overexpressing cells stimulated with anti-CD3 and anti-CD28. Nevertheless, CSA hardly inhibited TNF-alpha promoter activation in Cot-transfected cells stimulated with anti-CD28 and PDBu (Fig. 3).


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 3.   Effect of soluble anti-CD3 and soluble anti-CD28 on Cot kinase TNF-alpha promoter-driven transcription. Jurkat cells were transfected with the -1185 TNF-alpha promoter-Luc construct (5 µg/ml) alone, or together with pEF-BOS-cot(5'-3') (10 µg/ml), or pEF-BOS (10 µg/ml). After addition of different stimuli anti-CD28 (1 µg/ml), anti-CD3 (10 µg/ml), anti-CD28 (1 µg/ml) and anti-CD3 (10 µg/ml), anti-CD28 (1 µg/ml) and PDBu (20 ng/ml) in the presence or absence of CSA (100 ng/ml) Luc activity was measured; C, nonstimulated cells. The graph shows mean of fold induction of three different experiments, giving a value of 1 to cells electroporated with the -1185 TNF-alpha promoter-Luc construct and not stimulated.

Cells electroporated with the -1185 pTNFalpha -Luc alone or together with pEF-BOS exhibited a significant activation of the TNF-alpha promoter-driven transcription when stimulated with anti-CD28 and anti-CD3 (about a 9-fold induction) or when activated with anti-CD28 and PDBu (about a 20-fold induction) (Fig. 3). In these cells CSA inhibited a 30% TNF-alpha promoter activation by soluble anti-CD3 and anti-CD28 and did not regulate the stimulation by anti-CD28 and PDBu. One of the hallmarks of the anti-CD28 stimulation of cytokine production is its insensitivity to CSA (49).

Expression of Kinase-inactive Cot Inhibits TNF-alpha Promoter Activation in Stimulated Jurkat Cells-- Jurkat cells electroporated with -1185 pTNFalpha -Luc alone or together with pEF-BOS-inac-cot(5'-3') or pEF-BOS were subjected to stimulation with different additives, and TNF-alpha promoter-driven transcription of the Luc gene was measured.

pEF-BOS-inac-cot-transfected cells exhibited a significant reduction in the Luc activity, when compared with cells electroporated with pEF-BOS and -1185 pTNFalpha -Luc or with cells electroporated only with -1185 pTNFalpha -Luc. Inhibition of the TNF-alpha promoter-driven transcription in kinase-inactive Cot electroporated cells was observed with all the different stimuli: soluble anti-CD28 and PDBu, or soluble anti-CD3 and PDBu, or calcium ionophore and PDBu, although the percentage of inhibition varied with the different stimuli and different concentrations used (Fig. 4).


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 4.   Inactive Cot kinase inhibits induced TNF-alpha promoter-driven transcription in stimulated Jurkat T cells. Jurkat T cells electroporated with -1185 TNF-alpha promoter-Luc (5 µg/ml) alone, or together with pEF-BOS (10 µg/ml) or pEF-BOS-inac-cot(5'-3') (10 µg/ml) were subjected to stimulation with different additives: anti-CD28 (1 µg/ml) and PDBu (1, 5, or 10 ng/ml), or anti-CD3 (10 µg/ml) and PDBu (1, 5, or 10 ng/ml), or calcium ionophore (0.25 µM) and PDBu (1, 5, or 10 ng/ml), and Luc activity was measured. I, calcium ionophore. The figure shows one of the two experiments performed. square , no plasmid; open circle , pEF-BOS; bullet , pEF-BOS inactive Cot.

Cot Kinase Regulation of Different TNF-alpha Promoter Constructs in Jurkat Cells-- To determine the sites in the TNF-alpha promoter that Cot kinase could regulate, cells were electroporated with different constructs of the TNF-alpha promoter linked to the Luc gene (-1185, -615, -362, -105, or -36 bp pTNFalpha -Luc) and with pEF-BOS-cot(5'-3') or with pEF-BOS. Cells electroporated with pEF-BOS and the different TNF-alpha promoter constructs were stimulated with calcium ionophore (0.25 µM) and PDBu (50 ng/ml), or with soluble anti-CD28 (1 µg/ml) and PDBu (50 ng/ml). No stimulus was added when cells were transfected with pEF-BOS-cot(5'-3') and the different pTNFalpha -Luc constructs. The -1185 pTNFalpha -Luc construct exhibited the highest Luc activity (100%) when compared with the other TNF-alpha promoter constructs.

