|
J Biol Chem, Vol. 273, Issue 25, 15846-15853, June 19, 1998
Disruption of Redox Homeostasis in the Transforming Growth
Factor- /c-myc Transgenic Mouse Model of Accelerated
Hepatocarcinogenesis*
Valentina M.
Factor,
Andras
Kiss,
Joseph T.
Woitach,
Peter J.
Wirth, and
Snorri S.
Thorgeirsson
From the Laboratory of Experimental Carcinogenesis, NCI, National
Institutes of Health, Bethesda, Maryland 20892
 |
ABSTRACT |
In previous studies we have demonstrated that
transforming growth factor (TGF)- /c-myc double
transgenic mice exhibit an enhanced rate of cell proliferation,
accumulate extensive DNA damage, and develop multiple liver tumors
between 4 and 8 months of age. To clarify the biochemical events that
may be responsible for the genotoxic and carcinogenic effects observed
in this transgenic model, several parameters of redox homeostasis in
the liver were examined prior to development of hepatic tumors. By 2 months of age, production of reactive oxygen species, determined by the peroxidation-sensitive fluorescent dye, 2',7'-dichlorofluorescin diacetate, was significantly elevated in TGF- /c-myc
transgenic hepatocytes versus either wild type or
c-myc single transgenic cells, and occurred in parallel
with an increase in lipid peroxidation. Concomitantly with a rise in
oxidant levels, antioxidant defenses were decreased, including total
glutathione content and the activity of glutathione peroxidase, whereas
thioredoxin reductase activity was not changed. However, hepatic tumors
which developed in TGF- /c-myc mice exhibited an increase
in thioredoxin reductase activity and a very low activity of
glutathione peroxidase. Furthermore, specific deletions were detected
in mtDNA as early as 5 weeks of age in the transgenic mice. These data
provide experimental evidence that co-expression of TGF- and
c-myc transgenes in mouse liver promotes overproduction of
reactive oxygen species and thus creates an oxidative stress
environment. This phenomenon may account for the massive DNA damage and
acceleration of hepatocarcinogenesis observed in the
TGF- /c-myc mouse model.
 |
INTRODUCTION |
Current knowledge suggests that endogenous oxidants generated by
multiple intracellular pathways may be considered as an important class
of naturally occurring carcinogens (1, 2). Reactive oxygen species
(ROS)1 are endogenous
oxygen-containing molecules formed as normal products during aerobic
metabolism (3). The term encompasses many species including superoxide
(O 2), hydroxyl (HO·), peroxyl
(RO2·), and alkoxyl (RO·)
radicals, and certain nonradicals such as singlet oxygen
(1O2) and hydrogen peroxide
(H2O2) that can be easily converted into
radicals. ROS can produce genetic mutations as well as gross chromosomal alterations and thus contribute to cancer development at
initiation, promotion and progression stages (4, 5). There is also
accumulating evidence that oxidative damage to DNA may play a critical
role in aging (6, 7).
In addition, a number of recent studies have demonstrated that ROS at
submicromolar levels act as novel intra- and intercellular second
messengers and thus modulate various aspects of cellular functions
including proliferation, apoptosis and gene expression (8, 9). New
evidence indicates that ligand binding to cell surface receptors linked
to tyrosine kinase activity can trigger signal transduction pathways
leading to intracellular ROS generation (10). An expanding list of
extracellular stimuli shown to induce ROS generation in a variety of
nonphagocytic cell types includes a number of peptide growth factors
such as platelet-derived growth factor (11, 12), basic fibroblast
growth factor (11-13), and epidermal growth factor (EGF) (14, 15), as
well as certain cytokines including tumor necrosis factor- (13, 16,
17), interleukin-1 (16), and transforming growth factor
(TGF)- 1 (18-24). Although the chemical nature of the
ROS generated in response to the activation of various receptors has
not been well characterized, H2O2 has been
shown to be a major component of ROS in cells treated with EGF,
platelet-derived growth factor, or TGF- 1 (12, 14, 15,
20, 22).
The stimulation of ROS production by TGF- either in vitro
or in vivo has not been yet reported. TGF- is a member of
a family of growth factors which elicit their growth regulation by
triggering the EGF receptor signaling cascade (25). We have previously found that cooperation of TGF- and c-myc pathways in the
liver cells is extremely efficient in acceleration of
hepatocarcinogenesis in double transgenic mice (26, 27). In fact,
TGF- /c-myc mice not only developed tumors more rapidly
than either of the parental lines, but the multiplicity and tumor size
were significantly increased, indicating escalation of both initiation
and promotion stages of cancer development. Two hallmarks of
hepatocarcinogenesis associated with TGF- /c-myc signaling
are widespread dysplasia (27) and profound chromosomal abnormalities
(28). The rapid development of a dysplastic phenotype preceded the
early onset of liver tumor growth and was associated with marked
cellular enlargement, up-regulation of TGF- 1 gene
expression and growth cessation indicative of premature senescence (29,
30). However, the most remarkable biological consequence of
constitutive co-expression of TGF- and c-myc transgenes
was severe DNA damage. In 2-month-old double transgenic hepatocytes,
the frequency of chromosomal breakage was increased nearly 10-fold,
whereas the number of aberrations observed in c-myc and
TGF- single transgenic hepatocytes was only 1.3- and 3-times
background, respectively (28). Moreover, the presence of nonrandom
chromosomal breaks recorded prior to tumor development and persistent
enhancement of chromosomal damage in hepatocellular
carcinomas2 suggested that
TGF- /c-myc hepatocytes exhibited a mutator phenotype (4).
Given the known carcinogenic properties of ROS, we hypothesized that
enhanced metabolic generation of oxygen radicals in rapidly proliferating TGF- /c-myc transgenic hepatocytes might be
responsible for genetic instability and acceleration of liver cancer in
this animal model. The present study was undertaken to examine whether the chronic activation of mitogenic signaling induced by overexpression of c-myc and TGF- transgenes creates a state of oxidative
stress in mouse liver.
 |
EXPERIMENTAL PROCEDURES |
Materials--
The following chemicals were used: collagenase
(type H) (Boehringer Mannheim), and 2',7'-dichlorofluorescin diacetate
(DCFH-DA) (Molecular Probes, Eugene, OR). GSH, glutathione assay kit,
glutathione peroxidase assay kit, and lipid peroxidation kit were
purchased from Calbiochem, G NOME DNA isolation kit was from BIO 101, Inc. (Vista, CA), and protein assay was from Bio-Rad.
Mice--
Male c-myc single transgenic,
TGF- /c-myc double transgenic and wild type (WT) mice were
generated in (CD1 × B6CBA)F1 background as described
previously (26, 30, 31). The animal study protocols were conducted
according to National Institutes of Health guidelines for animal care.
Mice were fed a standard rodent chow and water ad
libitum.
Hepatocyte Isolation--
Hepatocytes were isolated by two-step
collagenase perfusion of the liver followed by isodensity
centrifugation in Percoll as described previously (29). Viability was
determined by trypan blue exclusion and was typically greater than
90%.
