J Biol Chem, Vol. 273, Issue 23, 14138-14145, June 5, 1998
Inhibition by Platelet-activating Factor of Src- and
Hepatocyte Growth Factor-dependent Invasiveness of
Intestinal and Kidney Epithelial Cells
PHOSPHATIDYLINOSITOL 3'-KINASE IS A CRITICAL MEDIATOR OF TUMOR
INVASION*
Larissa
Kotelevets
§,
Veerle
Noë§¶
,
Erik
Bruyneel¶,
Evgueni
Myssiakine
,
Eric
Chastre
,
Marc
Mareel¶, and
Christian
Gespach
**
From
INSERM U482 and IFR 65, Hôpital
Saint-Antoine, 75571 Paris Cedex 12, France and the ¶ Laboratory
of Experimental Cancerology, De Pintelaan 185, B-9000 Gent, Belgium
 |
ABSTRACT |
This study was designed to
characterize platelet-activating factor receptor (PAF-R) expression and
function in normal and cancerous human colonic epithelial cells. PAF-R
gene transcripts were analyzed by reverse transcription-polymerase
chain reaction and Southern blot, using three sets of primers
corresponding either to the coding region of the human PAF-R sequence
(polymerase chain reaction product: 682 base pairs (bp)) or to the
leukocyte- and tissue-type transcripts of 166 and 252 bp, respectively.
An elongated splice variant was identified in the 5'-untranslated
region of the tissue-type PAF-R transcript (334 bp) in colonic
epithelial crypts and tumors. In human colonic PCmsrc cells transformed
by c-src oncogene, the hepatocyte growth factor
(HGF)-dependent invasiveness of collagen gels was abolished
by 0.1 µM PAF and restored by the PAF-R antagonists
WEB2086 and SR27417. PAF blocked HGF-induced tyrosine phosphorylation
of p125 focal adhesion kinase. The phosphatidylinositol 3'-kinase
(PI3'-K) inhibitors wortmannin and LY294002 totally blocked the
HGF-induced invasion. Similar effects were observed in ts-srcMDCK
kidney epithelial cells transformed by a v-Src temperature-sensitive mutant: (i) PAF and wortmannin exerted additive inhibitory effects on
Src-induced invasion and (ii) activated and dominant negative forms of
p110
PI3'-K, respectively, amplified and abrogated the Src- and
HGF-dependent invasiveness of parental and ts-srcMDCK cells. We also provided the first evidence for the contribution of
rapamycin-insensitive, pertussis toxin-dependent G-protein pathways to the integration of the signals emerging from activated Met
and PAF receptors. These results indicate that PI3'-K is a critical
transducer of invasiveness and strongly suggest that PAF exerts a
negative control on invasion by inhibiting this signaling pathway. A
possible beneficial role of PAF analogs on tumor invasion is therefore
proposed.
 |
INTRODUCTION |
Platelet-activating factor
(PAF),1
1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine,
is implicated in human inflammatory processes and gastric ulceration
disorders (1). In the intestine, PAF contributes to diarrhea in
ulcerative colitis (2). It is a potent lipid mediator produced by
neutrophils, eosinophils, monocytes, macrophages, platelets, and
endothelial cells via two main routes of biosynthesis: the remodeling
pathway and a second pathway termed de novo. Products of
phospholipid catabolism (PAF and eicosanoids) are detected in the
gastrointestinal mucosa and epithelial cells during the inflammatory
process and neoplastic progression (3, 4). Colonic epithelium has been
reported to synthesize and secrete PAF acetylhydrolases, which
constitute a major pathway for PAF degradation (5). Increased levels of
PAF in intestinal mucosa have been reported in experimental models of
colitis, Crohn's disease, and ulcerative colitis (2, 6, 7). Numerous
clinical and experimental observations reveal that colonic cancer is
increasingly frequent after inflammatory bowel disease, ulcerative
colitis, primary sclerosing cholangitis, and Crohn's disease (3, 8, 9), suggesting that PAF and its receptors initiate the cancerous progression through inflammatory disorders in the gastrointestinal mucosa. On the other hand, anti-inflammatory drugs are associated with
a lower risk of colon cancer and reduced mortality due to this disease
(10).
In view of the information above, we are now asking whether functional
PAF receptors (PAF-R) are present in both normal and transformed human
colonic epithelial cells. As a first step toward answering this
question, we investigated 1) the expression of PAF-R transcripts by
reverse transcription-polymerase chain reaction (RT-PCR) and Southern
blot in normal and transformed human colonic epithelial cells, 2) the
effects of PAF on invasion by tumor cells, using two models of PCmsrc
human colonic epithelial cells and ts-srcMDCK canine kidney epithelial
cells transformed by the src oncogene (11, 12), and 3) the
functional relationships between PAF receptors and the signaling
pathways involved in cell adhesion and invasion, namely
p125FAK focal adhesion kinase, phosphatidylinositol
3'-kinase (PI3'-K), and the E-cadherin/catenin invasion suppressor
system connected to the actin cytoskeleton via
-catenin (13).
In the present investigation, we showed the following. (i) Specific
tissue-type PAF-R transcripts are clearly identifiable in human
intestinal epithelial cells at various stages of cancerous progression
and cell differentiation; (ii) upon PAF addition, there was complete
reversion of the Src- and HGF-dependent invasiveness of
intestinal and kidney epithelial cells; (iii) the PI3'-K inhibitors wortmannin and LY294002 mimic and cooperate with PAF against invasion; (iv) there was phosphorylation of p125FAK by HGF that was
completely blocked by PAF; (v) constitutively activated PI3'-K and
dominant negative forms of the PI3'-K p110
catalytic subunit
respectively induced and abrogated the invasiveness of parental and
Src-transformed MDCK cells; and (vi) the HGF- and
PAF-dependent invasion pathways were sensitive to pertussis toxin (PTx), suggesting that heterotrimeric G protein components (G
i-
/
dimers) are involved in the signaling
cascades that affect the invasiveness of Src- and Met-transformed
epithelial cells.
A preliminary report of the results presented here has been published
in abstract form (14).
 |
EXPERIMENTAL PROCEDURES |
Materials--
Dulbecco's modified Eagle's medium was from
Life Technologies, Inc., and fetal calf serum from Eurobio.
[
-32P]ATP was from ICN; the enhanced chemiluminescence
(ECL) immunodetection system and Protein G-Sepharose were from Amersham
Pharmacia Biotech; PAF and wortmannin were from Calbiochem. Fatty
acid-free bovine serum albumin, Geneticin, PTx, rapamycin,
phenylmethylsulfonyl fluoride (PMSF), Triton X-100, Nonidet P-40, and
LY294002 were purchased from Sigma. SR27417A and WEB2086 were,
respectively, obtained from Sanofi and Boehringer Ingelheim (France).
The anti-phosphotyrosine monoclonal antibody (mAb) 4G10, and the
anti-p125FAK mAb (clone 77) were from Upstate
Biotechnology, Inc. (UBI) and Transduction Laboratories,
respectively.
Cell Lines, Cell Transfection, and Tissue Samples--
The human
intestinal epithelial cell lines Caco-2, PC/AA C1, CFI-3, HT-29, and
HT29-MTX were routinely grown in 6-cm diameter Petri dishes, as
described previously (15-17). CFI-3 cells were established from the
intestinal epithelia of a fetus with cystic fibrosis. This cell line
does not produce any tumor in athymic nude mice and is relatively
undifferentiated (15). The PC/AA/C1 cell line was established from a
colonic adenoma in a patient with familial adenomatous polyposis. This
cell line is nontumorigenic and exhibits a mucinous phenotype (16).