Cot kinase overexpressing cells with the -615- and -105 pTNFalpha -Luc constructs exhibited 36 and 49%, respectively, of the maximal Luc activity (Fig. 4). In pEF-BOS electroporated cells stimulated with PDBu and ionophore the Luc activity was 6.7% for -615 pTNFalpha -Luc construct and 4.7% for the -106 pTNFalpha -Luc construct. The Luc activity in pEF-BOS electroporated cells stimulated with anti-CD28 and PDBu was about 12 and 15% for the -615- and -105 TNF-alpha promoter-Luc constructs, respectively.

Cot kinase also activated the -36 pTNFalpha -Luc construct; this plasmid only contains an AP-2 response element (25). This increase in the -36 TNF-alpha promoter-driven transcription with Cot kinase was similar to that observed in pEF-BOS electroporated cells stimulated with 1 µg/ml anti-CD28 and 50 ng/ml PDBu (Fig. 5). Activation of the different TNF-alpha promoter-Luc constructs by Cot kinase was CSA-insensitive (data not shown). Truncated Cot kinase activated the different TNF-alpha promoter-Luc constructs described above in a similar manner as Cot kinase (data not shown).


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 5.   Cot kinase regulation of TNF-alpha promoter constructs in Jurkat cells. Jurkat cells were transfected with pEF-BOS-cot(5'-3') (10 µg/ml) or with pEF-BOS (10 µg/ml) and different constructs of the TNF-alpha promoter (-1185, -615, -305, -106, or -36 bp) (5 µg/ml) linked to the Luc gene. Cells electroporated with pEF-BOS and the different TNF-alpha promoter-Luc constructs were stimulated with 0.25 µM calcium ionophore and 50 ng/ml PDBu or with anti-CD28 (1 µg/ml) and PDBu (50 ng/ml). To cells electroporated with pEF-BOS-cot(5'-3') and the different TNF-alpha promoter-Luc constructs no stimuli were added. 100% of Luc activity is given to the value obtained with -1185 TNF-alpha promoter-Luc-transfected cells. I, calcium ionophore. The graph shows the mean of three different experiments.

Cot Kinase Activation of the AP-1 Response Element in Jurkat Cells-- In Cot kinase-transfected cells the -105 pTNFalpha -Luc construct exhibited a much higher Luc activity than the -36 pTNFalpha -Luc construct. Several response elements have been identified in the -105- to -36-bp region of the human TNF-alpha promoter (19, 20, 25, 37), including the -60 bp AP-1 response element. Rhoades et al. (25) have shown, in different cell systems, that this AP-1 response element plays an important role in the transcriptional regulation of the human TNF-alpha promoter. On the other hand, Cot/Tpl-2 kinase is a mitogen-activated protein kinase kinase kinase that activates the ERK1 and the JNK pathways and consequently induces JNK to phosphorylate c-jun (1). All these data indicated that Cot/Tpl-2 kinase could regulate the AP-1 response element. To test this hypothesis we decided to study the regulation of the AP-1 element by Cot kinase in Jurkat cells. To perform this study two different constructions were used. One was the -73 col promoter linked to the Luc gene that contains only an AP-1 site as response element (39, 50). The other construct was the NFAT-AP-1 composite element from the IL-2 promoter linked to the Luc gene (40, 51, 52).

To determine whether the expression of Cot and truncated Cot could contribute to the activation of the -73 col promoter, we examined the effect of transfection of pEF-BOS-trunc-cot(5'-3'), pEF-BOS-cot(5'-3'), pEF-BOS, or no additional plasmid on the -73 col promoter-driven transcription of the Luc gene.

Cells transfected with truncated Cot or Cot kinase exhibited, respectively, a 15- or 12-fold higher Luc activity than cells electroporated with -73 pcol-Luc alone or together with pEF-BOS (Fig. 6A). Addition of PDBu (50 ng/ml) or calcium ionophore (0.25 µM) to cells electroporated with -73 pcol-Luc alone or together with pEF-BOS did not increase the value of the Luc activity; however, an increase of about 7-fold was observed when both stimuli were added together (Fig. 6A) (50). Addition of 0.25 µM calcium ionophore alone or 0.25 µM calcium ionophore and 50 ng/ml PDBu further increased the -73 col promoter-driven transcription in cells overexpressing truncated Cot or Cot. Addition of PDBu alone to these cells did not further enhance the -73 col promoter-driven transcription (Fig. 6A). As expected, Cot kinase did not activate the -63 col promoter linked to the Luc gene (data not shown). In this construct the AP-1 element is deleted (39, 50).