Fluorescent Measurement of Intracellular Peroxides--
To
assess levels of intracellular ROS, flow cytometric analysis was
performed using the oxidative-sensitive probe DCFH-DA as described (32,
33). Hepatocytes (0.5 × 106/ml) were incubated for 30 min at 37 °C either in the presence or absence of 5 µM
DCFH-DA. After incubation, the cells were transferred to an ice water
bath, and formation of 2',7'-dichlorofluorescein (DCF) was analyzed by
flow cytometry using a Becton Dickinson FACSCAN with excitation and
emission settings of 495 and 525 nm, respectively. The DNA of dead
cells was stained with propidium iodine (5 µM/ml) before
the measurement of DCF fluorescence. Ten thousand propidium
iodine-negative viable cells from duplicate samples were analyzed per
point. Relative fluorescence intensity was calculated as the difference
between DCF fluorescence and autofluorescence measured in unstained
cell suspensions for each cell preparation analyzed. Values were
converted from log fluorescence to linear fluorescence intensity by
application of the equation (34): relative fluorescence intensity = 10[(Ch#exp-Ch#ctl)/256], where Ch#exp = measured
mean channel number of experimental sample stained with DCFH-DA;
Ch#ctl = measured mean channel number of negative control (in the
absence of dye); and 256 = number of channels per decade with
4-decade log amplification.
Tissue Preparation--
Tissue assays were performed on livers
washed free of blood via retrograde venous perfusion with 0.9% NaCl
containing either 0.16 mg/ml heparin or EDTA as anticoagulant. Liver
tissue was rinsed in ice-cold saline, snap-frozen in liquid nitrogen,
and kept at 70 °C prior to use.
Determination of Intracellular GSH--
The concentration of GSH
in liver homogenates (5% w/v in 5% metaphosphoric acid) was
determined by a colorimetric assay kit according to the manufacturer's
instructions. A standard curve was generated using known quantities of
GSH.
Detection of Lipid Peroxidation--
The contents of
malondialdehyde and 4-hydroxylalkenals (4-HNE) in liver homogenates
prepared in 20 mM Tris-HCl, pH 7.4 (10% w/v), were
determined by a colorimetric assay kit according to the manufacturer's
instructions. A standard curve was generated using known quantities of
4-hydroxynonenal as the diethylacetal, in acetonitrile.
Detection of GPx Activity--
Tissue samples were homogenized
in two volumes of ice-cold buffer containing 25 mM
Tris-HCl, pH 7.5, 1.5 mM EDTA, 10 µg of aprotinin, 10 µg of leupeptin, and 10 µg of phenylmethylsulfonyl fluoride and
centrifuged at 16,000 × g for 10 min at 4 °C.
Cellular GPx activities were determined utilizing a standard GPx assay kit following the manufacturer's instructions. GPx enzymatic activity was monitored in Hewlett Packard diode-array spectrophotometer as the
rate of NADPH oxidation at 340 nm. One unit of GPx will oxidize 1 µmol of NADPH/min at 30 °C.
Detection of Thioredoxin Reductase Activity--
Thioredoxin
reductase activities in tissue homogenates were determined using the
NADPH-dependent reduction of 5,5'-dithiobis-(2-nitrobenzoic acid) method essentially as described previously (35). The tissue homogenates were prepared as above for GPx determinations and the assay
mixtures (1 ml) contained 50 mM potassium phosphate, pH
7.0, 50 mM KCl, 10 mM EDTA, 0.24 mM
NADPH, bovine serum albumin (0.2 mg/ml), and 2.5 mM
5,5'-dithiobis-(2-nitrobenzoic acid) (50 µl of a 50 mM
solution in absolute ethanol). The change in absorbance at 412 nm was
monitored over 1 min at 30 °C. Activity was defined as micromoles of
NADPH oxidized per min by A412/(13.6 × 2), since 1 mol of NADPH yields 2 mol of thionitrobenzoate.
Plasma Biochemistry--
Plasma was collected from retro-orbital
puncture. The concentrations of alanine aminotransferase,
triglycerides, and total cholesterol were measured utilizing an
automated multichannel analyzer (Anilytics Incorporated, Gaithersburg,
MD).
Other Analytical Methods--
Protein concentrations were
determined using the Bio-Rad detergent-compatible protein assay with
bovine serum albumin as the protein standard.
DNA Isolation and Analysis of mtDNA Deletion--
Total DNA was
isolated from liver samples using the G NOME DNA isolation kit
following the manufacturer's instructions. Detection of mtDNA deletion
present in the direct repeats of mtDNA (direct repeat 17 corresponding
to bp 979-5650 of mouse mtDNA) (36) was performed by PCR utilizing the
primers AGTCGTAACAAGGTAAGCAT (bp 1094-1113) and ATGCTAGGAGAAGGAGAAAT
(bp 4915-4934) and the following conditions: denaturation (96 °C,
40 s); primer annealing (50 °C, 30 s); primer extension
(72 °C, 2 min); 35 cycles. The PCR product of the intact repeat is
4671 bp, while the predicted size of the deletion between the direct
repeats is 3821 bp, producing a PCR deletion product of 851 bp. The PCR
products were analyzed on a 1% Tris-acetate-EDTA-agarose gel and
visualized using ethidium bromide.
Electron Microscopy--
Fragments of liver were fixed in a 100 mM phosphate-buffered solution (pH 7.4) of 2.5%
glutaraldehyde and 2% neutral formaldehyde for 4 h and then
postfixed in 100 mM phosphate-buffered 1% osmium tetroxide
solution for an additional 2 h. After embedding in Epon 812, ultrathin sections were cut with a Diatome diamond knife on LKB
ULTRATOM III ultratome (LKB Ultratome, Uppsala, Sweden), then
contrasted with uranyl acetate and lead citrate, and examined on a JEOL
100CX transmission electron microscope (Tokyo, Japan).
Statistical Analysis--
Results are expressed as the mean ± S.E. The significance of the difference of means was determined by
the paired Student's t test.
