| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 24, 15061-15068, June 12, 1998
,,, and
**
From the Department of Medicine, State University of
New York at Stony Brook, Stony Brook, New York 11794, the
§ Department of Molecular Biology, American Type Culture
Collection, Manassas, Virginia 20110, ¶ Accumetrics Inc.,
San Diego, California 92121, and Program in Genetics, State
University of New York at Stony Brook,
Stony Brook, New York 11794
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
Proteolytically activated receptors (PARs)
represent an emerging subset of seven transmembrane G protein-coupled
receptors that mediate cell activation events by receptor cleavage at
distinct scissile bonds located within receptor amino termini.
Differential genomic blotting using a yeast artificial chromosome known
to contain the PAR-1 and PAR-2 genes identified the PAR-3 gene within a
PAR gene cluster spanning ~100 kilobases at 5q13. The PAR-3 gene is
relatively small (~12 kilobases); and, like the PAR-1 and PAR-2
genes, it displays a two-exon structure, with the majority of the
coding sequence and the proteolytic cleavage site contained within the
larger second exon. Sequence analysis of the 5'-flanking region
demonstrates that the promoter is TATA-less, similar to that seen with
PAR-1, with the identification of nucleic acid motifs potentially
involved in transcriptional gene regulation, including AP-1, GATA, and
octameric sequences. PAR-3 transcripts were apparent in human vascular
endothelial cells, although at considerably lower levels than those of
PAR-1 and not significantly modulated by the endothelial cell stimulus
tumor necrosis factor-
. Likewise, although PAR-3 mRNA was
evident in human platelets, receptor cell surface expression was modest
(~10%) compared with that of PAR-1. Thus, although PAR-3 is
postulated to represent a second thrombin receptor, its modest
endothelial cell and platelet expression suggest that PAR-3 activation
by -thrombin is less relevant for physiological responses in these
mature cells. Rather, given its disparately greater expression in
megakaryocytes (and megakaryocyte-like human erythroleukemia cells), a
regulatory role in cellular development (by protease activation) could
be postulated.
| |
INTRODUCTION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
Proteolytically activated receptors (PARs)1 are members of a larger family of seven transmembrane cell surface receptors that mediate cell activation events through heterotrimeric G proteins (1, 2). Until very recently, two PARs had been isolated to date, the thrombin receptor (PAR-1) (3) and the proteinase-activated receptor (PAR-2) (4, 5). Unlike the former class of receptors in which cellular activation events are initiated by standard receptor-ligand binding interactions, both PAR-1 and PAR-2 are activated by cleavage at distinct Arg-Ser bonds located within the NH2-terminal extension of both receptors, and synthetic peptidomimetics representing the new NH2 terminus after receptor cleavage function as full receptor agonists irrespective of receptor cleavage. In addition to displaying similar molecular mechanisms of receptor activation, functional similarities between PAR-1 and PAR-2 have also been observed. Thus, both are expressed on vascular endothelial cells (6), and both mediate proliferative responses when activated by their protease agonists (7, 8) or synthetic peptide ligands (6, 8). These structure/function similarities also extend to the gene level; thus, both PAR-1 and PAR-2 genes are known to co-localize at 5q13, and both genes are organized similarly, suggesting evolution from a common ancestral gene (9).
Given evolving evidence for protease activation of multiple cell types
(2, 7) and the corollary that some, if not all, of these cellular
sequelae may be mediated by activation of novel PARs, we adapted a
positional cloning approach as a strategy for the identification of
other putative PARs that may co-cluster within this region of the
genome. Interestingly, we identified the recently characterized PAR-3
gene (10) within this region of the genome and demonstrate that its
structural organization is essentially identical to that of PAR-1 and
PAR-2, reinforcing the concept of a gene family of receptors evolving
from a common ancestral gene and emerging along a distinct evolutionary
pathway. Furthermore, like PAR-1 and PAR-2, PAR-3 is also expressed on vascular endothelial cells, although at considerably lower levels; similar low level but detectable PAR-3 expression is also evident in
human platelets; thus, although PAR-3 appears to be a second "thrombin receptor," its comparatively modest expression in these cell types suggests a functional role distinct from PAR-1 in mediating cell activation events by -thrombin.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
Supplies, Reagents, and Cell Lines-- Restriction enzymes were purchased from Stratagene (La Jolla, CA) or New England Biolabs (Beverly, MA). Avian myeloblastosis virus reverse transcriptase was from Seikagaku America, Inc. (Rockville, MD), and ExpandTM long template polymerase was from Boehringer Mannheim. Oligonucleotide primers were synthesized on an Applied Biosystems model 381A single-channel synthesizer (G. D'Angelo, Molecular Biology Core, SUNY Stony Brook). Human umbilical vein endothelial cells (HUVEC) were isolated from pooled primary cultures of human umbilical veins and propagated as described previously (6). Human erythroleukemia (HEL) cells were propagated in RPMI medium supplemented with 10% fetal calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin.