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 6.   Cot kinase regulation of the -73 col promoter and the NFAT-AP-1 composite element of the IL-2 promoter. Cells were transfected with pEF-BOS-trunc-cot(5'-3') (10 µg/ml), pEF-BOS-cot(5'-3') (10 µg/ml), pEF-BOS (10 µg/ml), or no pEF-BOS plasmid and with the -73 col promoter-Luc (5 µg/ml) (A) or the NFAT-AP-1 composite from the IL-2 promoter linked to Luc gene (5 µg/ml) (B). A and B, cells were stimulated with PDBu (50 ng/ml), or calcium ionophore (0.25 µM), or PDBu (50 ng/ml) and calcium ionophore (0.25 µM), and Luc activity was measured. C, nonstimulated cells; I, calcium ionophore. The graph shows the mean fold induction of three different experiments, giving a value of 1 to cells not stimulated and electroporated with the -73 col promoter-Luc (A) or the NFAT-AP-1-Luc (B).

Jurkat cells were transfected with the NFAT-AP-1 composite element from the IL-2 promoter linked to the Luc gene alone or together with pEF-BOS-trunc-cot(5'-3'), pEF-BOS-cot(5'-3'), or pEF-BOS. In the absence of any stimuli truncated Cot or Cot activated about 20- or 15-fold, respectively, the Luc activity when compared with cells electroporated with the NFAT-AP-1-Luc construct alone or together with pEF-BOS plasmid (Fig. 6B). Stimulation with 0.25 µM calcium ionophore and 50 ng/ml PDBu increased the Luc activity by about 1000-fold, independently of whether cells were electroporated with the NFAT-AP-1-Luc alone or together with pEF-BOS-trunc-cot(5'-3'), pEF-BOS-cot(5'-3'), or pEF-BOS. Addition of calcium ionophore alone only increased the Luc activity to this extent in cells overexpressing truncated Cot kinase or Cot kinase. Addition of 50 ng/ml PDBu did not stimulate the Luc activity in any of the transfected cells (Fig. 6B).

Effect of 8-Br-cAMP, Dex, CSA, and MEK Inhibitor on the AP-1 Response Element Activated by Cot Kinase in Jurkat T Cells-- To study whether overexpression of Cot kinase and calcium ionophore stimulated the AP-1 response element through the same mechanism as PDBu and calcium ionophore, several inhibitors were added to electroporated cells prior to stimulation.

Cells transfected with pEF-BOS-cot(5'-3') and -73 pcol-Luc were stimulated only with calcium ionophore (0.25 µM). Cells electroporated with pEF-BOS and -73 pcol-Luc, or only with the -73 pcol-Luc were activated with calcium ionophore (0.25 µM) and PDBu (50 ng/ml). Addition of 8-Br-cAMP (0.5 mM) or Dex (10-7 M) did not inhibit the Luc activity in any of the transfected cells (Fig. 7A). MEK inhibitor reduced the -73 col promoter-driven transcription by about 60% independently of whether Jurkat cells were transfected with Cot kinase or not. CSA inhibited the Luc activity in Cot-transfected cells by about 15% and the Luc activity in cells electroporated with pEF-BOS and -73 pcol-Luc by about 50% (Fig. 7A).


View larger version (19K):
[in this window]
[in a new window]
  		Fig. 7.   8-Br-cAMP, Dex, CSA, and MEK inhibitor on the regulation of AP-1 response element activated by Cot kinase. Cells were transfected with pEF-BOS-cot(5'-3') (10 µg/ml), pEF-BOS (10 µg/ml), or without pEF-BOS construct and with the -73 col promoter-Luc (5 µg/ml) (A) or the NFAT-AP-1-Luc (5 µg/ml) (B). A and B, after the addition of 8-Br-cAMP (0.5 mM), Dex (10-7 M), CSA (100 ng/ml), or MEK inhibitor (20 µg/ml). Cells transfected with pEF-BOS or without pEF-BOS were stimulated with PDBu (50 ng/ml) and calcium ionophore (0.25 µM), and cells electroporated with pEF-BOS-cot(5'-3') were stimulated with calcium ionophore (0.25 µM). The graphs show the mean induction of three different experiments, giving a value of 100% of Luc activity to the different transfected cells and without addition of inhibitors, C.

When the NFAT-AP-1 composite element from the IL-2 promoter was tested, CSA reduced almost completely the Luc activity in cells electroporated with pEF-BOS-cot(5'-3') and stimulated with calcium ionophore (0.25 µM) (Fig. 7B). In cells transfected with the NFAT-AP-1 composite site linked to the Luc gene alone or together with pEF-BOS, and stimulated with calcium ionophore (0.25 µM) and PDBu (50 ng/ml), the inhibition by CSA was complete (Fig. 7B). Addition of 8-Br-cAMP (0.5 mM) or Dex (10-7 M) did not inhibit the Luc activity in either pEF-BOS-cot(5'-3') or pEF-BOS-transfected cells. MEK inhibitor reduced (about 50%) the Luc activity of the NFAT-AP-1 composite linked to the Luc gene to the same extent in all the electroporated cells (Fig. 7B).