 |
RESULTS |
ROS Production Is Increased in Hepatocytes from TGF- /c-myc
Transgenic Mice--
To determine whether TGF- /c-myc
hepatocytes generate higher levels of ROS, DCFH-DA was utilized as a
substrate for detection of H2O2 and other
hydroperoxides (32, 37, 38). This assay involves the incorporation of
the nonpolar compound, DCFH-DA, into the hydrophobic regions of the
cell where it is hydrolyzed to DCFH. In the presence of appropriate
oxidants, DCFH gives rise to DCF, which is membrane-impermeable and
highly fluorescent, and can be detected by fluorescent-activated sorter
analysis. Fig. 1A demonstrates
that the rate of oxidation of DCFH-DA to DCF was comparable in
5-week-old WT, c-myc, and TGF- /c-myc mice. However, by 10 weeks of age, double transgenic hepatocytes generated significantly greater amounts of peroxides, as shown by a shift to the
right in the mean logarithmic fluorescence intensity to that of
c-myc and WT mice (Fig. 1B). Quantitative
measurements showed that the levels of peroxide production was
increased by 8.2-fold in TGF- /c-myc transgenic
hepatocytes versus 3.2-fold in c-myc cells
between 5 and 10 weeks of age. No significant difference was found
between the mean DCF fluorescence intensity in WT hepatocytes over a
period of the first 2 months of life (Fig. 1A).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Changes in intracellular generation of
peroxides in c-myc and TGF- /c-myc transgenic
hepatocytes as measured by DCF fluorescence. Hepatocytes isolated
from 5- and 10-week-old WT, c-myc, and
TGF- /c-myc mice by collagenase perfusion were incubated
in the absence or presence of 5 µM of the
oxidative-sensitive probe DCFH-DA for 30 min at 37 °C and subjected
to flow cytomentry. A, relative DCF fluorescence intensity
measured as difference between DCF fluorescence and autofluorescence in
unstained cell suspensions for each cell preparation analyzed. Values
were converted from log fluorescence to linear fluorescence intensity
as described under "Experimental Procedures" by application of the
equation for which every 256 channels of separation represent a 10-fold
difference. Data are shown as mean ± S.E., n = 5 in each group of mice. *p < 0.01, **p < 0.05 when compared with WT and c-myc mice, respectively,
using Student's t test. B, comparative flow
cytometry distributions of DCF fluorescence intensity. The histograms
represent the number of cells as a function of fluorescence intensity
expressed as channel number (log fluorescence intensity). The panel
represents the overlay of four representative fluorescent-activated
cell sorter analysis performed on 10-week-old WT (white
area), c-myc (gray area), and
TGF- /c-myc (black area) hepatocytes. The
dashed histogram shows the autofluorescence profile in
unstained WT hepatocytes.
|
|
Lipid Peroxidation Is Elevated in TGF- /c-myc Livers--
We
next examined the rate of lipid peroxidation as a downstream measure of
accumulated oxidative damage to membrane lipids. Lipid peroxidation is
important because it amplifies the free radical process, and because
its products could lead to cellular and tissue damage (39). No
differences were found in the tissue content of 4-HNE and
malondialdehyde, the major aldehyde end products of membrane lipid
peroxidation, in liver samples from WT and c-myc mice (Fig.
2). In contrast, approximately 2-fold
higher levels of 4-HNE and malondialdehyde were present in
TGF- /c-myc livers compared with either age-matched WT or
c-myc mice. In addition, double transgenic livers exhibited
a greater sensitivity to collagenase perfusion and consistently yielded
3-5-fold less viable hepatocytes than age-matched WT controls, as
judged by cell counting and trypan blue exclusion (data not shown),
indicating altered membrane properties. Furthermore, by 10 weeks of
age, c-myc and TGF- /c-myc mice showed a 2- and
4-fold increase in the plasma levels of alanine aminotransferase, respectively (Fig. 3A),
apparently as a consequence of cumulative free radical cytotoxic
activity. In addition, double transgenic mice had higher plasma levels
of cholesterol (Fig. 3B) and triglyceride (not shown).
Histologically, TGF- /c-myc hepatocytes displayed signs of
"fatty liver" phenotype (Fig.
4B) further suggesting a
disorder in a lipid metabolism. Together, these data demonstrate that
co-expression of TGF- and c-myc transgenes in mouse liver results in the creation of an oxidative stress environment and tissue
damage starting at a very young age.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2.
Levels of lipid peroxidation in
c-myc and TGF- /c-myc livers. The data
were generated using the Calbiochem lipid peroxidation kit which assays
both malondialdehyde and 4-HNE. The data are shown as mean ± S.E., n = 5 in each age group. *p < 0.05 when compared with age-matched WT and c-myc mice by
Student's t test.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
Plasma concentration of alanine
aminotransferase (A) and cholesterol (B) in WT,
c-myc, and TGF- /c-myc mice. The data
are mean ± S.E., n = 5 in each age group of mice.
*p < 0.003 when compared with age-matched WT or
c-myc mice; **p < 0.02 when compared with
age-matched c-myc mice by Student's t
test.
|
|

View larger version (128K):
[in this window]
[in a new window]
|
Fig. 4.
TGF- /c-myc hepatocytes exhibit
signs of fatty liver phenotype. A, ultrastructure of
centrolobular hepatocyte from 10-week-old WT mouse; B,
double transgenic hepatocyte in the vicinity to central vein
(CV) shows increased lipid deposition (L).
Original magnification, × 4000.
|
|
Extensive Mitochondrial DNA Damage in Hepatocytes from
TGF- /c-myc Mice--
Since mtDNA is more sensitive to oxidative
damage than is nuclear DNA (40), we next assayed the effects of
increased ROS production on mtDNA damage. For this we used a PCR
approach and screened hepatic DNA for large 3821-bp mtDNA deletions
associated with direct sequence repeats normally present in aging mice
(36). Fig. 5 shows that this deletion was
undetectable in 5- and 10-week-old WT livers in the absence of
oxidative stress. In contrast, the deletion was readily detectable in
both c-myc and TGF- /c-myc mice as early as 5 weeks of age. The amount of deletion product was more extensive in the
TGF- /c-myc livers which produced higher levels of
peroxides (Fig. 1). The presence of early mtDNA damage did not
correlate with the loss of mitochondrial morphology. Electron microscopy showed no clear evidence of swelling or degeneration of
mitochondria in randomly examined TGF- /c-myc hepatocytes
at 10 weeks of age. However, double transgenic hepatocytes from
10-week-old mice contained frequent residual bodies or lipofuscin
granules and secondary lysosomes carrying various cytoplasmic
organelles (Fig. 6A and
B). These structures are found in large numbers in senescent
cells in vivo as well as in aging cells of diverse organisms and are recognized as morphological signs of aging (41, 42).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 5.
PCR detection of deletion in liver
mtDNA. Total hepatic DNAs from WT, c-myc and
TGF- /c-myc mice at 5 and 10 weeks of age were subjected
to PCR amplification and separated using a 1%
Tris-acetate-EDTA-agarose gel electrophoresis as described under
"Experimental Procedures." The position of PCR deletion product of
851 bp is indicated.
|
|

View larger version (186K):
[in this window]
[in a new window]
|
Fig. 6.
Ultrastructural manifestation of premature
aging in TGF- /c-myc transgenic hepatocytes from
10-week-old mouse. Tissue was processed for transmission electron
microscopy as described under "Experimental Procedures." Lipofuscin
granules are indicated by asterisks (A and
B), and the secondary lysosome (open
arrow)-containing remnant of mitochondria and fragment of lipid
(B) can be clearly seen within the cell. Mitochondrion is
indicated by a thin arrow. Original magnification, × 20,000.
|
|
Antioxidant Status Is Reduced in TGFa/c-myc Livers--
GSH plays
a central role in cellular defense against oxidative stress (43). GSH
regulates the intracellular concentration of ROS via reactions
catalyzed by GPx (44). We thus determined whether modulation of GSH
levels and activity of cytosolic GPx, the major glutathione peroxidase
isozyme present in liver (45), contribute to development of oxidative
stress in TGF- /c-myc livers. In WT mice, the amount of
cellular GSH was about 35% lower (p < 0.001) in
5-week-old than in 10-week-old livers (Fig.
