![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 27, 17086-17094, July 3, 1998
From the Section on Molecular Neuroscience, Laboratory of Cellular
and Molecular Regulation, National Institute of Mental Health,
Bethesda, Maryland 20892-4090
Vasoactive intestinal peptide (VIP) is a
neuromodulator expressed with great anatomical specificity throughout
the nervous system. Cell-specific expression of the VIP gene is
mediated by a tissue specifier element (TSE) located within a
2.7-kilobase (kb) region between VIP1 is distributed
throughout the central and peripheral nervous systems and functions as
a neuromodulator, growth regulator, and neuroendocrine releasing factor
(1, 2). It is a 28-amino acid peptide that is processed from a larger
precursor peptide that also encodes a second VIP-like peptide called
PHI in rodents and PHM in humans (3). VIP is found in high
concentrations in specific regions of the brain including cerebral
cortex, hypothalamus, and hippocampus (4), and in the peripheral
nervous system in cholinergic and sensory nerves (5). VIP is a
co-transmitter mediating vasodilatation in the brain, gut, and other
organs. VIP is also expressed in the anterior pituitary and functions in the regulation of endocrine homeostasis (2, 6). An important role
for VIP in development is suggested by striking growth regulatory effects of exogenously administered VIP during mouse embryogenesis (7).
The anatomical and temporal specificity of VIP expression throughout
the neuroendocrine axis is therefore critical to neuronal function and
endocrine homeostasis. Understanding how this specificity is obtained,
at the level of the cis-acting sequences of the VIP gene itself, should
provide experimental access to the trans-acting factors that interact
with these sequences, and ultimately to the signal transduction
pathways that developmentally and physiologically link VIP gene
expression within VIPergic cells with the extracellular environment.
We have relied on neuroblastoma cell lines, subclones of which
recapitulate various aspects of VIP gene regulation in vivo (8-10), to study the mechanism of cell-specific regulation of the VIP
gene underlying its anatomically precise expression in vivo.
Subclones from the SK-N-SH neuroblastoma cell line have been
characterized with respect to cell type-specific modes of basal and
inducible regulation of the VIP gene. In particular, the SH-EP subline
constitutively expresses high levels of VIP mRNA (10, 11). Using
VIP-luciferase reporter constructs in transient expression assays, we
have previously shown that cell type-specific expression of the VIP
gene in SH-EP cells requires at least two different cis-acting
sequences within the VIP 5'-flanking region. An upstream
tissue-specifier element (TSE) located between We hypothesized that additional elements in the VIP gene might be
required for full tissue-specific gene expression directed by the TSE.
Stepwise deletion of domains of the VIP gene between the TSE and the
promoter proximal CRE, and assay of cell-specific transcription in
SH-EP versus HeLa cells, now show this hypothesis to be
correct. Cell type-specific expression of the VIP gene requires combinatorial effects from multiple cis-acting sequences that both
repress transcriptional activity of the TSE in HeLa cells, and enhance
its activity in SH-EP cells.
Materials--
Cell culture reagents, LipofectAMINE, and
synthetic oligonucleotides were obtained from Life Technologies, Inc.
(Gaithersburg, MD), fetal bovine serum from BioWhittaker (Walkersville,
MD), and culture plates from Costar Corp. (Cambridge, MA). pGL3
vectors, pGEM vectors, luciferase assay reagents, reporter lysis
buffers, and core footprinting kits were purchased from Promega Corp.
(Madison, WI). DNA ligation kit was from Boehringer Mannheim Corp.
(Indianapolis, IN). Sequencing reagents were purchased from U. S. Biochemical Corp. and Sequagel-6 ready to use 6% sequencing gel
solutions were from National Diagnostics (Atlanta, GA). Oct-1 and Oct-2 supershift antibodies were from Santa Cruz Biotechnology Inc. (Santa
Cruz, CA).
Cell Culture--
SH-EP neuroblastoma cells and HeLa cells were
cultured in Dulbecco's modified Eagle's medium with 4.5 g of
glucose per liter, containing 10% fetal bovine serum
(heat-inactivated) supplemented with glutamine (0.03%), penicillin
(100 units/ml), and streptomycin (100 µg/ml). Cells were maintained
in a humidified 95% air, 5% carbon dioxide atmosphere. Culture medium
was changed every 3-4 days to a fresh medium and SH-EP cells were
subcultured before the cells reach approximately 70% confluency.