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cot/Tpl-2 kinase is a protein serine/threonine kinase that belongs to the mitogen-activated protein kinase kinase kinase family (2-4). Cot/Tpl-2 kinase has been involved in IL-2 production (43) and lymphocyte activation (1, 9, 10). This paper demonstrates that Cot promotes TNF-alpha production in Jurkat cells stimulated by soluble anti-CD3 or by low concentrations of PDBu and calcium ionophore. In addition, the data also show that Cot kinase, by itself, promotes TNF-alpha mRNA expression. The data also show that Cot kinase induces TNF-alpha promoter activation as it enhanced transcription of a reporter gene linked to the TNF-alpha promoter in Jurkat T cells. Here, we also demonstrate that expression of a kinase-inactive form of Cot inhibits TNF-alpha promoter activation. Together these data indicate that Cot kinase plays a critical role in T cell TNF-alpha production.

Overexpression of Cot kinase in Jurkat cells is sufficient to induce TNF-alpha gene expression (Fig. 1) and TNF-alpha promoter activation (Fig. 2) but not for TNF-alpha secretion (Table I), confirming that TNF-alpha production is not only regulated at transcriptional levels but that some additional events in TNF-alpha production are regulated. Supporting this view, calcium appears to control pre-TNF-alpha processing and TNF-alpha secretion (53-55), and the data shown here demonstrate that Cot kinase does not replace calcium-generated signals (see below).

We have recently shown that Cot kinase enhances IL-2 promoter activation, although, in contrast with the TNF-alpha promoter, Cot kinase alone could not regulate IL-2 promoter activation in Jurkat T cells (43). All these data also demonstrate that in the activation of TNF-alpha and IL-2 promoters some common intracellular pathways are shared, but other(s) are cytokine-specific.

Different signals regulate TNF-alpha gene expression in different cell types (15, 16, 19, 27). Calcium influx alone, by regulating at least the NFAT response elements in a CSA-dependent manner, is sufficient for the rapid gene induction in A20 B cells and Ar-5 T cells (19, 26, 27). On the other hand, stimulation of MLA 144 T cells, U937 macrophages, or 729-6 B cells by phorbol esters is sufficient to induce TNF-alpha promoter activation; the AP-1 site plays an important role in this transcriptional regulation (25). Activation of the AP-1 of the -73 col promoter site in Jurkat T cells requires phorbol esters and calcium ionophore (Fig. 6) (50). The data shown here demonstrate that in Jurkat T cells stimulation with calcium ionophore or PDBu alone is not sufficient for induction of TNF-alpha transcription, which requires the addition of both stimuli together. Soluble anti-CD28 antibody or soluble anti-CD3 antibody are not sufficient either to stimulate expression of this gene, and in Jurkat T cells addition of PDBu is also needed.

Addition of PDBu to Cot-transfected cells does not further induce transactivation of the TNF-alpha promoter, the -73 col promoter, or the NFAT-AP-1 composite element, indicating that the effects of PDBu on the activation of the TNF-alpha promoter and the two AP-1 containing sequences tested can be replaced in Jurkat cells by overexpression of Cot kinase. However, Cot kinase does not mimic the effects of PDBu exactly, because Cot kinase overexpression alone activates the TNF-alpha promoter constructs, the collagenase promoter construct, and to a certain extent the NFAT-AP-1 composite element and PDBu does not.

Calcium influx activates TNF-alpha promoter through the CSA-sensitive NFAT response element (26, 27, 38, 56). Stimulation of TNF-alpha promoter by calcium and PDBu is CSA-sensitive, but Cot kinase TNF-alpha promoter activation is CSA-insensitive suggesting that Cot kinase activation of this promoter is independent of the calcium pathway. This hypothesis is reinforced by the fact that addition of calcium ionophore in Cot-transfected cells further stimulates the TNF-alpha promoter, the -73 col promoter, and also the NFAT-AP-1 composite element.

The results obtained with a kinase-inactive form of Cot (Fig. 4) and with MEK inhibitor and CSA (Fig. 2B) indicate that Cot kinase and stimulation by PDBu and calcium share some signal pathways (the ERK and probably the JNK transduction pathways), but not other(s), leading to TNF-alpha promoter activation.