7). These results indicate that the GSH
system is not fully developed in the maturing mouse livers at 5 weeks.
Both transgenic lines showed a similar pattern of expression of
cellular GSH during liver ontogenesis, but the amount of GSH was
consistently lower in the transgenic animals as compared with WT
controls (Fig. 7). In contrast, the activity of GPx, a key antioxidant
enzyme, was decreased only in TGF- /c-myc and not in
c-myc livers (Fig.
8A), concomitant with
elevation in lipid peroxidation (Fig. 2). It is noteworthy that there
was no significant difference in the activity of GPx in liver samples
from WT and c-myc mice of different ages. However, the
activity of GPx increased in TGF- /c-myc livers in an
age-dependent manner. This induction of GPx activity may be
an adaptive response to compensate for increased oxidative stress in
double transgenic livers consistent with reports in aging livers (46,
47). Interestingly, the tumors which developed in
TGF- /c-myc livers displayed very little GPx activity
(16% of peritumoral levels) (Fig. 8A). We next examined the
activity of thioredoxin reductase, a cellular selenocysteine-containing
protein (48) which together with thioredoxin and NADPH functions as a
powerful protein disulfide-reducing system (9, 49, 50). In contrast to
GPx, thioredoxin reductase activities in WT, c-myc, and
TGF- /c-myc mice were essentially the same. However,
hepatic tumors in TGF- /c-myc mice exhibited a marked
induction (about 30%) of thioredoxin reductase activity (Fig.
8B).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
Concentrations of total glutathione in the
livers of WT, c-myc, and TGF- /c-myc mice of
different age. Data are expressed as mean ± S.E.,
n = 5 mice in each group. *p < 0.01 when compared with age-matched WT or c-myc mice;
**p < 0.001 when compared with corresponding mice at 5 weeks of age by Student's t test.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 8.
Time course of changes in the activity of
glutathione peroxidase (A) and thioredoxin reductase
(B) in WT, c-myc, and TGF- /c-myc
mice. Data are means ± S.E. The liver samples in
A and B were from the same mice (five from each
age group). Six individual tumors along with peritumoral tissue were
obtained from 40-week-old TGF- /c-myc mice. A,
*p < 0.001 when compared with WT or c-myc
at 5 weeks of age; **p < 0.03 when compared with WT or
c-myc at 10 weeks of age. B, *p < 0.02 when compared with non-tumorous liver tissue by Student's
t test.
|
|
 |
DISCUSSION |
In the present study we have demonstrated that
TGF- /c-myc hepatocytes exhibit a striking increase in
intracellular peroxide production as estimated by the
peroxide-activated fluorescent dye DCFH-DA (32, 37, 38). The elevation
in ROS production was not an immediate outcome of TGF- and
c-myc transgene expression. The effect was not evident at 5 weeks of age but was typically observed by 10 weeks when the generation
of ROS was enhanced by 3- and 8-fold in c-myc and
TGF- /c-myc mice, respectively. This delayed effect might
reflect a persistent level of oxidative damage which overwhelms
constitutive cellular antioxidant defense mechanisms and eventually
results in oxidative stress and liver damage. Peroxidation of
unsaturated fatty acids in membrane phospholipids is one of the
multiple cytotoxic effects of oxidative stress (39). Consistent with
this, lipid peroxidation was approximately 2-fold higher in
TGF- /c-myc livers than in either WT or c-myc
livers. It has been reported that peroxidation of fatty acids in
membrane phospholipids leads to age-related alterations in various
physical properties of the plasma membrane (51). Therefore, an
increased presence of hydroperoxides may lead to oxidative damage and
account for the increased fragility of TGF- /c-myc
hepatocytes during cell isolation. In support of this, a dietary
supplementation with vitamin E, a chain reaction-breaking lipid-soluble
antioxidant, prevented excessive membrane damage during two-step
collagenase perfusion and restored both the overall yield and viability
of hepatocytes in 10-week-old TGF- /c-myc
mice.3 Of potential
importance is the observation that an elevation in lipid peroxidation,
one of the earliest quantitative markers of hepatic injury in
TGF- /c-myc model, was accompanied by a corresponding reduction in the activity of GPx. GPx plays an important role in
cellular antioxidant defense by reducing hydroperoxides, which otherwise can be converted to highly reactive hydroxyl radicals through
a metal-mediated Fenton reaction (52). It is noteworthy that the
activity of GPx was increased in older TGF- /c-myc mice possibly to counter a persistent oxidative stress. This is in agreement
with studies demonstrating an induction of GPx in aging rats (46, 47).
However, the hepatic tumors formed in the double transgenic mice
exhibited a considerable reduction in GPx activity. Loss of GPx
activity has been shown to be due to depression of enzyme biosynthesis
and occurred in parallel with suppression of phospholipid-hydroperoxide
glutathione peroxidase4 which
is involved in the degradation of products of the multiple lipoxygenases (44). The latter observation broadens the family of
possible oxidants to include a large variety of organic hydroperoxides, and points to the critical importance of hydroperoxide turnover in the
development of oxidative stress in TGF- /c-myc livers. In
addition, constitutive expression of GSH itself was slightly reduced in
TGF- /c-myc mice as well as in the c-myc mice.
The comparable decreases in GSH levels in both transgenic models
indicate that the rate of ROS generation is more critical than the
lowering of GSH levels as a determinant of the overall oxidized state
in the TGF- /c-myc hepatocytes. However, the finding of a
relatively small decrease in total hepatic GSH content might obscure a
substantial localized depletion in a sub-population of cells. This
possibility is supported by numerous observations related to the
TGF- /c-myc model. First, the livers of
TGF- /c-myc mice demonstrated a dysplastic phenotype in
the form of nuclear atypia and remarkable hypertrophy initially evident
in the pericentral regions of hepatic parenchyma where concentrations
of total reduced GSH are usually smaller (53). Second, up-regulation of
TGF- 1 and urokinase-type plasminogen activator gene
expression was detected in the centrolobular areas of hepatic
parenchyma (27) concurrent with increased ROS production in
TGF- /c-myc livers, although we do not know if these
phenomena are interdependent. There is evidence that oxidation might be a mechanism of inactivation of certain protease inhibitors including plasminogen activator inhibitor (54, 55) as well as activation of
latent TGF- 1 (56). On the other hand, the ability of
TGF- 1 to stimulate cellular production of
H2O2 in a variety of cell types (18-22),
including hepatocytes (23, 24, 57), has been well established.