Genomic Analysis and Library Screening--
Total genomic DNA
from normal human volunteers was extracted from peripheral blood
leukocytes as described previously (9) and quantitated by absorption
spectrophotometry at 260 nm. Approximately 5-10 µg of DNA was
digested with various restriction enzymes for Southern blot analysis.
The separation of large DNA fragments on agarose gels was completed
using an inversion field gel electrophoresis apparatus
(SwitchbackTM pulse controller, Hoefer Scientific
Instruments, San Francisco). Yeast artificial chromosomal (YAC) DNA was
isolated as described previously (11), and human genomic fragments were
separated from yeast chromosomes using a 1% agarose gel in 0.5 × TBE (Tris borate-EDTA), run at 6.9 V/cm in 0.5 × TBE buffer at
10 °C with a pulse timer of 1-50 s and a forward/reverse ratio of
3:1 for 24 h. Gels were blotted onto nylon membranes (Schleicher & Schuell) and hybridized to 32P-radiolabeled cDNA
probes. Blots were washed at high (0.1 × SSC, 0.1% SDS, 1 mM EDTA, pH 8.0, and 10 mM sodium phosphate at
68 °C for 1 h) or low (0.1 × SSC, 0.5% SDS, 1 mM EDTA, pH 8.0, 10 mM sodium phosphate at
55 °C for 30 min) stringency and analyzed by autoradiography with
Kodak XAR-5 film with an intensifying screen at 
80 °C for 3-10
days. For some experiments, filters were stripped according to the
manufacturer's recommendations and adequacy confirmed by overnight
autoradiography.
gt11, essentially as described previously (6). Positive phage clones were plaque purified, and the DNA
was purified from minilysates by standard methods (9). The PAR-3 gene
was isolated from a cosmid library generated from the ~1.4-megabase
YAC 798D11, shown previously in this laboratory to contain both PAR-1
and PAR-2 genes (11). A size-selected library ranging from ~30 to
~40 kb was generated by partial MboI digestion of 1 µg
of YAC 798D11 DNA followed by ligation to SuperCos-1 vector
(Stratagene) containing flanking BamHI sites. Ligation products were packaged using 25 µl of Gigapack III XL packaging extract for 2 h at 25 °C followed by titering and amplification using Escherichia coli host strain XL1-Blue. The titer of
the unamplified library was ~1 × 105 colony-forming
units/ml, consistent with a ~103-fold representation of
nucleotide sequences. Library screening was completed using the
32P-radiolabeled PAR-3 cDNA as probe, and DNA from
individual cosmids was characterized further by extensive restriction
mapping. Discrete genomic fragments were gel purified and ligated into
pBluescript (Stratagene) for DNA sequence analysis using dideoxy chain
termination. Exon-intron boundaries were defined by comparison of the
genomic DNA sequence with that of the published cDNA (10). Sequence analysis was performed using the Wisconsin Genetics Computer Group Package (12). The identification of PAR-3 promoter nucleotide motifs
potentially involved in transcriptional gene regulation was
characterized using TRANSFAC software (13).