To our knowledge this is the first time that TNF-alpha promoter has been shown to be activated by stimulation with anti-CD28 and PDBu. Cot kinase mimics better the activation of this promoter by anti-CD28 and PDBu than by calcium ionophore and PDBu, because activation of TNF-alpha promoter by Cot kinase or by anti-CD28 and PDBu is not regulated by CSA. On the other hand, we have also demonstrated that expression of a kinase-inactive form of Cot inhibits the TNF-alpha promoter-driven transcription stimulated by anti-CD28 and PDBu. Furthermore, unstimulated Cot-transfected cells or anti-CD28 and PDBu-stimulated pEF-BOS electroporated cells activated, through its AP-2 site, the -36 TNF-alpha promoter construct to a similar extent. Cot kinase-transfected cells exhibit an induction of about 20-fold in the NFAT-AP-1 composite element (Fig. 6B), a similar level of activation as that achieved by anti-CD28 and phorbol esters in Jurkat T cells (57). We have previously demonstrated that Jurkat cells express the cot gene prior to stimulation (43), but the mechanism by which Cot kinase is activated is still unknown. All these data indicate that anti-CD28 together with another stimulus could regulate Cot kinase activation in T cells.

    ACKNOWLEDGEMENTS

We thank Dr. Miyoshi for providing the truncated cot cDNA probe; Dr. Chan for the cot (est) cDNA probe; Dr. Arnero (Sandoz, España) for the cyclosporin A; and Dr. C. June for the 9.3 anti-CD28 antibody. We thank V. Calvo and M. Lopez Cabrera for the critical reading of the manuscript.

    FOOTNOTES

* This work was supported in part by Plan Nacional, Comunidad de Madrid, and Europharma.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Both authors contributed equally to this work.

§ Recipient of a fellowship from CSIC and Plan Nacional.

To whom correspondence should be addressed: Instituto Investigaciones, Biomédicas, CSIC, Arturo Duperier 4, 28029 Madrid, Spain. Tel.: 34-1-3975445; Fax: 34-1-5854587; E-mail: Salemany{at}biomed.iib.uam.es.