After transfer of the activated c-src oncogene, PCmsrc cells
became susceptible to invasiveness upon addition of HGF (11). The
colonic cancer cell lines HT-29, Caco-2, and HT29-MTX cells,
respectively, exhibit undifferentiated, enterocyte-type, and
mucinous-type phenotypes (17). Human colonic crypts were obtained from
fresh samples, as described previously (15).
MDCK canine kidney epithelial cells, transformed by a
temperature-sensitive mutant of v-Src (ts-srcMDCK cells, Cl2), exhibit an invasive phenotype at the permissive temperature of 35 °C, but
are not invasive at the restrictive temperature of 40 °C for v-Src
activity (12).
Transformed ts-srcMDCK cells were stably transfected by the
dominant-negative mutant of bovine PI3'-K p110-EcoS. This truncated form of PI3'-K p110
contains the binding site for the regulatory p85
subunit but lacks the catalytic domain (18). Cells were transfected by
the LipofectAMINETM method, using 25 µl of reagent/well and 10 µg
of plasmid for 2 × 106 cells (Life Technologies,
Inc.). After 48 h, cells were selected over a period of 2 weeks
with 500 µg/ml G418. Individual resistant colonies were then
isolated, picked, and expanded, and the expression of the mutant PI3'-K
p110-EcoS form was assessed by Northern blot. Parental MDCK cells and
MDCKp110* cells, stably transfected by the activated form of bovine
p110*
after addition of the C-terminal farnesylation signal from
Ha-Ras, were a generous gift from Dr. J. Downward (19).
Normal human leukocytes were isolated from peripheral blood and
purified by leukapheresis and countercurrent centrifugation elutriation
(20). Human leukemic HL-60 promyelocytes were cultured as described
previously (20). Specimens from patients who had undergone surgery for
colonic cancer were obtained from the Center de Chirurgie Digestive
(Prof. R. Parc, Hôpital Saint-Antoine, Paris, France). Tissue
samples were immediately frozen in liquid nitrogen and stored at
80 °C until use. Individual colon carcinomas were staged according
to Dukes' classification, as modified by Astler and Coller (17).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and
Southern Blot--
Total RNA was isolated by guanidinium
isothiocyanate extraction and cesium chloride density gradient
ultracentrifugation (11). To eliminate contamination by genomic DNA for
RT-PCR analysis, RNA samples were treated with RNase-free DNase.
First-strand cDNA was synthesized from 5 µg of total RNA, using
200 units of Moloney murine leukemia virus reverse transcriptase (Life
Technologies, Inc.), and random hexanucleotides (5 µM). A
fraction of the corresponding cDNA (1/10) was then amplified in 20 µl of reaction buffer containing 200 µM amounts of each
dNTP, 0.5 µM amounts of each primer, and 1 unit of
Ampli-Taq polymerase (Perkin-Elmer). Samples displaying a
clear PCR product of glyceraldehyde-3-phosphate dehydrogenase were
considered useful. Negative control reactions in which no RT was
performed were included in our experiments, to avoid artifacts due to
genomic DNA contamination.
As shown in Fig. 1, four sets of primers
were designed to amplify the RT-PCR products of the PAF-R gene
transcripts corresponding to the coding region, and the tissue- and
leukocyte-type 5'-UTR sequences (21-23). Thirty amplification cycles,
each comprising 30 s at 94 °C, 1 min 30 s at 60 °C, and
1 min 30 s at 72 °C, were run in an automatic thermal
Robocycler Gradient 96 (Stratagene). The reaction was initiated by a
5-min incubation at 94 °C and ended by a 7-min final extension at
72 °C. PCR products were analyzed by agarose gel electrophoresis and
visualized by ethidium bromide staining. Southern blot analysis was
performed to verify the authenticity of the PCR products, using two
internal probes: probe 1 (5'-CATCAAGACTGCTCAGGCCAACA-3') and probe 2 (5'-ACCAGGACCAGCTGATCATTC-3').

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of the PCR and
Southern analysis of PAF-R expression in normal and cancerous human
intestinal epithelial cells and leukocytes. The primers and
corresponding amplification product corresponding to each target
transcript were as follows: (i) coding region C, primers P4 (sense in
exon 3) (5'-CGGACATGCTCTTCTTGATCA-3') and P5 (antisense)
(5'-GTCTAAGACACAGTTGGTGCTA-3') (682 bp); (ii) antisense primer P3,
common to the leukocyte- and tissue-type transcripts
(5'-CCCGAGCACAAAGATGATGC-3'); (iii) the sense primers P2 in exon 1, specific for the leukocyte-type transcript L (166 bp;
5'-ACACACGGTCACTGCAGCTGAA-3') or P1 in exon 2, specific for the
tissue-type transcript T (334 bp; 5'-CCTGAGCTCCCCGAGAAGTCA-3'); (iv)
the sense primer P6 in exon 1, upstream primer P2, corresponding to the
leukocyte-type transcript and a PCR product of 345 bp
(5'-TCTGTGCAGTGCCCAGGTCT-3'). aT, additional tissue-type
transcript: 334 bp (dashed line in exon 1).
|
|
Subcloning and Sequencing of PCR Fragments--
To subclone the
RT-PCR fragments corresponding to the 5'-UTR of the tissue- or
leukocyte-type PAF-R transcript, amplicons were eluted from the agarose
gels using the Qiagen kit (Coger, France) and cloned in a PCR-TRAP
vector (GenHunter Corp.). Sequencing was performed using the Lseq and
Rseq primers and the Sequenase version 2.0 DNA sequencing kit (U. S. Biochemical Corp.).
Northern Blot Analysis--
Northern blot analysis for the
expression of PAF-R and PI3'-K in MDCK cells was performed as described
previously (11). RNA samples underwent electrophoresis in 1% agarose,
2.2 mol/liter formaldehyde gels, were transferred to Hybond
N+ nylon membranes (Amersham Pharmacia Biotech, United
Kingdom), and hybridized with the 32P-labeled probes
(Megaprime, Amersham Pharmacia Biotech). The relative amount of RNA in
each lane was judged to be similar by comparing the ethidium bromide or
methylene blue staining of the ribosomal bands. The specific probes
used were human PAF-R cDNA (21) and the EcoRI
restriction fragment of the p110
cDNA corresponding to the
N-terminal fragment of the dominant negative mutant of the enzyme
(18).
Invasion of Type I Collagen Gels--
Petri dishes were filled
with 1.2 ml of neutralized type I collagen (UBI) and incubated
overnight at 37 °C to allow gelification. Cells were harvested using
Moscona buffer and trypsin/EDTA, and seeded on top of the collagen
gels. Cultures were incubated at 37 °C for 24 or 48 h in the
presence of PAF, alone or combined with one of its receptor antagonists
WEB 2086 and SR27417A, or with one of the PI3'-K inhibitors wortmannin
and LY294002. The invasiveness of PCmsrc and ts-srcMDCK cells was
measured by the depth of cell migration inside the gel, using an
inverted microscope controlled by a computer program (24). Invasive and
superficial cells were counted in 12 fields of 0.157 mm2.
The invasion index was expressed as the percentage of cells invading
the gel over the total number of cells.