Moreover, TGF- 1 has been reported to suppress the
expression of certain antioxidant enzymes such as catalase and
superoxide dismutases in rat hepatocytes (58). Taken together, these
findings suggest an involvement of ROS in the development of dysplasia,
the hallmark of early pathological changes in TGF- /c-myc livers. Of potential importance is the observation that 4-HNE, a
representative hydroxylalkenal formed during lipid peroxidation with a
wide spectrum of biological effects (39, 51, 59, 60), has been found to
induce the expression of both mRNA and TGF- 1 protein
in cells of macrophage lineage (61).
A close correlation exists between the degree of ROS overproduction and
occurrence of liver tumors in transgenic mice. The increase in the
cellular oxidative stress was more pronounced and sustained in
TGF- /c-myc than c-myc mice, consistent with our carcinogenic data (26, 27). Although constitutive expression of
c-myc alone was sufficient to increase intracellular ROS
albeit to a lesser extent, c-myc expression did not result
in increase in lipid peroxidation or specific chromosomal damage at 10 weeks (28). However, in the c-myc as well as
TGF- /c-myc livers, there were significantly increased
amounts of mtDNA deletion starting from 5 weeks of age. MtDNA is known
to be 10-15-fold more sensitive to oxidative damage than is nuclear
DNA (40, 62). Enhanced ROS generation and the progressive accumulation
of mtDNA damage have been increasingly described in aging rodent and
human livers as well in degenerating diseases associated with oxidative
liver damage (33, 63-69). Further characterization of double
transgenic hepatocytes showed the presence of lipofuscin granules, a
pigment ascribed to the aging process and thought to derive from lipid peroxidation (7). These observations suggest that increased ROS
generation in c-myc and TGF- /c-myc hepatocytes
may lead to premature oxidative damage of hepatic mtDNA. Although it
remains to be determined, it seems possible that overexpression of
TGF- transgene alone might also promote ROS production. However, a considerably lower level of chromosomal damage (28) and a longer latency of liver tumor development is observed in TGF- (31) and in
c-myc single transgenic mice (27). This suggests that co-expression of TGF- and c-myc transgenes might
synergistically augment ROS production and/or decrease the antioxidant
defense, resulting in the acceleration of carcinogenesis in
TGF- /c-myc double transgenic mice.
Importantly, TGF- /c-myc hepatocytes displayed both an
increased oxidant generation and a higher rate of cell proliferation than c-myc single transgenic mice (30, 70). The coupling of these two phenomena increases the risk of mutagenesis as well as
fixation and propagation of the mutation (71), and might be responsible
for the excessive chromosomal damage and acceleration of
hepatocarcinogenesis in TGF- /c-myc transgenic mice.
Indeed, by 2 months of age, TGF- /c-myc hepatocytes
displayed a wide spectrum of chromosomal abnormalities, including
chromosomal breaks, translocations, endoreduplication, and aneuploidy
(28), similar to effects of ionizing radiation. Moreover, enlarged
dysplastic TGF- /c-myc hepatocytes accumulated more severe
DNA damage concurrent with increases in DNA content and loss of
replicative potential (28-30). A similar senescence-like phenotype
characterized by growth cessation and marked cellular enlargement has
also been observed in cultured fibroblasts treated with
H2O2 (72-74). Furthermore,
H2O2 was capable of inducing complete growth
arrest and/or apoptosis depending on concentration (74). Interestingly,
dysplastic hepatocytes in TGF- /c-myc livers increased in
number after a period of rapid cell proliferation, underwent apoptosis
with a high frequency (27, 70) and exhibited a variety of morphological
and biochemical changes suggestive of oxidative damage. Thus, enhanced
ROS production in rapidly proliferating TGF- /c-myc
hepatocytes might contribute to neoplastic transformation as well as
development of the dysplastic phenotype, an important precursor of
cancer in this model. The source(s) of ROS generation in
c-myc and TGF- /c-myc remains to be determined
and appears to be multiple. Recent evidence suggests that in
nonphagocytic cells a plasma membrane-bound
H2O2-generating system exists that is linked to
the Ras family of small GTP-binding proteins and can function as a
universal effector system for growth factors, hormones and cytokines
(14, 16, 75-77). The work from our laboratory has demonstrated that
overexpression of c-myc in the mouse liver augmented the
number of the EGF receptors along with increase in tyrosine kinase
activity and increased transcription of endogenous TGF- (78). These
data suggest that higher constitutive levels of signaling through EGF
receptor may account for sustained mitogenic stimulation resulting in
an activation of endogenous pathways to propagate a free radical chain
reaction. The possibility that H2O2 might be a
naturally occurring intracellular product of the proliferative stimulus
provided by c-myc was recently discussed (79). Although it
cannot be determined conclusively from these studies, DNA damage could
be produced by hydroxyl radical and other oxidizing species such as
lipid hydroperoxides and hydrogen peroxides (59, 80, 81).
To our knowledge these studies provide the first biochemical evidence
that co-expression of TGF- and c-myc transgenes in mouse
livers results in overproduction of ROS. These data support the
hypothesis that chronic stimulation of cell proliferation in liver
facilitates the creation of an environment of oxidative stress leading
to massive DNA damage and acceleration of hepatocarcinogenesis in this
animal model. Further studies are necessary to elucidate the signaling
pathways that regulate ROS generation and the nature of the specific
ROS responsible for genetic damage.
 |
ACKNOWLEDGEMENTS |
We thank Vadim Gladyshev (University of
Nebraska) for helpful suggestions and collaboration, Galina E. Onishchenko, (Moscow State University, Russia) for performing electron
microscopic examinations, David Stephany (Flow Cytometry Section,
NIAID, National Institutes of Health) for guidance with flow cytometry
measurements, and Michael Jensen (Laboratory of Experimental
Carcinogenesis, NCI, National Institutes of Health) for help with
graphics.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: 37 Convent Drive
MSC4255, Bldg. 37, Rm. 3C28, National Cancer Institute, NIH, Bethesda,
MD 20892-4255. Tel.: 301-496-1935; Fax: 301-496-0734; E-mail:
snorri_thorgeirsson{at}nih.gov.
1
The abbreviations used are: ROS, reactive oxygen
species; DCFH-DA, 2,7'-dichlorofluorescin diacetate; EGF, epidermal
growth factor; Gpx, glutathione peroxidase; 4-HNE, hydroxylalkenals; TGF, transforming growth factor; WT, wild type; bp, base pair(s); PCR,
polymerase chain reaction; DCF, 2',7'-dichlorofluorescein.
2
L. M. Sargent, X. Zhou, C. L. Keck,
N. D. Sanderson, D. B. Zimonjic, N. C. Popescu, and
S. S. Thorgeirsson, manuscript in preparation.
3
V. M. Factor and S. S. Thorgeirsson,
unpublished observation.
4
V. N. Gladyshev, personal
communication.
 |
REFERENCES |
-
Cerutti, P. A.,
and Trump, B. F.
(1991)
Cancer Cells
3,
1-7[Medline]
[Order article via Infotrieve]
-
Dreher, D.,
and Junod, A. F.
(1996)
Eur. J. Cancer
32A,
30-38[CrossRef]
-
Chance, B.,
Sies, H.,
and Boveris, A.