1 The abbreviations used are: ERK, extracellular signal-regulated kinase; TNF-alpha , tumor necrosis factor-alpha ; MEK, MAPK/ERK kinase; JNK, c-Jun N-terminal kinase; PDBu, phorbol 12,13-dibutyrate; Luc, luciferase; CSA, cyclosporin A; IL-2, interleukin 2; bp, base pair(s); RT, reverse transcriptase; PCR, polymerase chain reaction; Dex, dexamethasone; nt, nucleotide(s); PHA, phytohemagglutinin; inac-cot, inactive cot.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Salmerón, A., Ahmad, T. B., Carlille, G. W., Pappin, D., Narsimham, R. P., and Ley, S. C. (1996) EMBO J. 15, 817-826[Medline] [Order article via Infotrieve]
  2. Fanger, G. R., Gerwins, P., Widmann, C., Jarpe, M. B., and Johnson, G. L. (1997) Curr. Opin. Genet. & Dev. 7, 67-74[CrossRef][Medline] [Order article via Infotrieve]
  3. Hunter, T. (1997) Cell 88, 333-346[CrossRef][Medline] [Order article via Infotrieve]
  4. Robinson, M. J., and Cobb, M. H. (1997) Curr. Opin. Cell Biol. 9, 180-186[CrossRef][Medline] [Order article via Infotrieve]
  5. Miyoshi, J., Higashi, T., Mukai, H., Ohuchi, T., and Kakunaga, T. (1991) Mol. Cell. Biol. 11, 4088-4096[Abstract/Free Full Text]
  6. Aoki, M., Hamada, F., Sugimoto, T., Sumida, S., Akiyama, T., and Toyoshima, K. (1993) J. Biol. Chem. 268, 22723-22732[Abstract/Free Full Text]
  7. Aoki, M., Akiyama, T., Miyoshi, J., and Toyoshima, K. (1991) Oncogene 6, 1515-1519[Medline] [Order article via Infotrieve]
  8. Chan, A. M.-L., Chedid, M., McGovern, E. S., Popescu, N. C., Miki, T., and Aronson, S. A. (1993) Oncogene 8, 1329-1333[Medline] [Order article via Infotrieve]
  9. Makris, A., Patriotis, C., Bear, S. E., and Tsichlis, P. N. (1993) J. Virol. 67, 4283-4289[Abstract/Free Full Text]
  10. Patriotis, C., Makris, A., Bear, S. E., and Tsichlis, P. N. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2251-2255[Abstract/Free Full Text]
  11. Ceci, J. D., Patriotis, C. P., Tsatsanis, C., Makris, A. M., Kovatch, R., Swing, D. A., Jenkins, N. A., Tsichlis, P. N., and Copeland, N. G. (1997) Genes Dev. 11, 688-700[Abstract/Free Full Text]
  12. Erny, K. M., Peli, J., Lambert, J.-F., Muller, V., and Diggelmann, H. (1996) Oncogene 13, 2015-2020[Medline] [Order article via Infotrieve]
  13. Patriotis, C., Makris, A. M., Chernoff, J., and Tsichlis, P. N. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9755-9759[Abstract/Free Full Text]
  14. Troppmair, J., Bruder, J. T., Munoz, H., Lloyd, P. A., Kyriakis, J., Banerjee, P., Avruch, J., and Rapp, U. R. (1994) J. Biol. Chem. 269, 7030-7035[Abstract/Free Full Text]
  15. Goldfeld, A. E., and Maniatis, T. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1490-1494[Abstract/Free Full Text]
  16. Ware, C. F., Cruve, P. D., Grayson, M. H., Androlewicz, M. J., and Browing, J. L. (1992) J. Immunol. 149, 3881-3888[Abstract]
  17. Ferreri, N. R., Sarr, T., Askenase, P. W., and Ruddle, N. H. (1992) J. Biol. Chem. 267, 9443-9449[Abstract/Free Full Text]
  18. Cuturi, M. C., Murphy, M., Costa-Giomi, M. P., Weinmann, R., Perussia, B., and Trinchieri, G. (1987) J. Exp. Med. 165, 1581-1594[Abstract/Free Full Text]
  19. Tsai, E. Y., Yie, J., Thanos, D., and Goldfeld, A. E. (1996) Mol. Cell. Biol. 16, 5232-5244[Abstract]
  20. Tsai, E. Y., Jain, J., Pesavento, P. A., Rao, A., and Goldfeld, A. E. (1996) Mol. Cell. Biol. 16, 459-467[Abstract]
  21. Sung, S. S., Bjorndahl, J. M., Wang, C. Y., Kao, H. T., and Fu, S. M. (1988) J. Exp. Med. 167, 937-953[Abstract/Free Full Text]
  22. Fisher, H., Dohlsten, M., Andersson, U., Hedlund, G., Ericsson, P., Hansson, J., and Sjoren, H. O. (1990) J. Immunol. 144, 4663-4669[Abstract]
  23. Goldfeld, A. E., Strominger, J. L., and Doyle, C. (1991) J. Exp. Med. 174, 73-81[Abstract/Free Full Text]
  24. Leitman, D. C., Mackoe, E. R., Williams, T., Baxter, J. D., and West, B. L. (1992) Mol. Cell. Biol. 12, 1352-1356[Abstract/Free Full Text]
  25. Rhoades, K., Golub, S. H., and Economou, J. S. (1992) J. Biol. Chem. 267, 22102-22107[Abstract/Free Full Text]
  26. Goldfeld, A. E., McCaffrey, P. G., Strominger, J. L., and Rao, A. (1993) J. Exp. Med. 178, 1365-1379[Abstract/Free Full Text]