Immunoprecipitation and Western Blot of
p125FAK--
Subconfluent PCmsrc cells in 6-cm diameter
Petri dishes were starved for 24 h and then incubated for 24 h in the presence of 10 units/ml HGF, alone or combined with
10
7 M PAF, or without either HGF or PAF
(control). Control and treated PCmsrc cells were then rinsed twice with
PBS containing 0.1 mM sodium orthovanadate, and lysed at
100 °C in 0.5 ml of 1% SDS, and 10 mM Tris-HCl (pH
7.4). Cell lysates (1-2 mg of protein) were boiled for an additional 5 min, and centrifuged for 5 min at 14,000 × g. The
supernatants were then adjusted for protein content. Total lysate (100 µl) containing 600-800 µg of protein was diluted in 400 µl of
H2O and 500 µl of 2× immunoprecipitation buffer (1×
buffer: 1% Triton X-100, 10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.2 mM sodium orthovanadate, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.2 mM PMSF, 0.5% Nonidet P-40, 40 mM
-glycerophosphate, and 10 µg/ml each of the protease inhibitors
leupeptin and aprotinin). Next, these samples were subjected to
immunoprecipitation for a 1-h incubation in the presence of the
anti-p125FAK mAb clone 77 directed against the kinase
domain of FAK (Transduction Laboratories). This step was followed by
another hour of incubation with Protein G-Sepharose (Amersham Pharmacia
Biotech, Uppsala, Sweden). All incubations were carried out with mixing
at 4 °C. Immunoprecipitates were washed four times in 1×
immunoprecipitation buffer and denatured by boiling in SDS sample
buffer.
For the Western blots, total proteins or immunoprecipitates were
submitted to electrophoresis in 7.5% polyacrylamide gel and blotted on
nitrocellulose membranes (Hybond-C extra, Amersham Pharmacia Biotech).
Membranes were rinsed twice in TBS for 5 min, the nitrocellulose was
blocked overnight in TBS plus 5% bovine serum albumin (Fraction V,
Sigma), and probed for 1 h with anti-phosphotyrosine mAb 4G10
(UBI). The blots were then washed in TBS containing 0.1% Tween 20, probed for 1 h with horseradish peroxidase-conjugated monkey
anti-mouse IgG, and revealed by the ECL Western detection system (ECL,
Amersham Pharmacia Biotech). To determine the relative amounts of FAK
protein, the same nitrocellulose membranes were stripped and incubated
with the anti-FAK mAb.
Tyrosine Phosphorylation of
-Catenin--
ts-srcMDCK cells in
culture were washed three times with phosphate-free RPMI 1640 containing 2% dialyzed fetal calf serum (Life Technologies, Inc.) and
labeled for 2 h with 0.5 mCi/ml carrier-free
[32P]orthophosphate (Amersham Pharmacia Biotech, Gent,
Belgium). Cells were then detached with an E-cadherin-saving procedure, and incubated in suspension for 30 min at the nonpermissive temperature of 40 °C in the presence of HGF, either alone or combined with PAF,
and were further aggregated at 40 °C for 30 min. Control and treated
ts-srcMDCK cells were lysed in PBS containing 1% Nonidet P-40 and 1%
Triton X-100 and the following phosphatase or protease inhibitors (all
from Sigma): PMSF (1.7 mM), leupeptin (21 µM), aprotinin (10 µg/ml), sodium pyrophosphate (10 mM), sodium fluoride (10 mM), and sodium
vanadate (1 mM). Equal amounts of trichloroacetic acid-precipitable material were incubated for 3 h at 4 °C with the anti-phosphotyrosine mouse mAb PY20 (ICN Immunobiologicals, Costa
Mesa, CA), and then incubated for 1 h with Protein G-Sepharose 4 fast flow beads. The beads were washed three times with lysis buffer,
and tyrosine-phosphorylated proteins were eluted three times for 15 min
with the same buffer containing 1 mM
phospho-L-tyrosine and 10 mM phenylphosphate.
Eluted molecules were then immunoprecipitated for 2 h at 4 °C
with 20 µl of the
-catenin antiserum 1522, and for 1 h with
Protein G-Sepharose 4 fast flow beads. The immune serum 1522 was raised
against the synthetic peptide PGDSNQLAWFDTDL corresponding to the
C-terminal part of mouse
-catenin, and recognized a 95-kDa band on
Western blots (25).
PI3'-K Assay--
Immunoprecipitation and PI3'-K assay were
carried out as described previously (26-28). The ts-srcMDCK cells (5 million cells/dish) were cultured for 24 h in the absence of fetal
calf serum and then incubated for 18 h at 37 °C in the presence
of HGF (10 units/ml) alone or combined with 0.1 µM PAF.
Cells were then washed twice with ice-cold phosphate-buffered saline
(PBS) and lysed in 1 ml of Nonidet P-40 lysis buffer (10 mM
Tris, pH 7.4, containing 0.15 M NaCl, 1% Nonidet P-40,
10% glycerol, 1 mM sodium orthovanadate, 1 mM
PMSF, and 5 µg/ml each aprotinin, pepstatin, and leupeptin). Lysates
were centrifuged at 12,000 × g for 10 min at 4 °C.
Cell extracts containing 1 mg of protein were incubated for 2 h at 4 °C with 4 µg of the anti-phosphotyrosine mAb 4G10 and 40 µl of
Protein G-Sepharose, and the immune complexes were washed twice with
lysis buffer, twice with PBS supplemented with 1 mM sodium orthovanadate, twice with 0.5 M LiCl in 10 mM
Tris-HCl (pH 7.4), and twice with kinase buffer (25 mM
HEPES, pH 7.4, 100 mM NaCl, and 5 mM
MgCl2). The beads were resuspended in 50 µl of kinase buffer containing 10 µM ATP, 20 µCi of
[
-32P]-ATP, and 0.4 mg/ml of a sonicated mixture of
phosphatidylserine and phosphatidylinositol (1:1, w/w). The tubes were
incubated at 30 °C for 15 min, and the reaction was terminated by
addition of 100 µl of 1 M HCl. Phospholipids were
extracted with 350 µl of a 1:1 mixture of chloroform/methanol, and
the organic phase was washed three times with methanol, 1 M
HCl (1:1, v/v). The lipids were desiccated, and the pellets were
redissolved in 20 µl of chloroform/methanol, 1 M HCl
(200:100:1) and chromatographed on thin layer chromatography plates
(precoated with potassium oxalate and backed at 120 °C for 1 h
just before use) in chloroform, methanol, 4 M
NH4OH (9:7:2, v/v).
 |
RESULTS |
Detection of PAF-R Gene Transcripts in Human Colonic Cell Lines and
Tumors--
The human PAF-R is encoded by a unique gene composed of
two 5'-noncoding exons, each driven by distinct promoters (23). The
transcripts originating from exons 1 and 2 are alternatively spliced to
a common acceptor site on the third exon encoding the functional PAF-R
protein. Transcripts 1 and 2 have both been detected in heart, lung,
spleen, and kidney, whereas transcript 1 mainly accumulates in
peripheral leukocytes.
Using the pair of primers P4/P5 encompassing the 682-bp internal region
of the human PAF-R mRNA coding sequence (amino acids 63-289),
682-bp amplicons of the expected size were clearly identified in
freshly isolated normal colonic epithelial crypts and cultured human
colonic cancer cell lines (data not shown). PAF-R gene expression was
detected in human colon cancer resections (Dukes' stages B2 and C1)
and their distant nontransformed colonic mucosa. As positive control,
PAF-R expression was characterized in normal and leukemic human
leukocytes.