(1979)
Physiol. Rev.
59,
527-605[Free Full Text]
-
Cerutti, P. A.
(1994)
Lancet
344,
862-863[CrossRef][Medline]
[Order article via Infotrieve]
-
Wiseman, H.,
and Halliwell, B.
(1996)
Biochem. J.
313,
17-29
-
Ames, B. N.,
and Shigenaga, M. K.
(1992)
Ann. N. Y. Acad. Sci.
663,
85-96[Medline]
[Order article via Infotrieve]
-
Martin, G. M.,
Austad, S. N.,
and Johnson, T. E.
(1996)
Nat. Genet.
13,
25-34[CrossRef][Medline]
[Order article via Infotrieve]
-
Suzuki, Y. J.,
Forman, H. J.,
and Sevanian, A.
(1997)
Free Radic. Biol. Med.
22,
269-285[CrossRef][Medline]
[Order article via Infotrieve]
-
Nakamura, H.,
Nakamura, K.,
and Yodoi, J.
(1997)
Annu. Rev. Immunol.
15,
351-369[CrossRef][Medline]
[Order article via Infotrieve]
-
Burdon, R. H.
(1995)
Free Radic Biol. Med.
18,
775-794[CrossRef][Medline]
[Order article via Infotrieve]
-
Krieger-Brauer, H. I.,
and Kather, H.
(1995)
Biochem. J.
307,
543-548
-
Sundaresan, M.,
Yu, Z. X.,
Ferrans, V. J.,
Irani, K.,
and Finkel, T.
(1995)
Science
270,
296-299[Abstract/Free Full Text]
-
Lo, Y. Y.,
and Cruz, T. F.
(1995)
J. Biol. Chem.
270,
11727-11730[Abstract/Free Full Text]
-
Sundaresan, M.,
Yu, Z. X.,
Ferrans, V. J.,
Sulciner, D. J.,
Gutkind, J. S.,
Irani, K.,
Goldschmidt-Clermont, P. J.,
and Finkel, T.
(1996)
Biochem. J.
318,
379-382
-
Bae, Y. S.,
Kang, S. W.,
Seo, M. S.,
Baines, I. C.,
Tekle, E.,
Chock, P. B.,
and Rhee, S. G.
(1997)
J. Biol. Chem.
272,
217-221[Abstract/Free Full Text]
-
Meier, B.,
Radeke, H. H.,
Selle, S.,
Younes, M.,
Sies, H.,
Resch, K.,
and Habermehl, G. G.
(1989)
Biochem. J.
263,
539-545[Medline]
[Order article via Infotrieve]
-
Goossens, V.,
Grooten, J.,
De Vos, K.,
and Fiers, W.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
8115-8119[Abstract/Free Full Text]
-
Das, S. K.,
and Fanburg, B. L.
(1991)
Am. J. Physiol.
261,
L249-L254[Abstract/Free Full Text]
-
Shibanuma, M.,
Kuroki, T.,
and Nose, K.
(1991)
Cell Growth Differ.
2,
583-591[Abstract]
-
Ohba, M.,
Shibanuma, M.,
Kuroki, T.,
and Nose, K.
(1994)
J. Cell Biol.
126,
1079-1088[Abstract/Free Full Text]
-
Thannickal, V. J.,
Hassoun, P. M.,
White, A. C.,
and Fanburg, B. L.
(1993)
Am. J. Physiol.
265,
L622-L626[Abstract/Free Full Text]
-
Thannickal, V. J.,
and Fanburg, B. L.
(1995)
J. Biol. Chem.
270,
30334-30338[Abstract/Free Full Text]
-
Sanchez, A.,
Alvarez, A. M.,
Benito, M.,
and Fabregat, I.
(1995)
J. Cell. Physiol.
165,
398-405[CrossRef][Medline]
[Order article via Infotrieve]
-
Sanchez, A.,
Alvarez, A. M.,
Benito, M.,
and Fabregat, I.
(1996)
J. Biol. Chem.
271,
7416-7422[Abstract/Free Full Text]
-
Luetteke, N. S.,
and Lee, D. C.
(1990)
Semin. Cancer Biol.
1,
265-276[Medline]
[Order article via Infotrieve]
-
Murakami, H.,
Sanderson, N. D.,
Nagy, P.,
Marino, P. A.,
Merlino, G.,
and Thorgeirsson, S. S.
(1993)
Cancer Res.
53,
1719-23[Abstract/Free Full Text]
-
Santoni-Rugiu, E.,
Nagy, P.,
Jensen, M. R.,
Factor, V. M.,
and Thorgeirsson, S. S.
(1996)
Am. J. Pathol.
149,
407-428[Abstract]
-
Sargent, L. M.,
Sanderson, N. D.,
and Thorgeirsson, S. S.
(1996)
Cancer Res.
56,
2137-2142[Abstract/Free Full Text]
-
Kao, C. Y.,
Factor, V. M.,
and Thorgeirsson, S. S.
(1996)
Biochem. Biophys. Res. Commun.
222,
64-70[CrossRef][Medline]
[Order article via Infotrieve]
-
Factor, V. M.,
Jensen, M. R.,
and Thorgeirsson, S. S.
(1997)
Hepatology
26,
1434-1443[CrossRef][Medline]
[Order article via Infotrieve]
-
Jhappan, C.,
Stahle, C.,
Harkins, R. N.,
Fausto, N.,
Smith, G. H.,
and Merlino, G. T.
(1990)
Cell
61,
1137-1146[CrossRef][Medline]
[Order article via Infotrieve]
-
Bass, D. A.,
Parce, J. W.,
Dechatelet, L. R.,
Szejda, P.,
Seeds, M. C.,
and Thomas, M.
(1983)
J. Immunol.
130,
1910-1917[Abstract]
-
Hagen, T. M.,
Yowe, D. L.,
Bartholomew, J. C.,
Wehr, C. M.,
Do, K. L.,
Park, J. Y.,
and Ames, B. N.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
3064-3069[Abstract/Free Full Text]
-
Sharrow, S. O.
(1991)
in
Current Protocols in Immunology (Coligan, J. E., Kruisbeek, A. M., Margulies, D. H., Shevach, E. M., and Strober, W., eds), pp. 5.2.1-5.2.10, Wiley-Interscience, New York
-
Tamura, T.,
and Stadtman, T. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
1006-1011[Abstract/Free Full Text]
-
Tanhauser, S. M.,
and Laipis, P. J.
(1995)
J. Biol. Chem.
270,
24769-24775[Abstract/Free Full Text]
-
Cathcart, R.,
Schwiers, E.,
and Ames, B. N.
(1983)
Anal. Biochem.
134,
111-116[CrossRef][Medline]
[Order article via Infotrieve]
-
Royall, J. A.,
and Ischiropoulos, H.
(1993)
Arch. Biochem. Biophys.
302,
348-355[CrossRef][Medline]
[Order article via Infotrieve]
-
Esterbauer, H.,
Schaur, R. J.,
and Zollner, H.