  27. McCaffrey, P. G., Goldfeld, A. E., and Rao, A. (1994) J. Biol. Chem. 269, 30445-30450[Abstract/Free Full Text]
  28. Steffen, M., Ottmann, O. G., and Moore, M. A. (1988) J. Immunol. 140, 2621-2624[Abstract]
  29. Santis, A. G., Campanero, M. R., Alonso, J. L., Tugores, M. A., Yague, E., Pivel, J. P., and Sanchez-Madrid, F. (1992) Eur. J. Immunol. 22, 1253-1259[Medline] [Order article via Infotrieve]
  30. Santis, A. G., Campanero, M. R., Alonso, J. L., and Sanchez-Madrid, F. (1992) Eur. J. Immunol. 22, 3155-3160[Medline] [Order article via Infotrieve]
  31. Sung, S. J., Walters, J. A., and Fu, S. M. (1991) J. Immunol. 147, 2047-2054[Abstract]
  32. Newell, C. L., Deisseroth, A. B., and Lopez-Berestein, G. (1994) J. Leukocyte Biol. 56, 27-54[Abstract]
  33. Kramer, B., Meichle, A., Hensel, G., Charnay, P., and Kronke, M. (1994) Biochim. Biophys. Acta 1219, 413-421[Medline] [Order article via Infotrieve]
  34. Steffan, N. M., Bren, G. B., Frantz, B., Tocci, M. J., O`Neill, A., and Paya, C. V. (1995) J. Immunol. 155, 4685-4691[Abstract]
  35. Collart, M. A., Baeuerde, P., and Vassalli, P. (1990) Mol. Cell. Biol. 10, 1498-1506[Abstract/Free Full Text]
  36. Drouet, C., Shakhov, A. N., and Jongeneel, C. V. (1991) J. Immunol. 147, 1694-1700[Abstract]
  37. Goldfeld, A. E., Doyle, C., and Maniatis, T. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9769-9773[Abstract/Free Full Text]
  38. Goldfeld, A. E., Tsai, E., Kincaid, R., Belshaw, P. J., Schrieber, S. L., Strominger, J. L., and Rao, A. (1986) Cell. Immunol. 103, 19-26[CrossRef][Medline] [Order article via Infotrieve]
  39. Deng, T., and Karin, M. (1993) Genes Dev. 7, 479-490[Abstract/Free Full Text]
  40. Durand, D. B., Shan, J. P., Bush, M. R., Replogle, R. E., Beld, R., and Crabtree, G. R. (1988) Mol. Cell. Biol. 8, 1715-1724[Abstract/Free Full Text]
  41. Arroyo, A. G., Campanero, M. R., Sanchez-Mateos, P., Zapata, J. M., Ursa, M. A., del Pozo, M. A., and Sanchez-Madrid, F. (1994) J. Cell Biol. 126, 1277-1286[Abstract/Free Full Text]
  42. Spits, H., Issel, H., Leeuwenberg, J., and de Vries, J. E. (1985) Eur. J. Immunol. 15, 88-91[Medline] [Order article via Infotrieve]
  43. Ballester, A., Tobeña, R., Lisbona, C., Calvo, V., and Alemany, S. (1997) J. Immunol. 159, 1613-1618[Abstract]
  44. Zolotuknin, S., Potter, M., Hauswirth, W. W., Guy, J., and Muzyczka, N. (1996) J. Virol. 70, 4646-4654[Abstract]
  45. Souzé, F., Ntodou-Thome, A., Tran, C. Y., Rosténe, W., and Forgez, P. (1996) Biotechniques 21, 280-284[Medline] [Order article via Infotrieve]
  46. Paliogianni, F., Raptis, A., Ahuja, S. S., Najiar, S. M., and Boumpas, D. T. (1993) J. Clin. Invest. 91, 1481-1489
  47. Northrop, J. P., Crabtree, G. R., and Mattila, P. S. (1992) J. Exp. Med. 175, 1235-1245[Abstract/Free Full Text]
  48. Ohtsuka, T., Kaziro, Y., and Satoh, T. (1996) Biochim. Biophys. Acta 1310, 223-232[Medline] [Order article via Infotrieve]
  49. Linsley, P. S., and Ledbetter, J. A. (1993) Annu. Rev. Immunol. 11, 191-212[Medline] [Order article via Infotrieve]
  50. Su, B., Jacinto, E., Hibi, M., Karin, M., and Ben-Neriah, Y. (1994) Cell 77, 726-736
  51. Northrop, J. P., Ullman, K. S., and Crabtree, G. R. (1993) J. Biol. Chem. 268, 2917-2923[Abstract/Free Full Text]
  52. Jain, J., McCaffrey, P. G., Miner, Z., Kerppola, T. K., Lambert, J. N., Verdine, G. L., Curran, T., and Rao, A. (1993) Nature 365, 352-355[CrossRef][Medline] [Order article via Infotrieve]
  53. Correale, J., Gilmore, W., McMillan, M., McCarthy, K., Le, T., and Weinerm, L. P. (1995) J. Immunol. 154, 2959-2968[Abstract]
  54. Baumgartner, R. A., Yamada, K., Deramo, V. A., and Beaven, M. A. (1994) J. Immunol. 153, 2609-2617[Abstract]
  55. Hughes, C. B., El-Din, A. B., Kotb, M., Gaber, L. W., and Gaber, A. D. (1996) Pancreas 13, 22-28[Medline] [Order article via Infotrieve]
  56. Goldfeld, A. E., Flemington, E. K., Boussiotis, V. A., Theodos, C. M., Titus, R. G., Strominger, J. L., and Speck, S. H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 12198-12201[Abstract/Free Full Text]
  57. Ghosh, P., Sica, A., Cippitelli, M., Subleski, J., Lahesmaa, R., Young, H. A., and Rice, N. R. (1996) J. Biol. Chem. 271, 7700-7704[Abstract/Free Full Text]