Radiation Hybrid (RH) Mapping Analysis-- Genetic mapping within the PAR gene cluster was completed using both the Stanford G3 (~500-kb resolution) and TNG3 (~100-kb resolution) RH mapping panels (11, 14). PCR screening was completed using the following PAR-3-specific oligonucleotide primers: PAR2064 (5'-3': TCCATCCTTTCACCTACCGGG, bp 731-751) and PAR2065 (5'-3': TAGCAGTAGATGATAAGCACA, bp 989-969) (10). PAR-1, PAR-2, and microsatellite-specific primers encompassing this region of the genome were as described previously (11). PCR conditions were optimized for individual primer pairs, but the thermal profile generally included a 1-min 95 °C denaturation step, a 2-min 55 °C annealing step, a 3-min 72 °C primer extension step, with a final extension for 10 min at 72 °C; after 25 cycles in a thermocycler (Coy Laboratory Products, Ann Arbor, MI), products were analyzed by Southern blot analysis in a 3% ethidium-stained agarose gel and scored as present or absent. Retention patterns were submitted for two-point linkage analyses to the server maintained by the Stanford Human Genome Center2 or analyzed using RHMAP (version 2.02), a software package for multipoint radiation hybrid mapping (16).
RNA Preparation and Northern and PCR Analysis--
Confluent
HUVEC in second to fifth passage were harvested directly with a rubber
policeman, and total cellular RNA was isolated by immediate
solubilization in guanidine hydrochloride and serial ethanol
precipitation (6). Alternatively, poly(A) mRNA was isolated from
solubilized HUVEC (or HEL cells) by oligo(dT)-cellulose chromatography
(Invitrogen, San Diego). For some experiments, 3 × 107 HUVEC were stimulated with 100 units/ml tumor necrosis
factor- (17) for 4 or 24 h followed by RNA isolation.
Transcript expression of murine tissues was completed using 1 µg of
poly(A) RNA (Clontech, Palo Alto, CA). Northern blot analysis was
completed by size fractionation in a 1% denaturing agarose gel, and
equivalent RNA loading was confirmed by reprobing with a 
-actin
cDNA probe (18). Reverse transcription-PCR was completed by
incubating ~1 µg of total cellular RNA with 1 µg of a 14-mer
oligo(dT) primer at 41 °C for 1 h using 10 units of avian
myeloblastosis virus reverse transcriptase in a solution containing 50 mM Tris/HCl, pH 8.3, 50 mM KCl, 8 mM MgCl2, 10 mM dithiothreitol, and
500 µM individual dNTPs in a final volume of 50 µl. 10 µl was subsequently adjusted to PCR conditions using approximately
0.01 OD unit of each PCR primer and 5 units of Taq
polymerase (Thermus aquaticus DNA polymerase; Perkin-Elmer).
Oligonucleotide primers included the reverse primer PAR2065 (see above)
and the forward primers PAR2066 (5'-3': ATAACGTTTAAGAGACGGGACT, bp
111-132). PCR conditions included a 1-min 15-s denaturation step at
94 °C, a 1-min 55 °C annealing step, and a 3-min primer extension
step at 72 °C. Amplifications consisted of 35 rounds using a DNA
thermocycler, and insert sizes were determined by electrophoresis in a
1% ethidium-stained agarose gel. Platelet PCR was completed in a
similar manner, except for minor modifications, essentially as
described previously (19).
PAR-3 Immunodetection-- A 17-mer peptide encompassing the PAR-3 cleavage site with an added NH2-terminal cysteine and COOH-terminal amide (PAR-332-48, Ac-CKPTLPIKTFRGAPPNS-amide) was custom synthesized by Quality Controlled Biochemicals (Hopkington, MA) and purified by reverse phase high pressure liquid chromatography. For antibody generation, the peptide was conjugated to keyhole limpet hemocyanin or to BSA using the hetero-bifunctional cross-linking reagent mal-sac HNSA, and the keyhole limpet hemocyanin-conjugate was used to immunize New Zealand White rabbits. Immunoreactivity of the anti-PAR-3 antibody to the BSA conjugate was confirmed by solid phase enzyme-linked immunosorbent assay. Preimmune and immune rabbit IgGs were purified by protein G affinity chromatography. For immunofluorescent studies, the immunopurified IgG was labeled directly with FITC (0.2 mg of FITC/mg of IgG) in 0.1 M sodium carbonate buffer, pH 9.5, for 2 h at 25 °C, and unbound FITC was removed by gel filtration on a Bio-Rad 10-DG column developed with degassed PBSA (10 mM sodium phosphate, 150 mM sodium chloride, 0.05% sodium azide, pH 7.4).