Construction of VIP-Luciferase Reporter Plasmids--
The
methods used to construct VIP-luciferase reporter plasmids were
essentially as described previously (11). All VIP-luciferase reporter
constructs contained the first exon, the first intron, and the second
exon extending to the first codon of the human VIP gene fused to the
luciferase coding sequence of the pGL3-basic vector, in addition to
various regions of 5' flank of the VIP gene. The promoter proximal 251 nucleotides upstream of the VIP transcription initiation site, which
includes the minimal VIP promoter and the VIP-CRE, demonstrated
previously to be required for full cell-specific as well as inducible
expression in SH-EP and SK-N-SH cells is designated domain e
in Fig. 1. To this minimal VIP gene was fused various segments
b-d of the VIP gene lying between the TSE (designated
a in Fig. 1) and the proximal promoter e. These
constructs were assayed for transcriptional activity as described
below, both with and without the TSE fused to the 5'-end of the
recombinant transcriptional unit. The minimal TSE ( Transient Expression Assays--
SH-EP and HeLa cells were
transfected as described previously (11) with some modifications. Cells
were seeded in Costar 12-well tissue culture plates at densities of
8 × 104 and 1 × 105 cells/well for
SH-EP and HeLa cells, respectively, in 1.0 ml of culture medium. Cells
were allowed to grow to approximately 60-70% confluency and
transfected with 0.5 µg of DNA and 3.0 µl of LipofectAMINE
polycationic liposome reagent/well for 5 h in 1 ml of serum-free
medium. After transfection, medium was removed and replaced with
complete medium. Cells were incubated for an additional 36-40 h before
they were harvested in 200 µl of the reporter lysis buffer. For the
luciferase assay, 20 µl of cell lysate was mixed with 100 µl of the
luciferase substrate and light units were counted for 20 s using a
luminometer (Lumat LB9501, Berthold).
In Vitro Footprinting Analysis--
SH-EP and HeLa cell nuclear
extracts were prepared according to Ausubel et al. (13).
Fragments of DNA used in the footprinting analysis represent different
parts of the 425-bp TSE sequence covering each of the two 9-bp AT-rich
sequences (nucleotides Site-directed Mutagenesis--
Site-directed mutagenesis was
carried out using the Sculptor in vitro mutagenesis system
(Amersham Corp.). Single-stranded template DNA was produced from
pBluescript II KS(+) phagemid (Stratagene, La Jolla, CA) in which the
425-bp VIP TSE fragment (from PstI to PstI) was
subcloned. Single-stranded DNA was made using the Escherichia
coli host strain XL1-blue and helper phage VCS M13 by standard
procedures (15). The mutagenic primers contain 4 base substitutions
within the 9-bp AT-rich sequences: upstream AT-rich sequence mutagenic
primer (Attt-1/m4)
CCCTACATAAACCATGTAgcaTgCATCTGTCAACAAATTGGC; downstream
AT-rich sequence mutagenic primer (Attt-2/m4)
GGTTAATTTCTGGAAgcTTgCAgTAATGTTTTCAGACTGCTG. The AT-rich
Oct-1-like 9 bases are underlined with mutated bases written in
lowercase.
Electrophoretic Mobility Shift Assay--
SH-EP and HeLa cell
nuclear extracts were prepared according to Schreiber et al.