We next designated two sets of primers corresponding to either
leukocyte-type 1 transcripts (P2/P3 primers) or tissue-type 2 transcripts (P1/P3 primers), in order to examine the expression of both
transcripts in colonic epithelial cells. Leukocyte-type transcripts
(166 bp) were weakly expressed in both normal and transformed
intestinal epithelial cells (Fig. 2,
A and B). In contrast, the tissue-type transcript
was strongly expressed in intestinal cells, as a PCR product of the
expected size (252 bp), as compared with its expression in leukocytes
(Fig. 2C). This 252-bp product was revealed with an
additional 334-bp variant (aT). After cloning and sequencing, we
demonstrated that the tissue-type 252-bp sequence is identical to the
PAF-R transcript 2 as reported previously (22). On the other hand, we
observed that the additional tissue-type 334-bp product (aT) sequenced
in Caco-2 cells was lengthened by the following 82 nucleotides at the
3'-end of exon 1, as shown in Fig. 1:
ACAGCATAGAGGCTGAGGCTGGGGCCAGGACCCAGACAGAGACACACGGTCACTGCAGCTGAAGCCGCTGCCCCTGCTACAG (dashed line in exon 1 of Fig. 1).

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of the leukocyte- and tissue-type
PAF receptor transcripts in 5'-UTRs by RT-PCR and Southern blot
analysis in human intestinal epithelial cells and leukocytes. The
following cell types were tested: Freshly isolated human colonic crypts
(crypts), SV40LT-immortalized CFI-3 intestinal epithelial cells, the
human colonic epithelial cancer cell lines Caco-2 (enterocyte-like),
HT29 (mainly undifferentiated), and HT29-MTX (mucin-secreting),
peripheral human monocytes (mono) and their derived
macrophages (macro), lymphocytes (lympho), and
human promyelocytic leukemia cells HL-60. Films corresponding to the
leukocyte-type transcripts (166 bp) were exposed for 90 min
(A) or 6 h (B); those corresponding to the
tissue-type transcripts (252 and 334 bp in C) were exposed
for 1 h.
|
|
This fragment was produced by alternative splicing, because the
apparent consensus splice donor and acceptor sites GT/AG were identified at the boundaries of this additional aT sequence. The presence of this splice variant in the 5'-untranslated region of the
PAF-R transcript may be associated with differential regulation and
translational efficiency of PAF-R mRNA in normal and transformed intestinal cells. Because the splice variant of the tissue-type transcript may serve as a template for amplification of the 166-bp product, we used the P6 primer upstream of the splice site in exon 1 to
confirm the expression of the leukocyte-type transcript in intestinal
epithelial cells HT-29, Caco-2, and PCmsrc (data not shown).
Effects of HGF, PAF, and PI3'-K on Invasion and Tyrosine
Phosphorylation of p125FAK in Colonic and Kidney Epithelial
Cells Transformed by the src Oncogene--
Cell-cell and cell-matrix
adhesions play an important role in determining the structural
organization of polarized epithelial cells and the behavior of cancer
cells toward migration, invasiveness, and metastasis. One major target
of activated PAF-R is the cytoskeleton, which is involved in
controlling of cell shape, chemotaxis and migration (29, 30). Focal
adhesion kinase (p125FAK) is a major point of convergence
for the actions of a variety of effectors that affect cell morphology,
adhesion, and locomotion, including Src, PI3'-K, and the HGF receptor
Met (31). We therefore investigated the effects of PAF on the Src- and
HGF-dependent invasiveness of transformed intestinal and
kidney epithelial cells (11, 12), in relation with the status of PI3'-K
and p125FAK.
As shown in Fig. 3, 0.1 µM
PAF completely blocked the HGF-dependent invasiveness of
human colonic epithelial PCmsrc cells in collagen gels. Half-maximal
inhibition occurred at 10 nM PAF. The PAF-R antagonist 10 nM) reversed, by 100%, the inhibition caused by 0.1 µM PAF. At 1 nM, another PAF-R antagonist,
SR27417A, inhibited by 50% the response to PAF, and total inhibition
was observed at 10 nM SR27417A. When both antagonists were
tested at 10 nM, they failed to induce invasiveness,
suggesting that the behavior of the HGF-stimulated PCmsrc cells was not
affected by endogenous PAF. In PCmsrc cells, the action of PAF was
mimicked by 10 nM wortmannin (Fig. 3) and LY294002, another
structurally unrelated PI3'-K inhibitor. At 10 µM,
LY294002 completely blocked HGF-stimulated invasiveness.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3.
Inhibitory effect of PAF and PI3'-K
inhibitors on the HGF-induced invasiveness of human colonic cancer
cells PCmsrc: reversion by PAF-R antagonists. PCmsrc cells were
incubated for 24 h with one of the following substances or
combinations: HGF (10 units/ml); HGF plus 0.1 µM PAF,
alone or combined with its PAF-R antagonists WEB2086 (WEB,
10 nM) or SR27417A (SR, 10 nM); WEB
alone; or HGF plus the PI3'-K inhibitors wortmannin (WORT,
10 nM) or LY294002 (LY, 10 µM).
The percentage of invasive cells was determined as indicated under
"Experimental Procedures." Data are means ± S.E. of four to
eight separate experiments.
|
|
As an extension of these studies, we observed that HGF induced a marked
rise in the level of tyrosine phosphorylation of p125FAK in
PCmsrc cells (Fig. 4). The
anti-p125FAK antibody immunoprecipitated similar amounts ot
FAK protein in control and HGF/PAF-treated cells. PAF alone failed to
induce any detectable change in tyrosine phosphorylation, but
completely blocked the HGF-induced phosphorylation of
p125FAK.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 4.
Inhibitory effect of PAF on HGF-induced
tyrosine phosphorylation of p125FAK in the human colonic
cancer cell line PCmsrc. After treatment of cells for 24 h
with HGF (10 units/ml), PAF (0.1 µM), or HGF plus PAF,
whole cell lysates prepared from PCmsrc cells were immunoprecipitated
with the mAb clone 77 against p125FAK (Transduction
Laboratories), and analyzed using the anti-phosphotyrosine mAb 4G10
(UBI). After stripping the membranes, equal expression was observed by
reprobing with the same anti-p125FAK mAb, clone 77. Results
are representative of two other independent experiments.
|
|
Because tyrosine phosphorylation of
-catenin increased after HGF
stimulation or Src transformation, we investigated the action of PAF
and its receptors on cell adherens junctions in our system (32). We
found that PAF had no effect on tyrosine phosphorylation of the 95-kDa
band corresponding to
-catenins in either control or HGF-treated
ts-srcMDCK cells when they were incubated at the restrictive
temperature of 40 °C (data not shown).
When kidney epithelial ts-srcMDCK cells were incubated at the
restrictive temperature of 40 °C, we observed that 0.1 µM PAF completely reversed the HGF-dependent
invasiveness (Fig. 5A). The
presence of specific and functional PAF-R in this model was confirmed
by the observation that the PAF-R antagonists WEB2086 and SR27417A
abolished the inhibitory effect of PAF on invasion. At 10 nM, the PI3-K inhibitor wortmannin inhibited the
HGF-dependent invasiveness of ts-srcMDCK cells. Expression
of PAF-R in MDCK cells was further confirmed by Northern blot, after
identification of the corresponding transcript of 4 kilobase pairs
(data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Inhibitory effect of PAF and PI3'-K
inhibitors on HGF- and Src-induced invasiveness of ts-srcMDCK
epithelial cells: reversion by PAF-R antagonists. Panel A,
ts-srcMDCK cells were incubated for 24 h at the restrictive
temperature of 40 °C with HGF (10 units/ml) alone or combined with
the following effectors: PAF (0.1 µM); PAF and its PAF-R
antagonists WEB2086 (WEB, 10 nM) or SR27417A
(SR, 10 nM); the PI3'-K inhibitor wortmannin
(WORT, 10 nM); or PAF plus wortmannin. The
percentage of invasive cells was determined as indicated under
"Experimental Procedures." Data are means ± S.E. of four or
five separate experiments. Panel B, ts-srcMDCK cells were
incubated for 24 h at the permissive temperature of 35 °C with
either 0.1 µM PAF, the PI3'-K inhibitor wortmannin
(WORT, 10 nM), and the combinations PAF plus
wortmannin or the PI3'-K inhibitor LY294002 at the indicated
concentration. Data are means ± S.E. of four to five separate
experiments.
|
|
At the permissive temperature of 35 °C, PAF and wortmannin had
additive inhibitory effects on the Src-induced invasiveness of
ts-srcMDCK cells (Fig. 5B). Treatment with 10 µM LY294002 reduced this invasiveness by 63%.