Immunofluorescent staining of confluent HUVEC was completed in eight-well chamber slides after fixation in 4% paraformaldehyde for 20 min at 25 °C (for determination of cell surface staining) or fixation and permeabilization using ice-cold 100% acetone for 60 s. Fixed HUVEC were then washed extensively with PBS followed by incubation with 100 µg/ml FITC-conjugated anti-PAR-3 IgG or a 1:100 dilution of the FITC-conjugated IgG alone for 60 min at 4 °C. After the last of five washes in PBS, cells were mounted in Aquamount, and fluorescent images were obtained using a Nikon Diaphot inverted microscope equipped with fluorescent optics (Nikon, Garden City, NY). Images were frame averaged to 256 frames with Image I software (Universal Imaging, Media, PA) using laser light excited at 529 nm and a blocking filter of 550 nm. Flow cytometric analysis of HUVEC was completed by detaching adherent cells using PBS and 10 mM EDTA and resuspending the cells to a final concentration of 5 × 105/ml PBS and 0.1% BSA. 200-µl aliquots were then incubated with 100 µg/ml FITC-conjugated anti-PAR-3 IgG for 60 min at 4 °C in PBS and 0.1% BSA, and cells were washed twice and then fixed in 1% formalin before analysis. Platelet cell surface PAR-1/PAR-3 expression was completed as described previously (20). Briefly, platelet-rich plasma was prepared in 10 mM EDTA from healthy human donors by differential centrifugation and adjusted to 3 × 108 platelets/ml TSE (0.1 M Tris, 0.15 M NaCl, 10 mM EDTA, pH 7.4). 400-µl aliquots were then incubated with 100 µg/ml FITC-conjugated anti-PAR-3 IgG, 100 µg/ml anti-PAR-1 IgG (20), or 100 µg/ml nonimmune rabbit IgG for 30 min at 25 °C. For PAR-1 expression, platelets were incubated with a 1:100 dilution of the FITC-conjugated goat anti-rabbit F(ab')2 secondary antibody (Tago, Inc., Burlingame, CA) for 20 min at 25 °C; samples were then washed three times in TSE, fixed in 1% formalin, and analyzed in a FACStar flow cytometer (Becton Dickinson and Co., Rutherford, NJ).| |
RESULTS AND DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
Identification of the Human PAR-3 Gene within the PAR Gene
Cluster--
Previous work from this laboratory demonstrated that
human PAR-1 and PAR-2 genes are contained within YAC 798D11 and
separated maximally by ~100 kb (11). In an attempt to identify
additional PARs that potentially may be clustered in this region of the
genome, differential genomic blotting was adapted using a series of
cDNA probes encompassing distinct regions of the PAR-1 or PAR-2
genes. Using such an approach, PAR-1-specific probes failed to identify any novel cross-hybridizing fragments (not shown). In contrast, a
PAR-2-specific probe encompassing the 5'-region of the cDNA identified a novel band at low stringency which was not evident when
the blot was washed at higher stringency (Fig.
1). By inversion field gel
electrophoresis, this EcoRI fragment was estimated to be
~16 kb and could not be resolved by the known genomic organization of
PAR-2 (5). Furthermore, this band was not present within a P1 genomic
clone (P1142) shown previously by Nystedt and colleagues (5) to contain
the entire PAR-2 gene (not shown), again strongly suggesting that it
represented a previously uncharacterized, homologous PAR or a processed
pseudogene. Concomitant with these initial observations, a routine
BLAST (21) homology search using PAR-2 sequences identified a highly
homologous expressed sequence tag (EST) AA177828, partially
characterized from a murine splenic cDNA library, as part of the
Washington University/HHMI Mouse EST project. This expressed sequence
tag was purchased from Research Genetics, fully sequenced, and found to
contain a 1,238-bp insert encoding a 283-amino acid open reading frame
(representing an incomplete cDNA) demonstrating highest homology to
PAR-1 and PAR-2. This 32P-radiolabeled insert was then used
to screen empirically a HUVEC cDNA library using low stringency
screening to maximize hybridization cross-species, with the isolation
of three cDNA clones, the longest of which (2B1A, 2,566 bp) was
characterized more fully (see below). As demonstrated in Fig.