(16) with minor modifications. Cells were grown in T150 flasks until
they reached approximately 65% confluency. Cells grown in two T150
flasks were collected and resuspended in 1.2 ml of cold buffer A (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM
EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 5 µg/ml aprotinin, and
2 µg/ml pepstatin). Cells were allowed to swell on ice for 25 min and
75 µl of 10% Nonidet P-40 was added. Cell homogenate was spun in a
Microfuge (maximum speed 16,000 × g) for 30 s,
and the nuclear pellet was resuspended in 150 µl of ice-cold buffer C
(20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM
dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml aprotinin, and 2 µg/ml pepstatin). Nuclear proteins were
extracted on ice by vigorously shaking on a rocker for 30 min. The
extract was centrifuged at 16,000 × g for 5 min at
4 °C and the supernatant which contains the nuclear proteins was
transferred to a fresh tube. Protein concentrations were determined by
Bio-Rad protein assay, according to the manufacturer's protocol, and
nuclear extracts were frozen by submerging in liquid nitrogen and
stored at We have previously shown from a deletional analysis that sequences
within the region
Five Discrete Cis-active Domains Direct Cell Type-specific
Transcription of the Vasoactive Intestinal Peptide (VIP) Gene*
and
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
5.2 and
2.5 kb upstream from the
transcription start site, and requires an intact promoter proximal
VIP-CRE (cyclic AMP-responsive element) (Hahm, S. H., and Eiden,
L. E. (1997) J. Neurochem. 67, 1872-1881). We
now report that the TSE comprises a 425-base pair domain located
between
4.7 and
4.2 kb containing two AT-rich octamer-like
sequences. The 425-base pair TSE is sufficient to provide full
cell-specific regulation of the VIP gene, when fused to the 5' proximal
1.55 kb of the VIP gene. Mutational analysis and gel shift assays of
these octamer-like sequences indicate that the binding of proteins
related to the ubiquitously expressed POU-homeodomain proteins Oct-1
and/or Oct-2 to these octamer-like sequences plays a central role for
the function of the TSE. The TSE interacts with three additional
discrete domains besides the cAMP response element, which are located
within the proximal 1.55 kb of the VIP gene, to provide cell-specific
expression. An upstream domain from
1.55 to
1.37 kb contains
E-boxes and MEF2-like motifs, and deletion of this domain results in
complete abrogation of cell-specific transcriptional activity. The
region from
1.37 to
1.28 kb contains a STAT motif, and further
removal of this domain allows the upstream TSE to act as an enhancer in
both SH-EP and HeLa cells. The sequence from
1.28 to
0.9 kb
containing a non-canonical AP-1 binding sequence (Symes, A., Gearan,
T., Eby, J., and Fink, J. S. (1997) J. Biol. Chem.
272, 9648-9654), is absolutely required for
TSE-dependent cellspecific expression of the VIP gene.
Thus, five discrete domains of the VIP gene provide a combination of
enhancer and repressor activities, each completely contingent on
VIP gene context, that together result in cell-specific transcription
of the VIP gene.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
4.6 and
4.0 kb from
the transcription start site was absolutely required for a cell
type-specific expression of the VIP gene. A deletion in this region
abolished high level expression of the reporter gene in SH-EP cells
(11). Inactivation of a 17-bp promoter proximal element (the VIP-CRE),
originally defined by its ability to mediate cAMP-dependent
induction of the VIP gene (12), caused an approximately 60% decrease
in the level of expression of the reporter gene in SH-EP cells (11),
indicating that the upstream TSE cannot fully direct cell-specific
expression of the VIP gene without the participation of the
promoter-proximal CRE.
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
4,656 to
4,231
bp) was defined by both 5' and 3' progressive deletions of the
5.2 to
2.5 HindIII fragment previously shown to be required for
cell-specific expression of VIP (10) fused to the VIP
0.094 minimal
promoter-enhancer and transfected into SH-EP cells.
4546 to
4231 and
4394 to
4231,
respectively). Each DNA fragment used as a probe was first
dephosphorylated using calf intestine alkaline phosphatase (Boehringer
Mannheim) and 32P-end-labeled using T4 polynucleotide
kinase in the presence of [
-32P]ATP (3000 Ci/mmol) and
purified from a 1.5% agarose gel using the Qiaquick gel purification
kit (Qiagen, Inc., Chatsworth, CA). DNase I protection was performed
according to the method of Ohlsson and Edland (14), with minor
modifications. Instead of poly(dI-dC) or calf thymus DNA, fragmented
herring sperm DNA was used. Approximately 1-2 ng (10,000 cpm) of
labeled probe was used in each reaction and mixed with either no
protein or with 100 or 185 µg of SH-EP nuclear extract or 100 µg of
HeLa nuclear extract. DNase I digestion was carried out at room
temperature for 1 min using RQ1 DNase I (Promega, Madison, WI).
Maxam-Gilbert sequencing for A + G residues was carried out as
described in Ref. 15.