(1991)
Free Radic. Biol. Med.
11,
81-128[CrossRef][Medline]
[Order article via Infotrieve]
-
Lee, C. M.,
Weindruch, R.,
and Aiken, J. M.
(1997)
Free Radic. Biol. Med.
22,
1259-1269[CrossRef][Medline]
[Order article via Infotrieve]
-
Brunk, U. T.,
and Collins, V. P.
(1981)
in
Age Pigments (Sohal, R. S., ed), pp. 243-264, Elsevier/North Holland Biomedical Press, Elsevier, Amsterdam
-
Rubin, H.,
Chow, M.,
and Yao, A.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
1825-1830[Abstract/Free Full Text]
-
Halliwell, B.,
and Gutteridge, J. M.
(1990)
Methods Enzymol.
186,
1-85[CrossRef][Medline]
[Order article via Infotrieve]
-
Ursini, F.,
Maiorino, M.,
Brigelius-Flohe, R.,
Aumann, K. D.,
Roveri, A.,
Schomburg, D.,
and Flohe, L.
(1995)
Methods Enzymol.
252,
38-53[Medline]
[Order article via Infotrieve]
-
Frampton, J.,
Conkie, D.,
Chambers, I.,
McBain, W.,
Dexter, M.,
and Harrison, P.
(1987)
Nucleic Acids Res.
15,
3671-3688[Abstract/Free Full Text]
-
Ji, L. L.,
Dillon, D.,
and Wu, E.
(1990)
Am. J. Physiol.
258,
R918-R923[Abstract/Free Full Text]
-
Powers, S. K.,
Lawler, J.,
Criswell, D.,
Lieu, F. K.,
and Martin, D.
(1992)
J. Appl. Physiol.
72,
1068-1073[Abstract/Free Full Text]
-
Gladyshev, V. N.,
Jeang, K.-T.,
and Stadtman, T. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
6146-6151[Abstract/Free Full Text]
-
Holmgren, A.,
and Bjornstedt, M.
(1995)
Methods Enzymol.
252,
199-208[CrossRef][Medline]
[Order article via Infotrieve]
-
Bjornstedt, M.,
Kumar, S.,
Bjorkhem, L.,
Spyrou, G.,
and Holmgren, A.
(1997)
Biomed. Environ. Sci.
10,
271-279[Medline]
[Order article via Infotrieve]
-
Choe, M.,
Jackson, C.,
and Yu, B. P.
(1995)
Free Radic. Biol. Med.
18,
977-984[CrossRef][Medline]
[Order article via Infotrieve]
-
Ahmad, S.
(1995)
in
Oxidative Stress and Antioxidant Defenses in Biology (Ahmad, S., ed), pp. 238-272, Chapman & Hall, New York
-
DeLeve, L. D.,
and Kaplowitz, N.
(1991)
Pharmacol. Ther.
52,
287-305[CrossRef][Medline]
[Order article via Infotrieve]
-
Johnson, D.,
and Travis, J.
(1979)
J. Biol. Chem.
254,
4022-4026[Free Full Text]
-
Swaim, M. W.,
and Pizzo, S. V.
(1988)
J. Leukoc. Biol.
43,
365-379[Abstract]
-
Barcellos-Hoff, M. H.,
and Dix, T. A.
(1996)
Mol. Endocrinol.
10,
1077-1083[Abstract/Free Full Text]
-
Sanchez, A.,
Alvarez, A. M.,
Benito, M.,
and Fabregat, I.
(1997)
Hepatology
26,
935-943[CrossRef][Medline]
[Order article via Infotrieve]
-
Kayanoki, Y.,
Fujii, J.,
Suzuki, K.,
Kawata, S.,
Matsuzawa, Y.,
and Taniguchi, N.
(1994)
J. Biol. Chem.
269,
15488-15492[Abstract/Free Full Text]
-
Dianzani, M. U.
(1993)
Crit. Rev. Oncol. Hematol.
15,
125-147[Medline]
[Order article via Infotrieve]
-
Newman, M. J.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5543-5547[Abstract/Free Full Text]
-
Leonarduzzi, G.,
Scavazza, A.,
Biasi, F.,
Chiarpotto, E.,
Camandola, S.,
Vogel, S.,
Dargel, R.,
and Poli, G.
(1997)
FASEB J.
11,
851-857[Abstract]
-
Shigenaga, M. K.,
Hagen, T. M.,
and Ames, B. N.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
10771-10778[Abstract/Free Full Text]
-
Yen, T. C.,
King, K. L.,
Lee, H. C.,
Yeh, S. H.,
and Wei, Y. H.
(1994)
Free Radic. Biol. Med.
16,
207-214[CrossRef][Medline]
[Order article via Infotrieve]
-
Sastre, J.,
Pallardo, F. V.,
Pla, R.,
Pellin, A.,
Juan, G., JE, O. C.,
Estrela, J. M.,
Miquel, J.,
and Vina, J.
(1996)
Hepatology
24,
1199-1205[CrossRef][Medline]
[Order article via Infotrieve]
-
Filser, N.,
Margue, C.,
and Richter, C.
(1997)
Biochem. Biophys. Res. Commun.
233,
102-107[CrossRef][Medline]
[Order article via Infotrieve]
-
Cahill, A.,
Wang, X.,
and Hoek, J. B.
(1997)
Biochem. Biophys. Res. Commun.
235,
286-290[CrossRef][Medline]
[Order article via Infotrieve]
-
Mansouri, A.,
Gaou, I.,
Fromenty, B.,
Berson, A.,
Letteron, P.,
Degott, C.,
Erlinger, S.,
and Pessayre, D.
(1997)
Gastroenterology
113,
599-605[CrossRef][Medline]
[Order article via Infotrieve]
-
Mansouri, A.,
Fromenty, B.,
Berson, A.,
Robin, M. A.,
Grimbert, S.,
Beaugrand, M.,
Erlinger, S.,
and Pessayre, D.
(1997)
J. Hepatol.
27,
96-102[CrossRef][Medline]
[Order article via Infotrieve]
-
Fromenty, B.,
Grimbert, S.,
Mansouri, A.,
Beaugrand, M.,
Erlinger, S.,
Rotig, A.,
and Pessayre, D.
(1995)
Gastroenterology
108,
193-200[CrossRef][Medline]
[Order article via Infotrieve]
-
Santoni-Rugiu, E.,
Jensen, M. R.,
and Thorgeirsson, S. S.
(1998)
Cancer Res.
58,
123-134[Abstract/Free Full Text]
-
Ames, B. N.,
and Gold, L. S.
(1991)
Prog. Clin. Biol. Res.
369,
1-20
-
Chen, Q.,
and Ames, B. N.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4130-4134[Abstract/Free Full Text]
-
de Haan, J. B.,
Cristiano, F.,
Iannello, R.,
Bladier, C.,
Kelner, M. J.,
and Kola, I.
(1996)
Hum. Mol. Genet.