1D, this cDNA (now known to be identical to PAR-3) (10),
cross-hybridized to the novel ~16-kb EcoRI fragment recognized by the 5'-PAR-2 probe (Fig. 1C), thereby
establishing its identity as the human PAR-3 gene.
|
Physical and Genetic Mapping within the PAR Gene Cluster-- To establish more precisely distances among the PAR genes within this genomic segment, we completed genetic mapping using radiation hybrid mapping panels (11, 14). Using the lower resolution G3 panel, the amplification (and retention) patterns for all three genes were indistinguishable (no breaks were observed in the 83 hybrids typed), establishing that the closest framework marker to all three PARs was D5S424 (22), with significant linkage as well to D5S1977, D5S2529, and D5S2596 (in order of decreasing log of odds scores, see Fig. 2). Thus, all three PARs were linked tightly to the identical microsatellite markers and were at least as close to each other as the resolution power of this panel (360-500 kb).2 To establish further interorder assignments and distance, we determined amplification patterns from a second radiation hybrid panel TNG3 with a higher lengthwise resolution of ~100 kb (11).2 The amplification patterns obtained using this RH panel were analyzed using RH2PT (16) and demonstrated that the three genes could now be resolved, with the likely order centromere-D5S424-PAR-2-PAR-1-PAR-3-telomere (Fig. 2). Although physical conversions are not available for the TNG3 RH panel, if one assumes an average resolution of 3-6 kb/centiRad throughout the panel,2 this initial analysis suggested that the three PARs are separated by ~110 to ~220 kb, which was confirmed subsequently by inversion field gel electrophoresis and Southern blot analysis. DNA digests of YAC 798D11 were completed using various restriction endonucleases (including rare-cutting enzymes) in an attempt to resolve the three genes within single large genomic fragments. As revealed in Fig. 3, Southern blot analysis demonstrated that all three cDNAs were contained within restriction fragments of ~90 kb (XhoI) or ~120 kb (NotI), consistent with a distance among the genes of less than 100 kb.
|
|
PAR-3 Genomic Characterization--
To characterize the genomic
structure of PAR-3, a cosmid library was constructed using YAC 798D11
DNA. Approximately 7 × 103 independent clones from
the unamplified library were screened using the PAR-3 cDNA, with
the identification of 10, three of which (COS3-2, COS2-1, and
COS7-1) were characterized further. Only one of the three clones
(COS3-2) contained the entire PAR-3 gene, whereas COS2-1 and COS7-1
lacked the 5'-coding region (Fig. 4).
PAR-3 exons, intron/exon boundaries, and portions of the flanking introns were sequenced bidirectionally for further analysis. Not unexpectedly, PAR-3 displayed a genomic organization similar to that of
the PAR-1/PAR-2 genes (5, 9, 23), containing a small first exon and a
larger second exon encoding the majority of the coding sequence and the
protease cleavage site. The single intronic splice site occurs after
the second nucleotide of the Gly22 codon, indicative of a
type II splice site, although the splice junction sequences are
somewhat atypical (24). Nucleotide analysis of the entire coding
sequence was identical to that described initially (10), with the
identification of an additional 1,451 bp of 3'-untranslated sequence in
the cDNA clone 2B1A. This sequence has been deposited into the
GenBank data base and assigned the accession number AF053124. The size
of the PAR-3 first intron was estimated at ~4 kb, utilizing
restriction mapping and long range PCR from YAC 798D11, COS3-2, and
total human genomic DNA. Thus, although genomic
rearrangements/deletions are not uncommonly found in YACs, the
identical sizes of restriction fragments and PCR fragments confirm
these size estimates and determinations.
|
772, 1041, and 1208 (26, 27), and a
single cAMP response element-binding protein (28) sequence present at
638. Eight GATA-like sequences known to represent binding sites for
the erythroid nuclear factor protein NF-E1 are present at 344, 430,
480, 619, 735, 891, and 935 (29). This protein is also known
to be expressed in megakaryocytes (30), an observation of potential
relevance given the observed high level of PAR-3 expression in these
cells (10; see below). Also of relevance for megakaryocytic gene
regulation is the presence of seven distinct octameric sequences,
regulatory elements known to modulate the expression of various
megakaryocyte genes (31, 32).
|
PAR-3 mRNA Expression in Endothelial Cells--
Initial
evaluation for PAR-3 transcript expression was pursued by Northern blot
analysis using murine tissues. Dual transcripts of ~4.0 and ~2.0 kb
were evident primarily in poly(A) mRNA from spleen, with little to
no expression evident in poly(A) mRNA from brain, kidney, liver,
lung, pancreas, or smooth muscle (not shown), results that were
consistent with those described previously (10). Interestingly, this
initial analysis suggested that PAR-3 may be expressed in tissues of
hematopoietic origin, and cellular sources for PAR-3 expression were
pursued subsequently in megakaryocytes/platelets and endothelial cells.