70 °C in small aliquots. Synthetic oligonucleotides were
annealed and labeled using [
-32P]ATP by T4
polynucleotide kinase. Approximately 100,000 cpm of probe (~1.0 ng)
was mixed with 10 µg of SH-EP or HeLa nuclear extract in a total
volume of 10 µl containing 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM
dithiothreitol, 50 mM NaCl, 10 mM Tris-HCl (pH
7.5), and 50 µg/ml poly(dI-dC). Samples were incubated at room
temperature for 20 min and loaded onto a 3.75% polyacrylamide gel in
0.5 × TBE (22 mM Tris-HCl, pH 8.3, 22 mM
boric acid, 0.6 mM EDTA). Gels were pre-electrophoresed at
100 V for 1-2 h and electrophoresed at 300 V for approximately
1.5 h at 7 °C. Gels were dried and autoradiographed. For
supershift assays, 2 µl of TransCruz Oct-1 or Oct-2 antibody was
added to the binding reaction. Oligonucleotides used for the VIP gene
upstream and downstream AT-rich sequences were: CATGTATTTTCCATCTGTCA
and CTGGAATTTTCCATTAATGT (and their 3'
5' complements),
respectively. SP1 consensus oligonucleotide used as a nonspecific
competitor was ATTCGATCGGGGCGGGGCGAGC and its 3'
5' complement.
![]()
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
5.2 to
2.5 kb upstream from the transcription start site of the human VIP gene are absolutely required for
cell-specific expression of a VIP-luciferase reporter gene in SH-EP
neuroblastoma cells (11). A 425-bp sequence (referred to here as the
VIP tissue-specifier element, or TSE), spanning two PstI
sites located at
4,656 bp and
4,231 bp from the start of
transcription (Fig. 1), completely recapitulated cell-specific transcription imparted by the 2.7 kb of
upstream sequence between
5.2 and
2.5 kb, when fused directly to
2.5 kb of the VIP gene 5' flank (Fig. 2).
Thus, fusion of the 425-bp TSE to the VIP2.5 construct, which is itself
a very weak promoter/enhancer in both SH-EP and HeLa cells, resulted in
an ~37-fold increase in transcription in SH-EP cells, with only a marginal increase in expression (~2-fold) in HeLa cells. Therefore, the 425-bp TSE behaves as a cell-specific enhancer, when placed in
front of the VIP2.5, capable of fully restoring maximum expression of
the reporter gene in VIP-expressing cells.

View larger version (23K):
[in a new window]
Fig. 1.
Structure of the human VIP gene 5'-flanking
sequences. Schematic representation of the VIP gene 5'-flanking
sequences including domains of the DNA (a-e) that are
required for cell-specific expression of the VIP gene. Some of the
sequence elements (Oct-1, Oct-2, and VIP-CRE) are directly involved in
cell-specific expression, as described in this or a previous report
(11). The region between
1.55 and
.251 kb, that could be subdivided
into three subdomains, also plays an important role in cell-specific
expression of the VIP gene. Some of the putative sequence elements
located within this region of the DNA that may play a role in
cell-specific expression of the VIP gene are shown. The 180-bp
cytokine-responsive element (CyRE (20, 34, 36)) is shown to
be contained within domains c and d. A
non-canonical AP-1 site (21) is contained in the 5' portion of region
d, referred to here as d' (
1.28 to
.904
kb).

View larger version (30K):
[in a new window]
Fig. 2.
Effect of the 425-bp TSE of the VIP gene on
reporter gene expression. Transient expression assays were done in
SH-EP human neuroblastoma cells using VIP-luciferase reporter
constructs in which 5.2 and 2.5 kb of the VIP 5' gene flank (VIP5.2 and
VIP2.5, respectively (11)) are fused to the luciferase expression
vector pGL3-basic. The VIP2.5-TSE construct contains a 425-bp TSE
fragment subcloned in front of the VIP2.5 constructs. SH-EP cells were
transfected for 5 h using LipofectAMINE and harvested 40 h
after transfection for the luciferase assay. The results are expressed
as mean ± S.E.M. of light units per extract aliquot (see
"Experimental Procedures") from triplicate wells. Experiments were
repeated twice with similar results.