Invasiveness of Parental and ts-srcMDCK Cells Transfected with
Activated or Dominant-negative Forms of PI3'-K p110
: Measurement of
PI3'-K Activity--
As shown in Fig.
6A, introduction of the
constitutively activated p110
subunit of PI3'-K to parental MDCK
cells (19) induced remarkably strong invasiveness. This activated form
of the enzyme potentiated the HGF-induced invasion. In contrast,
activation of PAF-R abolished the invasiveness induced by activated
p110* and reversed the additional invasion produced by HGF (Fig.
6A).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of constitutively activated or
dominant-negative forms of PI3'K-p110 on spontaneous, Src-induced,
and HGF-induced invasiveness of MDCK epithelial cells. Panel
A shows (i) the induction and potentiation of spontaneous and
HGF-induced invasiveness in parental and stably transfected MDCK cells
by the constitutively activated p110* form of PI3'-K (MDCKp110*), (ii)
the suppression of HGF- and Src-induced invasiveness by the dominant
negative Eco-S form of PI3'-Kp110 in ts-srcMDCK N cells (clone 27)
incubated at either 40 or 35 °C; (iii) at the permissive temperature
of 35 °C, reversal by PAF and wortmannin of the invasiveness of
ts-srcMDCK cells by 60-73%, but not reduction of residual activity of
ts-srcMDCK N cells. Data are means ± S.E. of four separate
experiments. Panel B shows the expression by Northern blot
of the truncated 1.5-kilobase pair transcript encoding the
dominant-negative form NPI3'-K of p110 in stably transfected
ts-srcMDCK N clones (C14 to C27). Control ts-srcMDCK cells and clone
C26 were negative.
|
|
In agreement with these findings, we observed that 1) PAF inhibited the
HGF-induced PI3'-K activation measured in anti-phosphotyrosine immunoprecipitates prepared from ts-srcMDCK cells (Fig.
7), and 2) introduction of the dominant
negative mutant p110-EcoS of PI3'-K totally blocked the
HGF-dependent invasiveness of ts-srcMDCK
N cells (clone
27) when they were incubated at the restrictive temperature of 40 °C
(Fig. 6, A and B).

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 7.
In vitro kinase activity of PI3'-K
immunoprecipitated from ts-srcMDCK epithelial cells incubated in the
presence of HGF and PAF. ts-srcMDCK cells were incubated for
18 h at 37 °C in the presence of HGF (10 units/ml), PAF (0.1 µM), HGF plus PAF, and in the absence of effector
(Untreated). Then, soluble lysates were obtained for
immunoprecipitation, as described under "Experimental Procedures."
After extensive washing of anti-phosphotyrosine immunoprecipitates,
PI3'-K activity was determined. The autoradiograph shows the
radiolabeled lipid product of PI3'-K separated by thin layer
chromatography with position of PI-3-P indicated. As negative control,
PI3'-K determination was performed in the presence of 1% Nonidet P-40
(Control).
|
|
Clone 27 was selected among G418-resistant ts-srcMDCK
N colonies by
Northern blot (Fig. 6B), on the basis of the expression of
the truncated 1.5-kilobase pair transcript of p110
PI3'-K, using the
5'-EcoRI fragment of the cDNA corresponding to the
N-terminal part of the kinase as a specific probe. No hybridization was
observed using the same membranes hybridized with the
3'-EcoRI fragment of p110
PI3'-K (data not shown). As
controls, we observed that (i) the other
NPI3'-K- positive clone 29 (Fig. 6B) was also resistant to HGF for invasiveness, and
(ii) when the
NPI3'-K-negative clone 26 was incubated at 40 °C
with HGF, it exhibited a percentage of invasiveness similar to that of
ts-srcMDCK (7.7% and 6.2%, respectively). At the permissive
temperature of 35 °C, the dominant negative mutant of PI3'-K p110
strongly inhibited Src-induced invasiveness, to a degree comparable to
the inhibition observed with PAF or wortmannin (see also Fig.
5B).
Effect of Pertussis Toxin (PTx) and Rapamycin on Src- and
HGF/PAF-dependent Invasiveness of Transformed Epithelial
Cells--
We next determined (Fig. 8)
whether cellular responses to PAF and HGF in PCmsrc and ts-srcMDCK
cells were inhibited by PTx, because the effects of PAF are mediated
via the activation of serpentine G-protein-linked transmembrane
receptors. We first observed that treatment of ts-srcMDCK cells for
24 h, at the permissive temperature of 35 °C with 200 ng/ml
PTx, had no effect on Src-induced invasion of collagen gels
(control invasion: 8.33 ± 0.43%; PTx treatment: 8 ± 0.17%, n = 3).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 8.
Effects of PTx on HGF- and
PAF-dependent invasiveness of PCmsrc and ts-srcMDCK
epithelial cells. The percentage of invasive cells was measured as
specified under "Experimental Procedures." Cells were treated for
24 h with the indicated effectors, in the presence or absence of
PTx (200 ng/ml). Data are means ± S.E. of six separate
experiments.
|
|
In contrast, PTx reversed by 50% the inhibitory effect of PAF in
ts-srcMDCK cells when they were incubated at the permissive temperature
of 35 °C. Under the same conditions, PTx, which is responsible for
the ADP-ribosylation and inactivation of G
i/o subunits,
caused a 62-70% decrease in HGF-induced invasiveness in PCmsrc and
ts-srcMDCK cells when they were incubated at the restrictive
temperature of 40 °C (n = 6 independent experiments, p < 0.001-0.005). The HGF-dependent
invasion of ts-srcMDCK cells is sensitive to 20 ng/ml PTx; half-maximal
inhibition occurred at 50 ng/ml PTx.
On the other hand, Src- and HGF/PAF-dependent invasiveness
of PCmsrc and ts-srcMDCK cells was not inhibited by treatment with 20 nM rapamycin for 24 h (data not shown).
 |
DISCUSSION |
The studies described here demonstrate that normal human colonic
epithelial crypts, colonic adenoma, and adenocarcinoma cell lines
express functional and specific PAF receptors. A noteworthy finding in
this work is the identification of a new alternative splice variant in
the 5'-UTR of the PAF-R mRNA, in the form of an elongated version
of the tissue-type transcript. This variant includes an additional
sequence of 82 nucleotides from the 3' end of the leukocyte-type exon 1 transcript (33). It has been postulated that long 5'-UTR transcripts
are involved in the formation of secondary structures that must be
eliminated for the efficient translation initiation (34). Elongated
forms of 5'-UTR have a potential role in the extensive interactions
with multiple factors that control the rates of initiation and
translation of human PAF-R mRNA in human colonic epithelial cells.