The latter cell type was studied because of prior evidence for both
PAR-1 and PAR-2 expression in endothelial cells (6) and strong
presumptive evidence for PAR-3 expression obtained during initial HUVEC
cDNA library screening (see above). Accordingly, Northern blot
analysis was completed using total cellular RNA from endothelial cells
and from HEL cells, which display phenotypic features of megakaryocytic
differentiation (33). As shown in Fig. 6,
PAR-3 transcripts were clearly evident in HEL cells, approximately
2-fold higher than those of PAR-1 transcripts. In contrast, although
PAR-3 expression was evident in HUVEC, the relative transcript
expression was considerably less than that of PAR-1, with steady-state
PAR-1 levels nearly 25-fold greater than those of PAR-3. To address the
possibility that PAR-3 expression could be up-regulated during cell
activation, cells were then stimulated with the endothelial cell
stimulant tumor necrosis factor-, and differential PAR-1/PAR-3
expression was studied further. Minimal change in either transcript
expression was evident, with the PAR-1/PAR-3 ratio remaining skewed
toward enhanced PAR-1 expression at both time points studied.
|
|
Platelet PAR-3 Expression-- As described initially, PAR-3 transcripts were expressed prominently in splenic megakaryocytes as evaluated by in situ hybridization (10). This observation, combined with our demonstration for considerable PAR-3 expression in the megakaryocyte-like HEL cells, prompted us to study PAR-3 expression in platelets, an issue of considerable importance given previous evidence for dual thrombin receptors or signaling pathway(s) in these cells (20, 35). As shown by reverse transcription-PCR, a PAR-3 mRNA transcript was readily detectable in human platelets (Fig. 8). Because this assay as designed was not quantitative, cell surface receptor expression was then studied by flow cytometric analysis, designed to elucidate more accurately relative PAR-1/PAR-3 expression on the platelet cell surface. Interestingly, these results are comparable to those seen in HUVEC, demonstrating detectable but low level PAR-3 expression and considerably less cell surface receptor when compared with PAR-1. Prior determinations suggest that there are approximately 1,500-2,000 PAR-1 receptors on human platelets (36, 37). Based on the relative mean fluorescence intensities of PAR-1/PAR-3 as established by flow cytometry, we would estimate PAR-3 receptor density to be approximately 10% of PAR-1 (~150-200 receptors/platelet), although definitive comparisons will ultimately require monoclonal antibodies with limited antigenic epitopes.
|
Summary and Implications for Future Research-- PARs represent a unique and rapidly emerging family of G protein-coupled seven-transmembrane receptors that mediate cell activation events to serine proteases generated during one of three major protease-generating pathways in humans (inflammatory, fibrinolytic, or hemostatic). To date, all three PAR genes have been identified as being structurally conserved and residing within a discrete segment of the human genome, strongly suggesting evolution from a common ancestral gene. Given progressive evidence that a larger number of serine proteases affect cell activation (2), we would speculate that more structurally similar receptors exist, some of which may be found within this gene cluster or identified as part of the human genome initiative. The construction of a cosmid library containing the repertoire of genes encompassing this region of the genome may facilitate the search for, and rapid characterization of, other structurally similar receptors that may co-localize within this region of the genome.
What is the function of PAR-3? Although characterized initially as a second thrombin receptor (10), the Lys38/Thr39 cleavage site appears somewhat unusual for a thrombin substrate. Nonetheless, this may represent the alternative thrombin-responsive pathway described previously in multiple cells, including platelets (20, 35) and endothelial cells (20). In human platelets, PAR-1 is the primary regulator of platelet aggregation to thrombin (15); and in both platelets and endothelial cells, anti-PAR-1 antibodies abrogate the immediate phase of intracytosolic calcium release, although a moderate and sustained response remains evident (20). Although PAR-3 is clearly expressed in both of these cells by mRNA and protein determinations, the levels appear modest compared with those of PAR-1. Interestingly, PAR-3 expression appears considerably higher in megakaryocytes (10) and in the megakaryocyte-like cell line (HEL) studied as our model system. Thus, we would speculate that activation of human platelet PAR-3 by-thrombin (or other unidentified
proteases) may be less important for physiological responses in these
mature cells but potentially more applicable for poorly defined
cellular responses (to proteases) that may regulate megakaryocytic (or
endothelial cell) development.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Shirley Murray for assistance with the processing of this manuscript, Dr. Barry Coller for assistance and advice with antibody generation and for critically reviewing the manuscript, and David Colflesh for assistance with the fluorescent microscopy and image analysis.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant HL49141 and an American Heart Association Established Investigator award (to W. F. B).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF050525.