The 425-bp TSE contains two 9-nucleotide AT-rich sequences homologous to the Oct-1-binding site found within the neuron-specific enhancer domain of the human gonadotropin releasing hormone (GnRH) gene (17). Fig. 3 compares the 9-base sequences of the VIP TSE with the Oct-1-binding site of the GnRH gene, the consensus octamer sequence, and Pit-1 binding sites found in some other genes. The 9-bp AT-rich sequence of the human VIP gene differs from the Oct-1 binding sequence of the GnRH gene by only 1 nucleotide (ATTTTCCAT versus ATTTTACAT), and matches the overall consensus of Pit-1, (A/T)4TNCAT (18).
|
Mutations in either of the AT-rich sequences of the VIP gene significantly decreased reporter gene expression, suggesting that both of these AT-rich sequences are required for cell-specific expression of the VIP gene. The results in Fig. 4 show that while the TSE can fully recapitulate cell-specific expression when fused 5' to 1.55 kb of the VIP gene 5' flank (VIP1.55-TSE), mutating four nucleotides within the upstream AT-rich sequence of the TSE (VIP1.55-Attt1.m4 construct) caused an approximately 50% decrease in the effect of the TSE. Similar 4-base mutations in the downstream AT-rich sequence (VIP1.55-Attt2.m4 construct) decreased the level of reporter gene expression driven by the TSE by approximately 80% in SH-EP cells. Also, a deletion of 93 bp from the 3' region of the TSE that removes the downstream AT-rich sequence (VIP1.55-TSE.A2 construct) caused a more than 80% decrease in transcription. These results indicate that both of the AT-rich sequences play an important role for the function of the TSE.
|
Electrophoresis mobility shift assays were performed using synthetic oligonucleotides spanning each of the AT-rich repeats of the VIP gene, to investigate nuclear proteins that interact with these sequences. The Attt-2 probe, spanning the downstream 9-base AT-rich sequence of the VIP gene, produced multiple complexes with both SH-EP and HeLa nuclear proteins (Fig. 5). Formation of these complexes was specific as a 100-fold molar excess of an unrelated SP-1 consensus oligonucleotide failed to compete with the wild type Attt-2 probe. Addition of an Oct-1 or an Oct-2 antibody in the binding reaction caused a supershift of the bands marked as Oct-1 and Oct-2, respectively. Unlabeled oligonucleotide spanning the upstream AT-rich repeat (Attt-1) competed with labeled Attt-2 for binding in those complexes supershifted with an Oct-1 antibody. Attt-1 did not compete with labeled Attt-2 binding in those complexes recognized by an Oct-2 antibody. Likewise, an Oct-1 consensus oligonucleotide specifically competed for the formation of the complex with Attt-2 that is supershifted with Oct-1 antibody, and not the complex recognized by the Oct-2 antibody (Fig. 5). These Oct-1 and Oct-2 complexes were observed in both SH-EP and HeLa nuclear preparations. The Attt-2/m4 oligonucleotide (containing 4 single-base mutations within the AT-rich sequence) failed to compete for the formation of these complexes, indicating that Oct-1 and Oct-2 cannot bind to this mutated AT-rich sequence. In the experiment shown in Fig. 4, the same mutations within the downstream AT-rich sequence caused an 80% decrease in cell-specific VIP gene transcription mediated by the TSE, indicating that binding of Oct-1 and Oct-2 to the AT-rich sequence is critical for the function of the TSE.
|
When an oligonucleotide spanning the upstream AT-rich sequence was used as a probe (Attt-1 probe) for the gel shift assay, three major complexes were observed in both SH-EP (Fig. 6) and HeLa (data not shown) nuclear extracts. All were specific based on competition with unlabeled Attt-1. Unrelated oligonucleotide (SP-1 consensus) and the Attt-1 oligonucleotide containing 4-base mutations (Attt-1/m4) failed to compete for formation of these complexes. Addition of Oct-1 specific antibody caused a supershift of the band marked as Oct-1 in Fig. 6. This complex, but not the other two complexes, was competed by an addition of excess unlabeled Oct-1 consensus oligonucleotide (Fig. 6). No Oct-2/Attt-1-specific complex was detectable in this assay. Thus, unlike the downstream AT-rich sequence (Attt-2) which recognizes both Oct-1 and Oct-2 proteins, Attt-1 oligonucleotide spanning the upstream AT-rich sequence binds only Oct-1. Since the core 9-base sequences of Attt-1 and Attt-2 are identical, sequences flanking the 9-bp AT-rich repeats may be critical for determining the differential specificity of these two elements.
|
In vitro footprinting analysis was performed to better define protein-binding regions within the TSE. The result in Fig. 7 show that the downstream AT-rich sequence was protected by either SH-EP or HeLa nuclear proteins. In addition, an approximately 30-bp region spanning the immediate 5' flank of the downstream AT-rich element was protected specifically by SH-EP nuclear proteins. This suggests that a multiprotein complex may be formed at this region of DNA to support cell-specific enhancer function of the TSE, including POU-homeodomain proteins Oct-1 and Oct-2 and other proteins, some of which are expressed specifically in VIP-expressing SH-EP cells.
|
In addition to potentially complex protein interactions within the TSE itself, the dependence of TSE function on intact cAMP response element-binding protein-binding sequences (VIP-CRE) within the proximal promoter of the VIP gene (11) suggested that other regions of the VIP gene between the TSE and VIP core promoter could be involved in mediating TSE function as well. This became evident as a minimal VIP-luciferase construct containing the TSE fused directly to the VIP.094 construct (contains 94 bp of the VIP gene 5'-flanking sequence including the VIP-CRE) failed to fully recapitulate cell-specific expression of the reporter gene in SH-EP cells (Fig. 8). The VIP.094-TSE construct was expressed at a significantly lower level than the full-length VIP5.2 construct in SH-EP cells. In five separate experiments, the VIP.094-TSE was expressed on average at approximately 37% of the level of the full-length VIP5.2 construct, indicating that both the TSE and VIP-CRE are necessary but not sufficient for a maximum cell-specific expression of the VIP gene.
|
To define additional cis-acting sequences required for full
cell-specific expression of the VIP gene, transient
transfection/expression assays were performed using reporter constructs
in which the TSE was fused to VIP gene 5'-flanking sequences with
progressive deletions from
2.5 kb to
94 bp (Fig. 8). Full
cell-specific expression of the reporter gene was achieved in SH-EP
cells only when the TSE was fused upstream of at least 1.55 kb of
promoter proximal VIP gene 5' flank. These constructs had appropriately
low transcriptional activity in non-VIP-expressing HeLa cells. Removal
of 270 bp from
1.55 to
1.28 kb from the VIP gene 5' flank caused a
decrease in reporter gene transcription more than 50% in SH-EP cells.
More significantly, deletion of the VIP gene 5' flank below
1.55 kb caused a large increase in expression of the reporter gene in HeLa
cells, such that these constructs no longer exhibited cell-specific transcriptional activity.
To better define the role of the 270-bp domain from
1.55 to
1.28
kb, a construct was made by removing the upstream 180-bp portion of the
270-bp domain from the VIP1.55-TSE construct. The resulting VIP1.37-TSE
construct showed a complete loss of cell-specific expression in SH-EP
cells (Fig. 9), indicating that sequences located between
1.55 and
1.37 kb enhance the effect of TSE in SH-EP
cells but not in HeLa cells. Further deletion of the 5' flank down to
1.28 kb (VIP1.28-TSE construct) caused an increase in the level of
reporter gene expression in both SH-EP and HeLa cells, indicating that
the region between
1.37 and
1.28 kb contributes repressor activity
in non-VIP-expressing cells.
|
In addition, when the effect of the 180-bp domain (domain b)
between
1.55 and
1.37 kb was examined in the absence of the
downstream 90-bp domain (domain c) between
1.37 and
1.28
kb (by deleting domain c from the VIP1.55-TSE construct),
the resulting VIP-abde construct was expressed at a level
less than 50% of the VIP1.55-TSE construct (or VIP-abcde) in SH-EP cells (Fig. 11A). This indicates that sequences
between
1.37 and
1.28 kb (c) are also required for the
function of the TSE (a).
The region spanning
1.55 to
1.28 kb (b and c)
of the human VIP gene is highly homologous to the corresponding region
of the mouse VIP gene (19), and contains two E-boxes, two MEF2 (myocyte
enhancer factor-2)-like sequences, a STAT site, and a pair of 8-bp dyad
symmetry element (Fig. 10). The STAT
site has previously been identified as a critical determinant in VIP gene up-regulation after exposure of NBFL neuroblastoma cells to
ciliary neurotrophic factor (20). The 270-bp domain between
1.55 and
1.28 kb (bc), however, when fused downstream of the TSE
(a) but directly upstream of 251 bp (PacI site) of the VIP gene promoter proximal sequence (e) failed to recapitulate a full cell-specific expression of the reporter gene (VIP-abce construct, Fig.
11B). Instead, the
VIP-abce construct was expressed at an intermediate level
both in SH-EP and HeLa cells, like the VIP.251-TSE construct
(VIP-ae) lacking the 270-bp (bc) domain. This
indicates that additional sequences, located within domain d
(between the 270-bp domain and the promoter proximal VIP-CRE), are
required for full cell-specific expression.
|
|
Finally, to better analyze the d domain, an additional
construct was made by deleting approximately 650 bp (between
904 and
251 bp) of d from the VIP-abcde construct, leaving an approximate 370-bp upstream region of the d domain containing the non-canonical AP-1-binding site (21). The
deletion of 650 bp from the d domain did not significantly affect cell-specific expression of the reporter gene
(VIP-abcd'e construct, Fig. 11A). Therefore, a
full cell-specific expression of the VIP gene requires the upstream TSE
(a), promoter proximal VIP- CRE (e), and the
entire region between
1.55 kb and
904 bp of approximately 640 bp
(bcd').
| |
DISCUSSION |
|---|
|
|
|---|
We have shown here that at least five distinct regions of the
human VIP gene 5' flank work in concert to mediate maximal
cell-specific expression of the reporter gene in SH-EP neuroblastoma
cells. This analysis is summarized schematically in Fig.
12. A 425-bp TSE (or domain
a) located at approximately
4.3 kb can fully recapitulate
cell-specific transcription when fused to at least 1.55 kb of the VIP
gene promoter proximal sequence, in VIP-expressing cells (Fig. 12). The
VIP TSE contains two 9-bp AT-rich sequences, designated here as Attt-1
and Attt-2. Binding of proteins of the POU-homeodomain family (Oct-1
for Attt-1 and Oct-1 and Oct-2 for Attt-2) or closely related proteins
to the TSE is likely to be required for transcriptional activation of
the VIP gene. This is based on the observation that
Oct-1-immunoreactive protein is present in nuclear extracts of SH-EP
cells, and that mutations in the TSE that abrogate Oct-1 binding also
abolish the cell-specific enhancer activity of this element. Whyte
et al. (1995) have reported that block replacement mutations
in a similar Oct-1 binding motif in the GnRH gene decreased reporter
gene expression by 95% in the GnRH-secreting hypothalamic neuronal
cell line GT1. Therefore, binding of Oct-1 or a closely related POU
homeodomain protein to the AT-rich sequences plays a major role in
cell-specific transcription of at least two neuropeptide-encoding
genes, those for VIP and GnRH.
|
While Oct-1 is generally believed to be ubiquitously expressed in vivo, it has been shown to interact with other factors that are expressed in a lineage-restricted manner, to mediate cell-specific transcriptional regulation. For example, B-cell-specific transcription of immunoglobulin genes requires binding of the ubiquitous Oct-1 (or Oct-2), but also requires a B-cell-specific co-activator OCA-B, also called Bob-1 or OBF-1 (18, 22-24). Oct-1 may interact with similar factors expressed selectively in neural crest-derived cells to mediate a constitutive expression of the VIP gene in this neuronal cell lineage. Indeed, footprinting of the VIP TSE suggests that protein factor(s) specifically expressed in SH-EP but not in HeLa cells may participate in a protein complex responsible for the specificity of VIP gene expression in neuroblastoma cells.
Region b (between
1.55 and
1.37 kb) plays a critical
role in conferring cell-specific enhancer activity to the TSE. This
domain contains an E-box and two MEF2-like sequences. Available evidence suggests that interactions between MEF2 proteins and cell
type-specific basic helix loop helix proteins are important for
tissue-specific transcription in both muscle and neuronal cell lineages
(25-29). The mammalian achaete-scute homologue 1 (MASH1) is a
neurogenic basic helix loop helix protein that is expressed in subsets
of cells in the central and peripheral nervous systems during mouse
embryogenesis, and plays an important role in the early development of
the nervous system (30, 31). It has been shown that MASH1 forms a
heterodimer with ubiquitously expressed basic helix loop helix
transcription factors known as E proteins (25, 32). MEF2 interacts with
MASH1/E-protein heterodimers to synergistically activate transcription.
The E-box and MEF2-like sequences in this domain of the VIP gene may
mediate a similar type of transcriptional regulation by members of the
basic helix loop helix protein family and MEF2 or related proteins.
The downstream domains from
1.37 to
1.28 kb (region c)
and
1.28 to
.251 kb (region d) contain repressor elements, as progressive removal of these regions increases
TSE-mediated expression of VIP gene constructs in neuroblastoma cells.
However, this increased transcriptional activation is no longer
cell-type specific. These data may explain previous results in which
tissue specific activity was attributed to upstream sequences including the TSE, fused directly to the VIP core promoter, based on assessment of transcriptional activity in neuroblastoma cells without concomitant assessment in a VIP non-expressing cell line (33). Elements between
1.37 and
.251 of the VIP gene may function mainly to silence
transcription of the VIP gene in VIP non-expressing cells. Contribution
from the
1.28 to
.251-kb domain (region d) is required
for both TSE-mediated maximum expression in SH-EP cells and full
repression of TSE-containing reporter constructs in HeLa cells. The
region from
1.37 to
1.28 kb overlaps with the 5'-end of the 180-bp
cytokine responsive element which mediates induction of the VIP gene by
ciliary neurotrophic factor (20, 34). This region contains a binding
site for STAT1 and STAT3 proteins, which play important roles in
cytokine-mediated up-regulation of transcription in diverse systems
(20, 35). The role of this STAT site and other regions of the cytokine
responsive element in cell-specific or second messenger-inducible
expression of the VIP gene is currently under investigation.
Overall, these experiments demonstrate that the participation of five separate cis-active domains within the VIP promoter/enhancer are required for full cell-specific expression of the VIP gene in neuroblastoma cells. Each domain is likely to bind multiple components, including ubiquitously expressed proteins such as Oct-1, Oct-2, and cAMP response element-binding protein and as yet unidentified cell-specific transcription factors that mediate both transcriptional activation in VIP-expressing cells and transcriptional repression in VIP non-expressing cell types. The apparent complexity of cell-specific regulation of VIP transcription at the level of the gene itself may reflect the requirement for integration of multiple intra- and extracellular inputs to the appropriate developmental and physiological expression of the VIP gene in vivo.
| |
ACKNOWLEDGEMENT |
|---|
We thank Dr. Jilani G. Chaudry for assistance witn in vitro mutagenesis.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Section on Molecular
Neuroscience, Laboratory of Cellular and Molecular Regulation, National
Institute of Mental Health, 36 Convent Dr., MSC 4090, Bldg. 36, Rm.
2D10, Bethesda, MD 20892-4090. Tel.: 301-496-2573; Fax: 301-402-1748;
E-mail: sungho{at}codon.nih.gov.
1 The abbreviations used are: VIP, vasoactive intestinal peptide; TSE, tissue-specifier element; bp, base pair(s); kb, kilobase(s); GnRH, gonadotropin releasing hormone; MEF2, myocyte enhancer factor-2; CyRE, cytokine response element; CRE, cAMP response element.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
X. Liu, C. Hamelink, and L. E. Eiden The tissue specifier element (TSE) functions as a Ca2+ response element for Ca2+ and cAMP synergistic signaling to the human vasoactive intestinal polypeptide (VIP) gene FASEB J, April 1, 2007; 21(6): A1035 - A1035. |
||||
![]() |
E. M. Apostolakis, R. Lanz, and B. W. O'Malley Pituitary Adenylate Cyclase-Activating Peptide: A Pivotal Modulator of Steroid-Induced Reproductive Behavior in Female Rodents Mol. Endocrinol., January 1, 2004; 18(1): 173 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hamelink, H.-W. Lee, Y. Chen, M. Grimaldi, and L. E. Eiden Coincident Elevation of cAMP and Calcium Influx by PACAP-27 Synergistically Regulates Vasoactive Intestinal Polypeptide Gene Transcription through a Novel PKA-Independent Signaling Pathway J. Neurosci., July 1, 2002; 22(13): 5310 - 5320. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Andersen and M. G. Rosenfeld POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease Endocr. Rev., February 1, 2001; 22(1): 2 - 35. [Abstract] [Full Text] |
||||
![]() |
S. H. Hahm and L. E. Eiden Two Separate Cis-active Elements of the Vasoactive Intestinal Peptide Gene Mediate Constitutive and Inducible Transcription by Binding Different Sets of AP-1 Proteins J. Biol. Chem., September 3, 1999; 274(36): 25588 - 25593. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Jones, J. Conover, and A. J. Symes Identification of a Novel gp130-responsive Site in the Vasoactive Intestinal Peptide Cytokine Response Element J. Biol. Chem., November 10, 2000; 275(46): 36013 - 36020. [Abstract] [Full Text] [PDF] |
||||
| ||||||||