Similarly, the tissue-type transcript and this new variant harbor a
second ATG in exon 2. This second open reading frame, comprising 44 codons, is unusually long compared with other G-protein coupled
transmembrane receptors (35), as well as to the leukocyte-type PAF-R
transcript (36). The human
2 adrenergic receptor has
been shown to have a second upstream ATG and an elongated 19- codon
open reading frame in the 5'-UTR. When this upstream open reading frame
was deleted from the corresponding cRNA, production of the receptor
protein rose about 10-fold, when translated in the reticulocyte system (37), suggesting competitive interactions between the ATG signals. A
very similar feature characterizes both the cholinergic and estrogen
receptors. Precise function of the elongated form of the 5'-UTR in
intestinal PAF-R mRNA remains to be elucidated. Because of the
large intron separating exons 1 and 2, previous studies failed to
establish the organization of the PAF-R gene (23). The identification
of a new tissue-type splice variant in intestinal cells enabled us to
establish the physical map of the human PAF-R gene, as exon 2 was
upstream of exon 1 (Fig. 1). Our data suggest that PAF can directly
amplify the harmful action of inflammatory agents in human colonic
epithelial cells, because this potent lipid mediator, which is
generated during cell injury, triggered the expression of the inducible
prostaglandin synthase gene that leads to the synthesis of inflammatory
agents prostaglandins, prostacyclins, and thromboxanes. Another active
mediator of the inflammatory response, such as bacterial
lipopolysaccharide, induces PAF release, PAF-R expression, and tumor
necrosis factor-
(38), suggesting that multiple paracrine and
autocrine pathways are involved in cell injury in the intestinal
mucosa.
PAF-R activation is connected with changes in cell shape, cytoskeletal
reorganization, and expression of urokinase-type plasminogen activator
(48). This extracellular serine protease is strongly expressed in
transformed cell lines and is directly or indirectly involved in
degrading matrix components, including fibrin, fibronectin, laminin, or
basement membrane proteins like type IV collagen. Recent studies
indicate that the complexes formed by FAK with other cellular proteins
are important in the determination of its kinase activity and signaling
functions in focal contacts. In immediate signal-dependent
changes, FAK is directly connected to extracellular and intracellular
signals activated by growth factors, integrin receptors, matrix
components, and oncogenic pathways, thus providing docking sites for a
complex cluster of SH2-containing proteins and promoting functional
links between the cytoskeletal protein network, cell adhesion, and
migration (49). Because both PI3'-K and FAK are downstream components of activated Src and HGF/Met, these functional links led us to investigate the role of PAF and its receptors on these two signaling pathways. We found that PAF impaired the HGF-stimulated tyrosine phosphorylation of FAK that was shown to correlate with its increased kinase activity. Interestingly, we also found that the invasiveness of
transformed human colonic and canine kidney epithelial cells is
inhibited in a cooperative fashion by PAF-R and PI3'-K inhibitors, and
is mimicked by a dominant-negative mutant of PI3'-K p110
, thus
providing evidence that activation of PI3'-K is an absolute requirement
for Src- and HGF- dependent invasion of tumor cells. In agreement, PAF
completely abrogated the invasiveness induced by constitutive
activation of the PI3'-K p110
catalytic subunit and inhibited the
HGF-induced increase in PI3'-K activity in ts-srcMDCK cells. It was
therefore evident that PAF exerts a negative regulation on this
cellular activity and signaling pathway, including the downstream
mediators of PI3'-K, such as the pleckstrin homology domain-dependent effectors and Rho-like small G-proteins.
Alternatively, inhibition of invasion by activated PAF-R may occur
through the association of PI3'-K with the p85-kDa regulatory
subunit(s) or other non-tyrosine-phosphorylated proteins that influence
the stability and activity of the lipid kinase at the plasma membrane. Taken together, our data indicate that the inhibitory action of PAF on
invasiveness is coordinated with changes in the activities of both FAK
and PI3'-K in Src-transformed epithelial cells.
Because both wortmannin and LY294002 inhibit the PI3'-K/Akt
serine/threonine kinase cascade that activates the p70 ribosomal protein S6-kinase (p70s6k), we next examined the effect of
rapamycin on our system. This immunosuppressant indirectly blocks the
phosphorylation/activation of p70s6k, forming a complex
with FK-506-binding protein and TOR, a lipid kinase upstream of
p70s6k. This pathway controls the translation of the
proteins required for growth factor signaling, progression through the
cell cycle, and delivers signals for cell survival and the polarized
distribution of the actin cytoskeleton (50). We found that rapamycin
had no effect on Src- or HGF/PAF-dependent invasiveness in
PCmsrc or ts-srcMDCK cells, suggesting that the signaling elements
downstream of TOR-p70s6k are not involved in this
invasiveness. Moreover, our present observation that HGF-induced
tyrosine phosphorylation of
-catenin was not inhibited by PAF in
ts-srcMDCK cells rules out the possibility that the E-cadherin/catenin
complex has a functional role in PAF action. In agreement, we observed
that invasiveness of ts-srcMDCK cells induced by the monoclonal
antibody Degma-1 directed against murine E-cadherin is resistant to PAF
(data not shown). We therefore conclude that the
PAF-dependent invasiveness of transformed epithelial cells
involved E-cadherin- and p70s6k-independent pathways.
We presented evidence that PAF inhibits invasion via PTx-sensitive and
-resistant G-proteins. Although the identity of the individual
G-protein isotypes activated by human PAF-R is still a matter of
conjecture, the PTx-insensitive isoforms
Gs/G
11/G
q and the
PTx-sensitive isoforms
G
o/G
i1/G
i2/G
i3
are probably involved (28). PTx-insensitive heterotrimeric GTP-binding
proteins include (i) the ubiquitously expressed G
q,
G
11, G
12, and G
13 isotypes, which activate specific phospholipase C isoforms and cell
growth signaling, and (ii) the G
z isotype involved in
adenylate cyclase inhibition. Consistent with our finding, it has been
proposed that PAF receptors trigger either PTx-resistant or -sensitive activation of signaling pathways, depending on the G-protein isotype and the effector system concerned (44).
Another interesting finding derived from the experiments described
herein is that the HGF-dependent invasiveness of PCmsrc and
ts-srcMDCK cells is negatively regulated by PTx. Therefore, PTx exerts
opposite effects on the PAF- and HGF-dependent invasion of
Src-transformed epithelial cells. This is the first evidence that Met
receptors activate (or synergize with) a latent signaling pathway that
utilizes a member of the G-family of heterotrimeric proteins. The
association of single transmembrane protein-tyrosine kinase receptors
with G-proteins was recently documented in the case of the direct
interaction between the epidermal growth factor receptor juxtamembrane
region and the
-subunit of Gs (51). Our future
investigations will be designed to identify the PTx-sensitive G-proteins involved in the molecular and functional integration of the
positive and negative signals participating in the cross-talk between
PAF-R and the tyrosine kinases Src and Met in tumor invasion. In this
connection, recent evidence indicates that four classes of PI3'-K
catalytic subunit generate the signaling molecule
phosphatidyl-inositol-3,4,5-trisphosphate from upstream receptors: the
p110
,
, and
lipid kinases, and the recently discovered AGE
kinase involved in regulating longevity in Caenorhabditis
elegans. Most interestingly, the wortmannin-sensitive p110
isoform was strongly activated by both the
and 
subunits of
heterotrimeric G-proteins and induced mitogen-activated protein kinase
activation (52). One function of 
is to locate p110
to the
plasma membrane, via a tightly associated adaptator, p101 (53). This
p110
isoform of PI3'-K is strongly activated by the
PTx-dependent G
i1 subunit (52), suggesting
that the molecular cluster containing G
i1, p110
, and

-p101 is a candidate effector of the Met pathway in invasion.
Consistent with these interactions, it was recently reported that
heterodimeric PI3'-K consisting of p110
and p85 is synergistically
activated by the 
subunits of trimeric G proteins (54). Release
of G
also promotes tyrosine phosphorylation of Shc and its
subsequent association with Grb2-SOS. Complexity of the molecular
systems involving PI3'-K is further documented by the molecular and
functional diversity of the p85 regulatory subunits of the PI3'-K
enzyme family (55).
In conclusion, we showed that, in human colonic mucosa, PAF and its
membrane receptors may be directly involved, at the epithelial cell
level, in inflammatory processes and normal or neoplastic growth.
Because activation and amplification of the Src and Met oncogenes are
frequent events in human colon cancer and many human tumors (11),
future studies should center on the downstream elements connected with
PAF-R and Src/Met-R kinases. These elements include the PI3'-K cascade
and the identification of its downstream targets and ultimate
effectors, such as focal adhesions, cytoskeleton components, or
proteases. These investigations should prove informative, in view
of the possible beneficial effects of PAF derivatives against tumor
cell invasion and cancer progression toward metastasis.
 |
ACKNOWLEDGEMENTS |
We gratefully acknowledge Dr. P. Comoglio
(University of Turin, Turin, Italy) for providing the recombinant human
HGF peptide, Dr. J. Downward (Imperial Cancer Research Fund, London,
United Kingdom) for providing parental and MDCK p110* cells, Dr. S. Ohno (Yokohama City School of Medicine, Yokohama, Japan) for providing the expression vector encoding the Eco-S dominant-negative form of
PI3'-K, and Dr. P. Mayeux (Hôpital Cochin, Paris, France) and Dr.
L. Shaw (Beth Israel Deaconess Medical Center, Boston, MA) for advice
regarding the PI3'-K assay.
 |
Addendum |
Recently Keely et al. (56) and Shaw
et al. (27) made similar observations that PI3'-K is
involved in carcinoma invasion induced by Rac or
6
4 integrins.
 |
FOOTNOTES |
*
This work was supported by research grants and doctoral
fellowships (to L. K. and E. M.) from INSERM (Poste Orange),
l'Association de la Recherche Contre le Cancer, la Ligue Nationale
Contre le Cancer, the Federation of European Biochemical Societies, and the ASLK/VIVA-Verzekeringen and the FWO-Flanders (Brussels).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
The two first authors contributed equally.
Research associate of the FWO-Flanders (Brussels).
**
To whom correspondence should be addressed: INSERM U482, Signal
Transduction and Cellular Functions in Diabetes and Digestive Cancers,
Hôpital Saint-Antoine, 75571 Paris 12, France. Tel.: 33-1-43453477; Fax: 33-1-49284694; E-mail:
gespach{at}adr.st-antoine.inserm.fr.
1
The abbreviations used are: PAF,
platelet-activating factor; PAF-R, platelet-activating factor receptor;
HGF, hepatocyte growth factor; PI3'-K, phosphatidylinositol 3'-kinase;
FAK, focal adhesion kinase; PTx, pertussis toxin; RT, reverse
transcription; PCR, polymerase chain reaction; bp, base pair(s); TBS,
Tris-buffered saline; PBS, phosphate-buffered saline; UTR, untranslated
region; mAb, monoclonal antibody; MDCK, Madin-Darby canine kidney;
PMSF, phenylmethylsulfonyl fluoride.
 |
REFERENCES |
-
Rosam, A.,
Wallace, J.,
and Whittle, B.
(1996)
Nature
319,
54-56
-
Wardle, T. D,
Hall, L.,
and Turnberg, L. A.
(1996)
Gut
38,
355-361[Abstract/Free Full Text]
-
Langholz, E.,
Munkholm, P.,
Davidsen, M.,
and Binder, V.
(1992)
Gastroenterology
103,
1444-1451[Medline]
[Order article via Infotrieve]
-
Sobhani, I.,
Denizot, Y.,
Moizo, L.,
Laigneau, J. P.,
Bado, A.,
Laboisse, C.,
Benveniste, J.,
and Lewin, M.
(1996)
Eur. J. Clin. Invest.
26,
53-58[CrossRef][Medline]
[Order article via Infotrieve]
-
Riehl, T. E.,
and Stenson, W. F.
(1995)
Gastroenterology
109,
1826-1834[CrossRef][Medline]
[Order article via Infotrieve]
-
Sobhani, I.,
Hochlaf, S.,
Denizot, Y.,
Vissuzaine, C.,
Rene, E.,
Benveniste, J.,
Lewin, M. M. J.,
and Mignon, M.
(1992)
Gut
33,
1220-1225[Abstract/Free Full Text]
-
Ferraris, L.,
Karmeli, F.,
Eliakim, R.,
Klein, J.,
Fiocchi, C.,
and Rachmilewitz, D.
(1993)
Gut
34,
665-668[Abstract/Free Full Text]
-
Choi, P.,
and Zelig, M.
(1994)
Gut
35,
950-954[Abstract/Free Full Text]
-
Brentnall, T.,
Haggitt, R.,
Rabinovitch, P.,
Kimmey, M.,
Bronner, M.,
Levine, D.,
Kowdley, K.,
Stevens, A.,
Crispin, D.,
Emond, M.,
and Rubin, C.
(1996)
Gastroenterology
110,
331-338[CrossRef][Medline]
[Order article via Infotrieve]
-
Giovannucci, E.,
Egan, K.,
Hunter, D.,
Stamper, M.,
Colditz, G.,
Willett, W.,
and Speizer, F.
(1995)
N. Engl. J. Med.
333,
609-614[Abstract/Free Full Text]
-
Empereur, S.,
Djelloul, S.,
Di Gioia, Y.,
Bruyneel, E.,
Mareel, M.,
Van Hengel, J.,
Van Roy, F.,
Comoglio, P.,
Courtneidge, S.,
Paraskeva, C.,
Chastre, E.,
and Gespach, C.
(1997)
Br. J. Cancer
75,
241-250[Medline]
[Order article via Infotrieve]
-
Behrens, J.,
Vakaet, L,
Friis, R.,
Winterhager, E.,
Van Roy, F.,
Mareel, M.,
and Birchmeier, W.
(1993)
J. Cell Biol.
120,
757-766[Abstract/Free Full Text]
-
Mareel, M.,
Noë, V.,
and Bracke, M.
(1996)
Anti-Cancer Drugs
7,
149-156
-
Noë, V.,
Bruyneel, E.,
Kotelevets, L.,
Myssiakine, E.,
Chastre, E.,
Mareel, M.,
and Gespach, C.
(1996)
Clin. Exp. Metastasis
14,
71
-
Chastre, E.,
Di Gioia, Y.,
Barbry, P.,
Simon-Bouy, B.,
Mornet, E.,
Fanen, P.,
Champigny, G.,
Emami, S.,
and Gespach, C.
(1991)
J. Biol. Chem.
266,
21239-21246[Abstract/Free Full Text]
-
Paraskeva, C.,
Buckle, B.,
Sheer, D.,
and Wigley, C.
(1984)
Int. J. Cancer
34,
49-56[Medline]
[Order article via Infotrieve]
-
Nagano, M.,
Chastre, E.,
Choquet, A.,
Bara, J.,
Gespach, C.,
and Kelly, P.
(1995)
Am. J. Physiol.
268,
G431-G442[Abstract/Free Full Text]
-
Nishioka, N.,
Akimoto, K.,
Moriya, S.,
Takayanagi, J.,
Fukui, Y.,
Hirai, S.,
Mizuno, K.,
Kosaka, K.,
and Ohno, S.
(1995)
Biochem. Biophys. Res. Commun.
215,
1037-1042[CrossRef][Medline]
[Order article via Infotrieve]
-
Khwaja, A.,
Rodriguez-Viciana, P.,
Wennström, S.,
Warne, P.,
and Downward, J.
(1997)
EMBO J.
16,
2783-2793[CrossRef][Medline]
[Order article via Infotrieve]
-
Mirossay, L.,
Chastre, E.,
Callebert, J.,
Launay, J. M.,
Housset, B.,
Zimber, A.,
Abita, J. P.,
and Gespach, C.
(1994)
Am. J. Physiol.
267,
R602-R611[Abstract/Free Full Text]
-
Nakamura, M.,
Honda, Z.,
Izumi, T.,
Sakanaka, C.,
Mutoh, H.,
Minami, M.,
Bito, H.,
Seyama, Y.,
Matsumoto, T.,
Noma, M.,
and Shimizu, T.
(1991)
J. Biol. Chem.
266,
20400-20405[Abstract/Free Full Text]
-
Sugimoto, T.,
Tsuchimochi, H.,
McGregor, C.,
Mutoh, H.,
Shimizu, T.,
and Kurachi, Y.
(1992)
Biochem. Biophys. Res. Commun.
189,
617-624[CrossRef][Medline]
[Order article via Infotrieve]
-
Mutoh, H.,
Bito, H.,
Minami, M.,
Nakamura, M.,
Honda, Z.,
Izumi, T.,
Nakata, R.,
Kurachi, Y.,
Terano, A.,
and Shimizu, T.
(1993)
FEBS Lett.
332,
129-134
-
Vleminckx, K.,
Vakaet, L.,
Mareel, M.,
Fiers, W.,
and Van Roy, F.
(1991)
Cell
66,
107-119[CrossRef][Medline]
[Order article via Infotrieve]
-
Vermulen, S.,
Bruyneel, E.,
Van Roy, F.,
Mareel, M.,
and Bracke, M.
(1995)
Br. J. Cancer
72,
1447-1453[Medline]
[Order article via Infotrieve]
-
Mayeux, P.,
Dusanter-Fourt, I.,
Muller, O.,
Mauduit, P.,
Sabbah, M.,
Druker, B.,
Vainchenker, W.,
Fischer, S.,
Lacombe, C.,
and Gisselbrecht, S.
(1993)
Eur. J. Biochem.
216,
821-828[Medline]
[Order article via Infotrieve]
-
Shaw, L.,
Rabinovitz, I.,
Wang, H.,
Toker, A.,
and Mercurio, A.
(1997)
Cell
91,
949-960[CrossRef][Medline]
[Order article via Infotrieve]
-
Moscatello, D.,
Holgado-Madruga, M.,
Emlet, D.,
Montgomery, B.,
and Wong, A.
(1998)
J. Biol. Chem.
273,
200-206[Abstract/Free Full Text]
-
Stossel, T.
(1994)
Blood
84,
367-369[Free Full Text]
-
Ali, H.,
Richardson, R.,
Tomhave, E.,
DuBose, R.,
Haribabu, B.,
and Snyderman, R.
(1994)
J. Biol. Chem.
269,
24557-24563[Abstract/Free Full Text]
-
Craig, S.,
and Johnson, R.
(1996)
Curr. Opin. Cell Biol.
8,
74-85[CrossRef][Medline]
[Order article via Infotrieve]
-
Shibamoto, S.,
Hayakawa, M.,
Takeuchi, K.,
Hori, T.,
Oku, N.,
Miyazawa, K.,
Kitamura, N.,
Takeuchi, M.,
and Ito, F.
(1994)
Cell Adhesion Commun.
1,
295-303[Medline]
[Order article via Infotrieve]
-
Izumi, T.,
Kishimoto, S.,
Takano, T.,
Nakamura, M.,
Miyabe, Y.,
Nakata, M.,
Sakanaka, C.,
and Shimizu, T.
(1995)
Biochem. J.
305,
829-835
-
Sonenberg, N. J., Hershey, W. B., Mathews, M. B., and Sonenberg, N.
(eds)
(1996)
Translational Control, pp. 245-269, Cold Spring Harbor Press, Cold Spring Harbor, NY
-
Dixon, R.,
Kobilka, B.,
Strader, D.,
Benovic, J.,
Dohlman, H.,
Frielle, T.,
Bolanowski, M.,
Bennett, C.,
Rands, E.,
Diehl, R.,
Mumford, R.,
Slater, E.,
Sigal, I.,
Caron, M.,
Lefkowitz, R.,
and Strader, C.
(1986)
Nature
321,
75-79[Medline]
[Order article via Infotrieve]
-
Ye, R.,
Prossnitz, E.,
Zou, A.,
and Cochrane, C.
(1991)
Biochem. Biophys. Res. Commun.
180,
105-111[CrossRef][Medline]
[Order article via Infotrieve]
-
Kobilka, B.,
McGregor, C.,
Daniel, K.,
Kobilka, T.,
Caron, M.,
and Lefkowitz, R.
(1987)
J. Biol. Chem.
262,
15796-15802[Abstract/Free Full Text]
-
Ishii, S.,
Matsuda, Y.,
Nakamura, M.,
Waga, I.,
Kume, K.,
Izumi, T.,
and Shimizu, T.
(1996)
Biochem. J.
314,
671-678
-
Han, J.,
Lee, J. D.,
Bibbs, R.,
and Ulevitch, R.
(1994)
Science
265,
808-811[Abstract/Free Full Text]
-
Jiang, Y.,
Chen, C.,
Li, Z.,
Guo, W.,
Gegner, J.,
Lin, S.,
and Han, J.
(1996)
J. Biol. Chem.
271,
17920-17926[Abstract/Free Full Text]
-
Chastre, E.,
Empereur, S.,
Di Gioia, Y.,
El Mahdani, N.,
Mareel, M.,
Vleminckx, K.,
Van Roy, F.,
Bex, V.,
Emami, S.,
Spandidos, D.,
and Gespach, C.
(1993)
Gastroenterology
105,
1776-1789[Medline]
[Order article via Infotrieve]
-
Baron-Delage, S.,
Capeau, J.,
Barbu, V.,
Chastre, E.,
Levy, P.,
Gespach, C.,
and Cherqui, G.
(1994)
J. Biol. Chem.
269,
18686-18693[Abstract/Free Full Text]
-
Schulam, P.,
Kuruvilla, A.,
Putcha, G.,
Mangus, L.,
Franklin-Johnson, J.,
and Shearer, W.
(1991)
J. Immunol.
146,
1642-1648[Abstract]
-
Ferby, I.,
Waga, I.,
Sakanaka, C.,
Kume, K.,
and Shimizu, T.
(1994)
J. Biol. Chem.
269,
30485-30488[Abstract/Free Full Text]
-
Honda, Z.,
Takano, T.,
Gotoh, Y.,
Nishida, E.,
Ito, K.,
and Shimizu, T.
(1994)
J. Biol. Chem.
269,
2307-2315[Abstract/Free Full Text]
-
Kravchenko, V.,
Pan, Z.,
Han, J.,
Herbert, J.,
Ulevitch, R.,
and Ye, R.
(1995)
J. Biol. Chem.
270,
14928-14934[Abstract/Free Full Text]
-
Neurath, M.,
Pettersson, S.,
Meyer zum Büschenfeld, K. H.,
and Strober, W.
(1996)
Nat. Med.
2,
998-1004[CrossRef][Medline]
[Order article via Infotrieve]
-
Irigoyen, J.,
Besser, D.,
and Nagamine, Y.
(1997)
J. Biol. Chem.
272,
1904-1909[Abstract/Free Full Text]
-
Polte, T.,
and Hanks, S.
(1997)
J. Biol. Chem.
272,
5501-5509[Abstract/Free Full Text]
-
Schmidt, A.,
Kunz, J.,
and Hall, M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
13780-13785