** To whom correspondence should be addressed: Division of Hematology, HSC T15-040, SUNY, Stony Brook, NY 11794-8151. Tel.: 516-444-2059; Fax: 516-444-7530; E-mail: Wbahou{at}mail.som.sunysb.edu.
1 The abbreviations used are: PAR(s), proteolytically activated receptor(s); HUVEC, human umbilical vein endothelial cell(s); HEL, human erythroleukemia cell(s); YAC, yeast artificial chromosomal; kb, kilobase(s); RH, radiation hybrid; PCR, polymerase chain reaction; bp, base pair(s); BSA, bovine serum albumin; FITC, fluorescein isothiocyanate; PBS, phosphate-buffered saline.
2 Stanford Human Genome Center (http://shgc.www.stanford.edu/rh) (1996).
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  V. A. Schmidt, C. S. Chiariello, E. Capilla, F. Miller, and W. F. Bahou Development of Hepatocellular Carcinoma in Iqgap2-Deficient Mice Is IQGAP1 Dependent Mol. Cell. Biol., March 1, 2008; 28(5): 1489 - 1502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hirano The Roles of Proteinase-Activated Receptors in the Vascular Physiology and Pathophysiology Arterioscler. Thromb. Vasc. Biol., January 1, 2007; 27(1): 27 - 36. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Leger, L. Covic, and A. Kuliopulos Protease-Activated Receptors in Cardiovascular Diseases Circulation, September 5, 2006; 114(10): 1070 - 1077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Cleator, W. Q. Zhu, D. E. Vaughan, and H. E. Hamm Differential regulation of endothelial exocytosis of P-selectin and von Willebrand factor by protease-activated receptors and cAMP Blood, April 1, 2006; 107(7): 2736 - 2744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Mehta and A. B. Malik Signaling Mechanisms Regulating Endothelial Permeability Physiol Rev, January 1, 2006; 86(1): 279 - 367. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. A. Lidington, R. Steinberg, A. R. Kinderlerer, R. C. Landis, M. Ohba, A. Samarel, D. O. Haskard, and J. C. Mason A role for proteinase-activated receptor 2 and PKC-{epsilon} in thrombin-mediated induction of decay-accelerating factor on human endothelial cells Am J Physiol Cell Physiol, December 1, 2005; 289(6): C1437 - C1447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. N. McLaughlin, L. Shen, M. Holinstat, J. D. Brooks, E. DiBenedetto, and H. E. Hamm Functional Selectivity of G Protein Signaling by Agonist Peptides and Thrombin for the Protease-activated Receptor-1 J. Biol. Chem., July 1, 2005; 280(26): 25048 - 25059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. McLaughlin, M. R. Mazzoni, J. H. Cleator, L. Earls, A. L. Perdigoto, J. D. Brooks, J. A. S. Muldowney III, D. E. Vaughan, and H. E. Hamm Thrombin Modulates the Expression of a Set of Genes Including Thrombospondin-1 in Human Microvascular Endothelial Cells J. Biol. Chem., June 10, 2005; 280(23): 22172 - 22180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. James, D. J. Collison, and G. Duncan Characterization and Functional Activity of Thrombin Receptors in the Human Lens Invest. Ophthalmol. Vis. Sci., March 1, 2005; 46(3): 925 - 932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird Thrombin and Phenotypic Modulation of the Endothelium Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 41 - 53. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. O'Brien, H. Koi, S. Parry, L. F. Brass, J. F. Strauss III, L.-P. Wang, J. E. Tomaszewski, and L. K. Christenson Thrombin Receptors and Protease-Activated Receptor-2 in Human Placentation: Receptor Activation Mediates Extravillous Trophoblast Invasion i |