5,
283-292[Abstract/Free Full Text]
-
Bladier, C.,
Wolvetang, E. J.,
Hutchinson, P.,
de Haan, J. B.,
and Kola, I.
(1997)
Cell Growth. Differ.
8,
589-598[Abstract]
-
Meier, B.,
Jesaitis, A. J.,
Emmendorffer, A.,
Roesler, J.,
and Quinn, M. T.
(1993)
Biochem. J.
289,
481-486
-
Jones, S. A.,
Wood, J. D.,
Coffey, M. J.,
and Jones, O. T.
(1994)
FEBS Lett.
355,
178-182[CrossRef][Medline]
[Order article via Infotrieve]
-
Krieger-Brauer, H. I.,
Medda, P. K.,
and Kather, H.
(1997)
J. Biol. Chem.
272,
10135-10143[Abstract/Free Full Text]
-
Woitach, J. T.,
Conner, E. A.,
Wirth, P. J.,
and Thorgeirsson, S. S.
(1997)
J. Cell. Biochem.
64,
651-660[CrossRef][Medline]
[Order article via Infotrieve]
-
Xu, Y.,
Nguyen, Q.,
Lo, D. C.,
and Czaja, M. J.
(1997)
J. Cell. Physiol.
170,
192-199[CrossRef][Medline]
[Order article via Infotrieve]
-
Halliwell, B.,
and Aruoma, O. I.
(1991)
FEBS Lett.
281,
9-19[CrossRef][Medline]
[Order article via Infotrieve]
-
Retel, J.,
Hoebee, B.,
Braun, J. E.,
Lutgerink, J. T.,
van den Akker, E.,
Wanamarta, A. H.,
Joenje, H.,
and Lafleur, M. V.
(1993)
Mutat. Res.
299,
165-182[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. S.Y. Cheung, J. T. Brooling, M. M. Johnson, K. J. Riehle, J. S. Campbell, and N. Fausto
Interactions between MYC and transforming growth factor alpha alter the growth and tumorigenicity of liver progenitor cells
Carcinogenesis,
December 1, 2007;
28(12):
2624 - 2631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takami, P. Kaposi-Novak, K. Uchida, L. E. Gomez-Quiroz, E. A. Conner, V. M. Factor, and S. S. Thorgeirsson
Loss of Hepatocyte Growth Factor/c-Met Signaling Pathway Accelerates Early Stages of N-nitrosodiethylamine Induced Hepatocarcinogenesis
Cancer Res.,
October 15, 2007;
67(20):
9844 - 9851.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ray, K. R. Atkuri, D. Deb-Basu, A. S. Adler, H. Y. Chang, L. A. Herzenberg, and D. W. Felsher
MYC Can Induce DNA Breaks In vivo and In vitro Independent of Reactive Oxygen Species.
Cancer Res.,
July 1, 2006;
66(13):
6598 - 6605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. L. Kinnula, C. L. Fattman, R. J. Tan, and T. D. Oury
Oxidative Stress in Pulmonary Fibrosis: A Possible Role for Redox Modulatory Therapy
Am. J. Respir. Crit. Care Med.,
August 15, 2005;
172(4):
417 - 422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. F. Calvisi and S. S. Thorgeirsson
Molecular Mechanisms of Hepatocarcinogenesis in Transgenic Mouse Models of Liver Cancer
Toxicol Pathol,
January 1, 2005;
33(1):
181 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. G. Cavin, M. Venkatraman, V. M. Factor, S. Kaur, I. Schroeder, F. Mercurio, A. A. Beg, S. S. Thorgeirsson, and M. Arsura
Regulation of {alpha}-Fetoprotein by Nuclear Factor-{kappa}B Protects Hepatocytes from Tumor Necrosis Factor-{alpha} Cytotoxicity during Fetal Liver Development and Hepatic Oncogenesis
Cancer Res.,
October 1, 2004;
64(19):
7030 - 7038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Felix, A. Polack, W. Pretsch, S. H. Jackson, L. Feigenbaum, G.-W. Bornkamm, and S. Janz
Moderate Hypermutability of a Transgenic lacZ Reporter Gene in Myc-Dependent Inflammation-Induced Plasma Cell Tumors in Mice
Cancer Res.,
January 15, 2004;
64(2):
530 - 537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Nicholes, S. Guillet, E. Tomlinson, K. Hillan, B. Wright, G. D. Frantz, T. A. Pham, L. Dillard-Telm, S. P. Tsai, J.-P. Stephan, et al.
A Mouse Model of Hepatocellular Carcinoma : Ectopic Expression of Fibroblast Growth Factor 19 in Skeletal Muscle of Transgenic Mice
Am. J. Pathol.,
June 1, 2002;
160(6):
2295 - 2307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bravard, A. Ageron-Blanc, S. Alvarez, P. Drane, Y. le Rhun, F. Paris, C. Luccioni, and E. May
Correlation between antioxidant status, tumorigenicity and radiosensitivity in sister rat cell lines
Carcinogenesis,
May 1, 2002;
23(5):
705 - 711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yang, H. Z. Lin, J. Hwang, V. P. Chacko, and A. M. Diehl
Hepatic Hyperplasia in Noncirrhotic Fatty Livers: Is Obesity-related Hepatic Steatosis a Premalignant Condition?
Cancer Res.,
July 1, 2001;
61(13):
5016 - 5023.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. B. Meira, S. Devaraj, G. E. Kisby, D. K. Burns, R. L. Daniel, R. E. Hammer, S. Grundy, I. Jialal, and E. C. Friedberg
Heterozygosity for the Mouse Apex Gene Results in Phenotypes Associated with Oxidative Stress
Cancer Res.,
July 1, 2001;
61(14):
5552 - 5557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Schmelz, V. J. Schmid, and A. R. Parrish
Selective Disruption of Cadherin/Catenin Complexes by Oxidative Stress in Precision-Cut Mouse Liver Slices
Toxicol. Sci.,
June 1, 2001;
61(2):
389 - 394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. J. Thannickal and B. L. Fanburg
Reactive oxygen species in cell signaling
Am J Physiol Lung Cell Mol Physiol,
December 1, 2000;
279(6):
L1005 - L1028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Rahman and W. MacNee
Lung glutathione and oxidative stress: implications in cigarette smoke-induced airway disease
Am J Physiol Lung Cell Mol Physiol,
December 1, 1999;
277(6):
L1067 - L1088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Kampranis, R. Damianova, M. Atallah, G. Toby, G. Kondi, P. N. Tsichlis, and A. M. Makris
A Novel Plant Glutathione S-Transferase/Peroxidase Suppresses Bax Lethality in Yeast
J. Biol. Chem.,
September 15, 2000;
275(38):
29207 - 29216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. M. Factor, D. Laskowska, M. R. Jensen, J. T. Woitach, N. C. Popescu, and S. S. Thorgeirsson
Vitamin E reduces chromosomal damage and inhibits hepatic tumor formation in a transgenic mouse model
PNAS,
February 29, 2000;
97(5):
2196 - 2201.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|