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 CarcinogenesisHome page
P. Khanal, K.-Y. Lee, K.-W. Kang, B. S. Kang, and H. S. Choi
Tpl-2 kinase downregulates the activity of p53 and enhances signaling pathways leading to activation of activator protein 1 induced by EGF
Carcinogenesis, April 1, 2009; 30(4): 682 - 689.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
H. S. Choi, B. S. Kang, J.-H. Shim, Y.-Y. Cho, B. Y. Choi, A. M. Bode, and Z. Dong
Cot, a novel kinase of histone H3, induces cellular transformation through up-regulation of c-fos transcriptional activity
FASEB J, January 1, 2008; 22(1): 113 - 126.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. E. Munroe and G. A. Bishop
A Costimulatory Function for T Cell CD40
J. Immunol., January 15, 2007; 178(2): 671 - 682.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. S. Luciano, S. Hsu, P. L. Channavajhala, L.-L. Lin, and J. W. Cuozzo
Phosphorylation of Threonine 290 in the Activation Loop of Tpl2/Cot Is Necessary but Not Sufficient for Kinase Activity
J. Biol. Chem., December 10, 2004; 279(50): 52117 - 52123.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Sancho, A. Macho, L. de La Vega, M. A. Calzado, B. L. Fiebich, G. Appendino, and E. Munoz
Immunosuppressive Activity of Endovanilloids: N-Arachidonoyl-Dopamine Inhibits Activation of the NF-{kappa}B, NFAT, and Activator Protein 1 Signaling Pathways
J. Immunol., February 15, 2004; 172(4): 2341 - 2351.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Caivano, C. Rodriguez, P. Cohen, and S. Alemany
15-Deoxy-{Delta}12,14-prostaglandin J2 Regulates Endogenous Cot MAPK Kinase Kinase 1 Activity Induced by Lipopolysaccharide
J. Biol. Chem., December 26, 2003; 278(52): 52124 - 52130.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. L. Gandara, P. Lopez, R. Hernando, J. G. Castano, and S. Alemany
The COOH-Terminal Domain of Wild-Type Cot Regulates Its Stability and Kinase Specific Activity
Mol. Cell. Biol., October 15, 2003; 23(20): 7377 - 7390.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
W. Choi, S. Y. Eum, Y. W. Lee, B. Hennig, L. W. Robertson, and M. Toborek
PCB 104-Induced Proinflammatory Reactions in Human Vascular Endothelial Cells: Relationship to Cancer Metastasis and Atherogenesis
Toxicol. Sci., September 1, 2003; 75(1): 47 - 56.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
Y. W. Lee, B. Hennig, and M. Toborek
Redox-regulated mechanisms of IL-4-induced MCP-1 expression in human vascular endothelial cells
Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H185 - H192.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
L. P. Kane, M. N. Mollenauer, Z. Xu, C. W. Turck, and A. Weiss
Akt-Dependent Phosphorylation Specifically Regulates Cot Induction of NF-{kappa}B-Dependent Transcription
Mol. Cell. Biol., August 15, 2002; 22(16): 5962 - 5974.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Velasco-Sampayo and S. Alemany
p27kif Protein Levels and E2F Activity Are Targets of Cot Kinase During G1 Phase Progression in T Cells
J. Immunol., May 15, 2001; 166(10): 6084 - 6090.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Chiariello, M. J. Marinissen, and J. S. Gutkind
Multiple Mitogen-Activated Protein Kinase Signaling Pathways Connect the Cot Oncoprotein to the c-jun Promoter and to Cellular Transformation
Mol. Cell. Biol., March 1, 2000; 20(5): 1747 - 1758.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
A. Hoffmeyer, A. Grosse-Wilde, E. Flory, B. Neufeld, M. Kunz, U. R. Rapp, and S. Ludwig
Different Mitogen-activated Protein Kinase Signaling Pathways Cooperate to Regulate Tumor Necrosis Factor alpha  Gene Expression in T Lymphocytes
J. Biol. Chem., February 12, 1999; 274(7): 4319 - 4327.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. Sanchez-Gongora, C. Lisbona, R. de Gregorio, A. Ballester, V. Calvo, L. Perez-Jurado, and S. Alemany
COT Kinase Proto-oncogene Expression in T Cells. IMPLICATION OF THE JNK/SAPK SIGNAL TRANSDUCTION PATHWAY IN COT PROMOTER ACTIVATION
J. Biol. Chem., September 29, 2000; 275(40): 31379 - 31386.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. de Gregorio, M. A. Iniguez, M. Fresno, and S. Alemany
Cot Kinase Induces Cyclooxygenase-2 Expression in T Cells through Activation of the Nuclear Factor of Activated T Cells
J. Biol. Chem., July 13, 2001; 276(29): 27003 - 27009.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ballester, A.
Right arrow Articles by Alemany, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ballester, A.
Right arrow Articles by Alemany, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement