![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 23, 14347-14354, June 5, 1998
From the Department of Molecular Genetics, Biochemistry, and
Microbiology, University of Cincinnati,
Cincinnati, Ohio 45267-0524
Erythroid Krüppel-like factor (EKLF) is a
zinc finger transcription factor required for Over the past few years, several relatively specific erythroid
transcription factors have been isolated and their functional activity
defined. These transcription factors regulate the expression of globin
genes as well as many other erythroid-specific genes (for reviews see
Refs. 1 and 2). One of these erythroid-specific factors has been termed
erythroid Krüppel-like factor
(EKLF)1 (3). EKLF is a zinc
finger DNA-binding protein that recognizes the CACCC motif in the human
Other critical genes involved in hematopoiesis include
GATA-1, Tal1, and Lmo2/rbtn2. While targeted
disruption of the mouse EKLF gene results in a failure in adult
erythropoiesis, inactivation of any one of these three genes,
GATA-1, Tal1, and Lmo2, produces a similar
phenotype characterized by a block in hematopoiesis at an earlier yolk
sac stage (10-12). GATA-1 is a zinc finger transcription factor, and
its expression is generally confined to erythroid cells. GATA-1-binding
sites are present in all erythroid-specific genes examined to date
(13). Tal1 is a basic helix-loop-helix (bHLH) transcription factor
whose name is derived from its isolation at a common translocation site
occurring in T-cell acute lymphoblastic leukemia (14). The protein is
primarily produced in the same hematopoietic cells that also produce
GATA-1. As a class B type of bHLH factor, Tal1 does not readily
homodimerize but rather interacts with other HLH proteins, principally
the E2A proteins, E12 and E47 (15). These heterodimers are then able to
bind DNA. The general consensus site for bHLH complexes is CANNTG and
is referred to as an E box. The final erythroid-specific protein of
this set, Lmo2, contains a LIM domain believed to be involved in
protein-protein interactions (16, 17). Whereas this particular class of
proteins also has a zinc finger motif, no evidence for direct DNA
binding has been obtained.
The similar failure in erythropoiesis observed with the null mutations
in each of these four genes, EKLF, GATA-1, Tal1, and Lmo2, suggest some common role or regulatory interplay in
hematopoietic development. Several associations and interactions
between these proteins have indeed been demonstrated. GATA-1, for
example, has been shown to physically associate with both EKLF and the
ubiquitous SP1 protein (18). GATA-1 is also involved in the regulation of EKLF expression through binding to a critical proximal promoter element (19). Recent developments concerning the assembly of an
erythroid-specific complex of transcription factors are particularly interesting. Lmo2 and Tal1 can be found as a complex in erythroid cells
(20). Subsequently it was noted that Lmo2 will also assemble with
GATA-1, whereas efforts to demonstrate a stable association between
GATA-1 and Tal1 were unsuccessful (21). Evidence for a model in which
Lmo2 interacts with both GATA-1 and Tal1 serving as a protein link
between these two DNA-binding proteins has now been provided (22). One
caveat with these experiments, however, is the absence of a target gene
for which these proteins, excluding GATA-1, alone or as part of this
large complex, have been shown to bind and effect transcriptional
activity.
In our studies of the regulatory elements and associated binding
factors important for temporal and tissue-specific expression of the
EKLF gene, we have identified an activator element in the distal
promoter region. The element consists of two GATA sites flanking an E
box motif. We have shown through mutational analyses that all three
sites are required for the functional activity. Such a combined site
and the data suggesting the binding of multiple proteins raise
interesting issues concerning the mechanisms involved in
erythroid-specific gene regulation.
Construction of Reporter Plasmids--
The basic constructs
Multiple Proteins Binding to a GATA-E Box-GATA Motif Regulate the
Erythroid Krüppel-like Factor (EKLF) Gene*
,
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-globin gene
expression and is implicated as one of the key factors necessary for
the fetal to adult switch in globin gene expression. In an effort to
identify factors involved in the expression of this important
erythroid-specific regulatory protein, we have isolated the mouse EKLF
gene and systematically analyzed the promoter region. Initially, a
reporter construct with 1150 base pairs of the EKLF 5'-region was
introduced into transgenic mice and shown to direct erythroid-specific
expression. We continued the expression studies in erythroid cells and
have identified a sequence element consisting of two GATA sites
flanking an E box motif. The three sites act in concert to elevate the transcriptional activity of the EKLF promoter. Each site is essential for EKLF expression indicating that the three binding sites do not work
additively, but rather function as a unit. We further show that GATA-1
binds to the two GATA sites and present evidence for binding of another
factor from erythroid cell nuclear extracts to the E box motif. These
results are consistent with the formation of a quaternary complex
composed of an E box dimer and two GATA-1 proteins binding at a
combined GATA-E box-GATA activator element in the distal EKLF
promoter.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-globin promoter. It has been shown that EKLF expression is
restricted to the erythroid cell lineage, with initial expression in
the yolk sac (4), and predominant expression occurring later in
erythroid development. As a transcription factor, EKLF appears to be
specifically involved in adult
-globin gene expression (4-6). Mice
deficient in this gene exhibit lethal
-thalassemia (7, 8). This
disease is very similar to the human
-thalassemia caused by point
mutations in the CACCC sequence lending further support to the
importance of the EKLF-CACCC interaction in vitro (9).
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
1150EKLFCAT and
124EKLFCAT were prepared using PCR. Primers
5'-EKLFKpn, GCTTTCTCGAGGCCTGACTAGGTACC, and EKLFH3,
GGAATTCAAGCTTGGCTGGCTGGTGTCCACC, were used to amplify the
1150-bp
region. The EKLFH3 primer and EKLF124Kpn, CCTGGTACCGCACACCATACACATATCG, were utilized to amplify the
124-bp promoter region. For transgenic animal studies, the
1150-bp KpnI-HindIII
fragment was ligated 5' of the lacZ gene containing the SV40
poly(A) addition site. The KpnI-HindIII fragments
of
1150EKLF and
124EKLF were ligated 5' of a CAT reporter in
pGEM7Zf (Promega, Madison, WI) to yield
1150EKLFCAT and
124EKLFCAT,
respectively. The
1150EKLFCAT construct was then digested with
PstI followed by religation creating 
928/
575EKLFCAT. A KpnI-SacI fragment was eliminated to yield
952EKLFCAT.
1150EKLFCAT was cut in the upstream polylinker at the
SphI site and at KpnI, and a 436-bp fragment was
cloned in to yield
1596EKLFCAT. This construct was subsequently cut
with AvrII and SphI to produce
1385EKLFCAT.
1150 construct, a double-stranded
oligomer, SpMyb, spanning
647 to
567 and containing a 5'
ApaI overhang adjacent to an XbaI site and 3'
NcoI overhang, was ligated to the ApaI and
NcoI sites of
1150EKLFCAT resulting in a
1150EKLFCAT without the GATA-E box-GATA site. This construct was restricted with ApaI and XbaI and oligomers GEG,
GMEG, GEGM, GEMG, and
GMEMGM (see Fig. 5) were inserted
to make the
1150EKLFCAT mutants. To produce the
60GATA mutation
primers H114D, CCTATGCATCTTTTGCTAAACAGCTCAG, and the
60GATAB mutation
oligomer, GTCTTCCTCTAGAAGCACCCAGGC, were used to amplify
810 to
60 mutating the
60 GATA site.
60GATAT, GCCTGGGTGCTTCTAGAGGAAGAC, and EKLFH3 primers amplified the
60 to +62 region with the complementary GATA mutation. These two
60 GATA mutations were cut and ligated at the newly created XbaI site, then cut 5' with Tth111I and 3' with
HindIII and ligated into the Tth111I-HindIII
sites of
1150EKLFCAT resulting in the
1150(
60GATAM)EKLFCAT.
124 EKLFCAT construct included isolated fragments,
PCR products, and double-stranded oligomers.
PstI-HinfI (
928 to
814) and
HinfI-PstI (
814 to
575) fragments were blunt end-ligated 5' of
124EKLFCAT at the KpnI site yielding
(114)-124EKLFCAT and (239)-124EKLFCAT, respectively. A fragment
from
810 to
692 was amplified using primers 5'-239K,
CTGGTACCTTTTGCTAAACAGCTCAG, and 5'-239KA, CTGGTACCGGGCCCAGAACAACCATGG
and was ligated to the 5' KpnI site of
124EKLFCAT to make
(5'-239)
124EKLFCAT. Similarly, the
696 to 574 region was amplified
with primers 3'-239KA, CTGGTACCGGGCCCCTACCTGATAG, and 3'-239KB,
CTGGTACCAGATCTGCAGTTCTTACTCTCCC and also ligated to the 5'
KpnI site of
124EKLFCAT to give (3'-239)-124EKLFCAT. This
construct has a 5' ApaI site and a 3' BglII site
designed into the primers. These sites were cut, and the
double-stranded oligomers GEG, GMEG, GEGM,
GEMG, and GMEMGM, and
Sp (see Fig. 7) were ligated. All constructs were produced in or
transferred to a modified pBKCMV vector (Stratagene, Inc., La Jolla,
CA) which had been cut with NsiI and NheI blunted
and self-ligated to eliminate the cytomegalovirus promoter. The
constructs were linearized at the MluI site for use in
stable transfections.
Nucleotide Sequence Analysis-- Genomic clones were sequenced with a model 377 DNA Sequenator and Taq Dye Deoxy sequencing protocol (Applied Biosystems, Inc., Foster City, CA). The nucleotide sequence of all subclones was also confirmed in a similar manner. Primers for this sequence analysis and other applications in this study were produced with a model 394 synthesizer (Applied Biosystems, Inc., Foster City, CA).
Library Screen-- A strain 129 mouse genomic library was obtained (23) that had been constructed using Lambda DASH vector (Stratagene, Inc., La Jolla, CA). The library was then screened with a reverse transcriptase-PCR product from nucleotides 852 to 1234 of the EKLF cDNA using MEL BB88 cell RNA as a template. Filters were washed with 0.5× SSC and 0.1% SDS at 65 °C. Sixty-seven positive clones were selected of which 29 contained EKLF sequence.
Transgenic Mice--
Transgenic mice were generated in strain
FVB/N by injection of purified (Qiagen, Inc., Santa Clarita, CA)
1150EKLF
-gal fragment into the male pronucleus (24). The putative
transgenic animals were screened by PCR. Southern blot analysis was
also performed with genomic DNA from F1 animals of each line to
determine the transgene copy number and to ensure the transgene was
intact and free of rearrangements.
-Galactosidase Assays--
Tissue extracts from adult
transgenic animals were prepared by homogenizing with a Brinkman
Polytron model PT3000 (Brinkman Instruments, Westbury, NY) followed by
three cycles of freezing on dry ice and thawing in a 37 °C water
bath.
-Galactosidase assays were then carried out as described
previously (25). For the in situ analysis, embryos were
isolated at day 10.5 post-coitus, and whole-mount staining was
performed as described (26).
Transfections and CAT Assays-- Mouse erythroleukemia (MEL) BB88 cells were transfected using a Bio-Rad GenePulser (Bio-Rad) set at 350 V and 960 microfarads. Approximately 5 × 107 cells per 800 µl of serum-free RPMI media were used per transfection with a total of 45 µg of total DNA. In transient assays, this 45 µg was composed of 30 µg of the CAT reporter plasmid and 15 µg of an SV40-luciferase control plasmid (Promega Corp., Madison, WI). Stable transfections were split into three pools and selected with G418 (Life Technologies, Inc.) at 1200 µg/ml for 4 days then maintained on 400 µg/ml. CAT assays from stables were performed with 25 µg of protein for 1 h at 37 °C as described previously (27). Transient CAT assays utilized the entire transfection for 3 h at 37 °C and were normalized with luciferase activity. Protein concentrations were determined using a bicinchoninic acid assay (Pierce).
Electrophoretic Mobility Shift Assays-- Nuclear extracts were prepared as described (28). All EMSAs were carried out in a total volume of 30 µl containing 4 µg of poly(dI-dC), 2 × 105 cpm end-labeled probe, and 10 µg of nuclear extract. The GATA-1 binding was carried out under ionic conditions described by Lam and Bresnick (29), and the E box binding was performed under ionic conditions described by Prasad et al. (30). Reactions were carried out at room temperature by incubating 15 min without probe and 15 min after the addition of the probe. The supershifts were carried out under the conditions described above for GATA-1 binding with 0.1 µg of GATA-1 rat monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) added at the time of the probe addition. The DNA-protein complexes were separated on 5% polyacrylamide gels at 120 V for 3-4 h.
Nucleotide Sequence Accession Number-- The EKLF genomic sequence diagrammed in Fig. 1 has been deposited in GenBankTM.
| |
RESULTS |
|---|
|
|
|---|
The EKLF Promoter Directs Erythroid-specific Expression in Transgenic Mice-- The mouse EKLF gene was isolated from a genomic phage library using a fragment from the zinc finger region as a hybridization probe. Approximately 5.6 kb of genomic DNA was subjected to nucleotide sequence analysis; this includes 1.6 kb of 5'-flanking sequence, the 3.3-kb transcription unit, and approximately 0.7 kb of 3'-flanking region. A schematic diagram of the EKLF genomic organization is shown in Fig. 1, panel A. The gene consists of 3 exons, and a summary of the important structural features of the EKLF gene, along with the intron/exon boundary sequences, is included in panel B of Fig. 1.
|
-galactosidase gene. Lines of transgenic mice were established
expressing this construct. Tissues, including blood, brain, lung,
kidney, spleen, and testis, were collected from adult animals and
assayed for
-galactosidase activity. Expression of the reporter gene
was only detected in the blood samples from these mice. Bone marrow is
a more active hematopoietic organ in mice (31) compared with the
spleen, accounting for the lack of expression in young adult spleen.
The 1150-bp region of the mouse EKLF promoter is thus sufficient to
confer erythroid tissue-specific expression to a heterologous gene.
Moreover, we mated these F1 transgenic mice to produce timed
pregnancies and collected embryos at 11.5 days of gestation. The
embryos were fixed and stained for
-galactosidase activity.
Representative non-transgenic and transgenic embryos and yolk sac
sections are shown in Fig. 2.
-Galactosidase activity is prominent throughout the embryonic circulation and in the fetal liver. Although we did observe background staining of yolk sac tissue in the non-transgenic animals, the circulating blood is clearly red in these yolk sacs and
blue in the yolk sacs from transgenic embryos. Thus the
1150-bp EKLF promoter directs both tissue and developmentally specific
expression of the reporter gene.
|
Identification of an Enhancer Element in the Distal EKLF
Promoter--
To investigate further the regulatory elements in the
EKLF promoter important for erythroid-specific expression, varying
lengths of the 5'-flanking sequence have been attached to a CAT
reporter gene. These constructs were introduced into MEL BB88 cells. As shown in Fig. 3, an approximately 5-fold
increase in CAT activity is observed with the
1150 construct compared
with our minimal promoter. We chose
124 as our basal element since
Crossley et al. (19) had previously shown the presence of a
critical GATA site in this proximal promoter region and indicated that
this was the principal cis element within 353 bp of the transcription start site. The fold enhancement we are reporting therefore corresponds to elevated expression compared with this 124-bp promoter with an
active GATA-binding site. Comparison of the
1150 construct containing
this newly described distal enhancer activity with a
77 EKLF promoter
reported previously (19) in which the GATA site has been mutated
results in an approximately 80-fold enhancement over this background
value. We will return to a direct comparison with this proximal GATA
site in a later experiment.
|
1150 construct
severely compromises expression from the EKLF promoter. The region
missing in the 
928/
575 construct corresponds to a 353-bp PstI fragment. The nucleotide sequence for this region is
shown in Fig. 4, panel A. We
performed a computer search of this region against a data base of
transcription factor consensus binding sites and discovered three Sp1
sites, two GATA sites, an E box motif, a c-myb site, and an
EKLF consensus site. In order to test the functional significance of
these putative transcription factor binding sites, we prepared a series
of CAT constructs with subfragments from this region attached to our
basal
124 EKLF promoter. The designation of these clones is outlined
in Fig. 4, panel B. This assay was developed as a complement
to the loss-of-function analysis carried out with the
1150 internal
PstI deletion. An up-regulation of activity from the EKLF
124 promoter upon inclusion of these sequences would indicate that
the activator function can be added back to this basal promoter. As
shown in Fig. 4, panel C, the presence of the 239-bp
fragment results in a 9-fold increase in CAT activity, whereas the
114-bp fragment has no effect. This indicates that the 239-bp fragment
accounts for all the activity in the element defined by deletion
analysis and that this element can be moved relative to the
transcription start site and still maintain its functional activity.
The 239-bp fragment was subsequently further divided at the
ApaI site and analyzed in a similar manner. The majority of
the enhancer activity resides in the 3'-half of this fragment (Fig. 4,
panel C).
|
All Three Sites in the GATA-E Box-GATA Motif Define the EKLF
Enhancer Element--
We noted with interest the clustering of the
GATA and E box motifs and considered that alone or in combination these
elements may be responsible for the erythroid-specific activation of
the EKLF-CAT constructs. Double-stranded oligonucleotides flanked by
restriction enzyme sites to allow easy insertion 5' of the
124 EKLF
minimal promoter were therefore synthesized. Initially, two sequences,
designated GEG and Sp and shown in Fig.
5, panel A, were tested. GEG
is a 49-bp oligomer and includes the GATA-E box-GATA configuration of
sites. The Sp oligomer corresponds to the next 37 nucleotides of
sequence and includes the Sp1 consensus site. As illustrated in Fig.
5, panel B, the GEG oligomer completely replicated the
5-8-fold enhancement observed with the 3'-239 control construct,
whereas the Sp oligomer had no effect. Oligomers with point mutations
in each of the GATA sites alone or in combination were subsequently
synthesized. Additionally, double-stranded oligomers were prepared in
which the core E box sequence was replaced with a restriction enzyme
site. Finally, an oligomer was constructed with all three sites
disrupted. Mutation of either GATA site or the E box abrogated the
enhancer activity of this element. Moreover, we did not observe an
additive effect whereby mutation of the GATA sites might have
eliminated half the activity of this distal element, and alteration of
all three sites would drop the activity to base line. Rather,
disruption of either of the GATA sites or the E box was sufficient to
abolish the activator effect. Multiple binding sites, including the E
box motif and at least one of the GATA sites, are therefore necessary
for the activity of this erythroid-specific enhancer element which
appears to function as a unit.
|
1150 EKLF CAT construct to test the effect of these small alterations
in the wild-type context. In this series of experiments, the effect of
mutating each site individually and in combination was examined. The
analysis of CAT activity from stably transfected MEL cells is
summarized in Fig. 6. A mutation in any
single site, either the 5'- or 3'-GATA sites (GMEG or
GEGM) or the E box motif (GEMG), is sufficient
to reduce the EKLF promoter activity to the level observed with the
928 to
575 deletion that originally defined this proximal enhancer.
Combinations including alterations in both GATA sites
(GMEGM) or all three factor binding sites
(GMEMGM) gave levels comparable to
a single site mutation. All three sites thus appear to be required for
the function of this distal activator.
|
1150 EKLF-CAT reporter. A point mutation was therefore made in this
GATA site, and the activity of this
1150(
60GM)
construct was compared with the single GATA site mutations,
1150(GMEG) and
1150(GEGM). After stable
transfection in MEL cells, the normalized CAT activity from cellular
extracts is shown in Table I. Clearly, all three GATA sites are critical for expression of the EKLF promoter when considered in the context of this extended 5'-promoter sequence. That is, even in the presence of an intact GATA-E box-GATA distal activator, only minimal transcriptional activity is observed if the
proximal GATA site is altered. Similarly, in the framework of the
1150-bp fragment, this proximal site by itself is insufficient to
direct expression of the EKLF gene.
|
Multiple DNA-Protein Complexes Form on the Intact GATA-E Box-GATA Motif-- The previous experiments establish the functional importance of the GATA-E box-GATA motif as a regulatory element in the EKLF promoter. The fact that a mutation in any single site eliminated the enhancer effect suggested that several factors could be involved in the formation of a larger protein complex, each potentially contributing to the stability through contact with its DNA-binding site. We have begun investigating the character of this putative complex with electrophoretic mobility shift assays (EMSAs) using a nuclear extract from MEL cells. With the wild-type GEG double-stranded oligomer as a probe, we regularly observe three specific complexes, labeled A, B, and C in panel A of Fig. 7. Occasionally, slower mobility complexes are also detected, but not consistently under the particular buffer and temperature conditions used for this assay. The three major complexes can be specifically competed by the wild-type oligomer (GEG) or by any of the single mutation oligomers as shown in Fig. 7, panel A. The common factor with all these productive competitors is the presence of at least one intact GATA site.
|
A/C
mutations at these putative GATA-binding sites were prepared because
previous studies (32) had shown that these nucleotide changes would
prevent binding by the GATA class of transcription factors. Although
all three complexes, A-C, are observed with the GEG oligomer, only the
C complex is formed when the probe carries a point mutation in one of
the GATA sites. One interpretation of this result is that the C complex represents binding by a single GATA protein, and the A and B complexes contain multiple factors. The binding at each GATA site is not necessarily specific to the particular context of that GATA sequence, however. That is, binding to the GMEG oligomer can be
competed with the GEGM oligomer and vice versa.
Nevertheless, we have noted that the GEGM oligomer appears
to be less efficient in this binding reaction than either the
GMEG or the wild-type GEG oligonucleotide.
Whereas the results from these binding assays confirmed the importance
of the GATA sites in this element, the role of the E box was not
addressed. On the one hand, a mutation in the E box motif abolished the
enhancer activity, yet a specific protein-DNA complex could not be
assigned to this site since the GATA sites appeared to be driving the
binding activity in our assays. Therefore, as a means of focusing on
the potential E box-binding protein, the GMEGM
oligonucleotide was labeled and used as probe in the EMSA shown in Fig.
8. With mutations in the flanking sites
precluding binding by GATA factors, a complex was formed with the
central intact E box. Specificity was demonstrated by competition with
the wild-type but not the mutated E box in the GATA-E box-GATA
oligomers. These experiments taken together provide evidence for the
formation of DNA-protein complexes at all three sites in the GATA-E
box-GATA motif.
|
GATA-1 Is a Component in the Complexes That Bind the EKLF Distal Enhancer-- With the important features of this cis element defined, our studies have now shifted to the identification and characterization of the trans-acting factors that interact with this interesting configuration of binding sites. We have carried out supershift assays using antibodies to GATA-1 and two E box-binding proteins. Concerning this latter site, we were unable to demonstrate a reproducible effect using antibodies to either the ubiquitous E2A proteins or antibodies generated against the Tal1 protein. Our studies using GATA-1 antibodies were more instructive, and the results are illustrated in Fig. 9. In EMSA reactions with the wild-type GEG oligomer used as the probe, addition of the GATA-1 antibody resulted in the formation of several slower mobility complexes with a concomitant disappearance of the A-C complexes evident in the 1st lane. Addition of a control, non-immune antibody or an antibody directed against another, unrelated protein did not effect the mobility of any of these bands. Furthermore, with a probe containing only one intact GATA site (e.g. GMEG), the single C complex is also shifted by the GATA-1 antibody. Therefore, all three DNA-protein complexes observed with the GATA-E box-GATA motif include GATA-1 as a component.
|
| |
DISCUSSION |
|---|
|
|
|---|
The EKLF Promoter Specifies Adult, Erythroid-specific Expression-- A 1150-bp genomic fragment containing the EKLF promoter was shown to drive erythroid-specific and developmentally correct expression as analyzed in transgenic mice. In addition, we have transfected K562 cells with these EKLF-CAT constructs. The K562 cell line represents an earlier stage in erythroid development as compared with MEL cells. The reporter constructs are expressed in the K562 transfectants, but the levels are 40-50-fold lower than the MEL cell expression when the results are corrected for transfection efficiency between the two cell lines.2 This is consistent with the developmental pattern both of the reporter construct in transgenic mice and the endogenous EKLF gene. This promoter may therefore represent an avenue for producing adult, erythroid-specific expression in mice.
A GATA-E Box-GATA Enhancer Motif Resides in the Distal EKLF Promoter-- This study describes the identification of an interesting configuration of binding sites in the EKLF distal promoter region that functions as a unit to elevate the transcriptional activity. The 49-bp element consists of a GATA-E box-GATA arrangement of consensus binding sites. The distal activator was functionally defined by deletion constructs in which the presence of the element consistently produced a 5-8-fold increase in reporter gene activity. Mutational analyses were carried out to demonstrate the requirement for all three binding sites, i.e. both GATA sites and the E box-binding motif. A mutation at any individual site abolishes the transcriptional activation.
Potential Assembly of a Multimeric Complex at the GATA-E Box-GATA Enhancer Element-- Our results suggest the potential formation of, at the minimum, a quaternary protein complex containing two GATA-1 transcription factors and an E box dimer. These data can be considered in light of a recent paper from Wadman et al. (22) describing a large multiple protein, erythroid-specific complex in MEL nuclear extracts. These authors utilized a CASTing (cyclic amplification and selection of targets) procedure (33) to screen for preferred nucleotide sequences binding the protein of interest, Lmo2/rbtn2, in a complex with other factors. This experiment yielded a consensus site consisting of an E box and a GATA-binding site separated by 8-10 bp. This arrangement exactly matches the 3' two-thirds of our distal activator element. The authors propose a model involving a complex of GATA-1 and a heterodimer of Tal1 and E2A bridged by Lmo2, with the newly described Ldb1 also included through an association with Lmo2. This model is based in part on previous studies demonstrating a physical interaction between GATA-1 and Lmo2 (21) and Lmo2 and Tal1 (20). If we are detecting the same type of multimeric protein structure in our studies, this would be an indication of a functional role for this complex as a transcriptional activator for erythroid-specific expression. Although the similarity in sequence configuration is compelling, there are some differences that suggest the EKLF complex may be comparable but not identical to that described by Wadman et al. (22).
One principal difference is the requirement for all three sites in our element. The 5'-GATA-binding site contributes to the functional activity of this enhancer to an equivalent degree as the 3'-GATA- or E box-binding sites. The failure to obtain a CASTing sequence with all three sites may simply be due to the fact that the oligonucleotide strings used in the procedure were composed of 26 random nucleotides, whereas the EKLF element we have described spans 49 bp. The identity of the factor binding to the E box in the EKLF activator element is still under investigation. Based on recent evidence indicating interactions between GATA-1, Lmo2/rbtn2, and Tal1 (20-22), and the fact that Tal1 is an erythroid-specific E box factor, we have tested for the presence of Tal1 in our electrophoretic mobility shift assays. The inclusion of antibodies against either Tal1 or E2A, a known heterodimer partner for Tal1 (15), did not produce a supershift in any of the DNA-protein bands in our assays. Whereas we can detect binding at the E box site (see Fig. 8), we have noted that the nucleotide sequence matches neither the consensus Tal1-binding site (CAGATG) (34) nor the non-standard Tal1 site (CAGGTG) described by Wadman et al. (22). One possibility is, therefore, that an additional E box binding factor is involved. Alternatively, in this in vitro system, the binding conditions that favor binding of one protein or complex may be unsuitable for other constituents. Additional variations in buffer, temperature, and gel conditions may therefore be necessary to form and stabilize what is potentially a very large protein-DNA complex. Nonetheless, the functional activity observed in the transfected cells and the evidence for nuclear factor binding at all three sites indicate that the characterization of these binding factors will be an important avenue of continuing investigation. Finally, an analysis of the complex formation at this distal site must consider the likelihood of protein-protein associations in addition to direct DNA binding interactions. The establishment of GATA-1 binding at this site presents intriguing possibilities in light of the expanding list of factors shown to physically associate with GATA-1. Previous studies have demonstrated interactions between GATA family members (35, 36) and between GATA-1 and EKLF or Sp1 (18). For example, a factor termed FOG was recently isolated based on its ability to bind GATA-1 (37). Although a functional role has not yet been assigned to this protein, its expression pattern mirrors that of GATA-1 and it may generally be associated with GATA in vivo. Thus, the view of transcriptional activation is moving from simple models of factors binding to their cognate sites and individually activating transcription through an interaction with a component of the basal transcription machinery to more intricate mechanisms whereby either a protein binds to DNA and subsequently recruits additional factors into a multi-protein complex or, alternatively, the complex may assemble in the nucleus and bind en bloc to a series of binding sites. With the identification of many important transcription factors active in this system and the recent evidence for the multiple associations between these factors, studies of erythroid-specific gene regulation are expected to continue to significantly contribute to our general understanding of transcriptional mechanisms.| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Christine Kern for participation in the cloning of the EKLF gene during the early stages of this work and Jon Neumann for the generation of the transgenic mice. We are grateful to Dr. Richard Baer for generously providing TAL1 and E2A antibodies and to Dr. Emery Bresnick for kindly supplying a TAL1 antibody.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant DK39585.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF033102.
To whom correspondence should be addressed: Dept, of Molecular
Genetics, Microbiology, and Biochemistry, University of Cincinnati, 231 Bethesda Ave., ML 524, Cincinnati, OH 45267. Tel.: 513-558-5458; Fax:
513-558-1885.
1 The abbreviations used are: EKLF, erythroid Krüppel-like factor; TAL, T-cell acute lymphoblastic leukemia; bHLH, basic helix-loop-helix; Lmo, LIM domain only; CAT, chloramphenicol acetyltransferase; MEL, murine erythroleukemia; EMSA, electrophoretic mobility shift assay; kb, kilobase pair(s); PCR, polymerase chain reaction.
2 K. P. Anderson, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Lohmann and J. J. Bieker Activation of Eklf expression during hematopoiesis by Gata2 and Smad5 prior to erythroid commitment Development, June 15, 2008; 135(12): 2071 - 2082. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yokomizo, K. Hasegawa, H. Ishitobi, M. Osato, M. Ema, Y. Ito, M. Yamamoto, and S. Takahashi Runx1 is involved in primitive erythropoiesis in the mouse Blood, April 15, 2008; 111(8): 4075 - 4080. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ogilvy, R. Ferreira, S. G. Piltz, J. M. Bowen, B. Gottgens, and A. R. Green The SCL +40 Enhancer Targets the Midbrain Together with Primitive and Definitive Hematopoiesis and Is Regulated by SCL and GATA Proteins Mol. Cell. Biol., October 15, 2007; 27(20): 7206 - 7219. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Van Vlierberghe, M. van Grotel, H. B. Beverloo, C. Lee, T. Helgason, J. Buijs-Gladdines, M. Passier, E. R. van Wering, A. J. P. Veerman, W. A. Kamps, et al. The cryptic chromosomal deletion del(11)(p12p13) as a new activation mechanism of LMO2 in pediatric T-cell acute lymphoblastic leukemia Blood, November 15, 2006; 108(10): 3520 - 3529. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bose, C. Fugazza, M. Casalgrandi, A. Capelli, J. M. Cunningham, Q. Zhao, S. M. Jane, S. Ottolenghi, and A. Ronchi Functional Interaction of CP2 with GATA-1 in the Regulation of Erythroid Promoters Mol. Cell. Biol., May 15, 2006; 26(10): 3942 - 3954. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ferreira, K. Ohneda, M. Yamamoto, and S. Philipsen GATA1 Function, a Paradigm for Transcription Factors in Hematopoiesis Mol. Cell. Biol., February 15, 2005; 25(4): 1215 - 1227. [Full Text] [PDF] |
||||
![]() |
L. Xue, X. Chen, Y. Chang, and J. J. Bieker Regulatory elements of the EKLF gene that direct erythroid cell-specific expression during mammalian development Blood, June 1, 2004; 103(11): 4078 - 4083. [Abstract] [Full Text] [PDF] |