HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dizhoor, A. M. Articles by Olshevskaya, E. V. Search for Related Content PubMed PubMed Citation Articles by Dizhoor, A. M. Articles by Olshevskaya, E. V. Social Bookmarking                      What's this?

J Biol Chem, Vol. 273, Issue 28, 17311-17314, July 10, 1998

COMMUNICATION
Constitutive Activation of Photoreceptor Guanylate Cyclase by Y99C Mutant of GCAP-1
POSSIBLE ROLE IN CAUSING HUMAN AUTOSOMAL DOMINANT CONE DEGENERATION^*

Alexander M. Dizhoor^§¶, Sergei G. Boikov, and Elena V. Olshevskaya

From the  Department of Ophthalmology/Kresge Eye Institute and ^§ Department of Pharmacology, Wayne State University School of Medicine, Detroit, Michigan 48201

	ABSTRACT

Top Abstract Introduction Procedures Results & Discussion References

Photoreceptor membrane guanylate cyclases (RetGC) are regulated by calcium-binding proteins, GCAP-1 and GCAP-2. At Ca²⁺ concentrations below 100 nM, characteristic of light-adapted photoreceptors, guanylate cyclase-activating protein (GCAPs) activate RetGC, and at free Ca²⁺ concentrations above 500 nM, characteristic of dark-adapted photoreceptors, GCAPs inhibit RetGC. A mutation, Y99C, in human GCAP-1 was recently found to be linked to autosomal dominant cone dystrophy in a British family (Payne, A. M., Downes, S. M., Bessant, D. A. R., Taylor, R., Holder, G. E., Warren, M. J., Bird, A. C., and Bhattachraya, S. S. (1998) Hum. Mol. Genet. 7, 273-277). We produced recombinant Y99C GCAP-1 mutant and tested its ability to activate RetGC in vitro at various free Ca²⁺ concentrations. The Y99C mutation does not decrease the ability of GCAP-1 to activate RetGC. However, RetGC stimulated by the Y99C GCAP-1 remains active even at Ca²⁺ concentration above 1 µM. Hence, the cyclase becomes constitutively active within the whole physiologically relevant range of free Ca²⁺ concentrations. We have also found that the Y99C GCAP-1 can activate RetGC even in the presence of Ca²⁺-loaded nonmutant GCAPs. This is consistent with the fact that cone degeneration was dominant in human patients who carried such mutation (Payne, A. M., Downes, S. M., Bessant, D. A. R., Taylor, R., Holder, G. E., Warren, M. J., Bird, A. C., and Bhattachraya, S. S. (1998) Hum. Mol. Genet. 7, 273-277). A similar mutation, Y104C, in GCAP-2 results in a different phenotype. This mutation apparently does not affect Ca²⁺ sensitivity of GCAP-2. Instead, the Y104C GCAP-2 stimulates RetGC less efficiently than the wild-type GCAP-2. Our data indicate that cone degeneration associated with the Y99C mutation in GCAP-1 can be a result of constitutive activation of cGMP synthesis.

	INTRODUCTION

Top Abstract Introduction Procedures Results & Discussion References

The second messenger of phototransduction, cGMP, is synthesized in photoreceptors by two retinal guanylate cyclases, RetGC-1 and RetGC-2 (also referred to as ROSGC-1 and -2 or GC-E and GC-F, respectively) (2-10). RetGC¹ are regulated by two homologous Ca²⁺-binding proteins, GCAP-1 and GCAP-2 (3, 4, 10-13).

Ca²⁺ enters outer segments (OS) of vertebrate photoreceptors through cGMP-gated Na⁺/Ca²⁺ channels in the plasma membranes. These channels are open in the dark, but they become closed in the light, because illumination stimulates cGMP hydrolysis by phosphodiesterase. Ca²⁺ is constantly extruded from the OS by a light-independent Na⁺/K⁺, Ca²⁺ exchanger, therefore interruption of Ca²⁺ influx through the channels decreases the intracellular free Ca²⁺ concentration (10, 14, 15), and that stimulates cGMP resynthesis in photoreceptors (10, 16). This Ca²⁺ feedback mechanism is essential for the recovery and light adaptation of photoreceptors (10).

RetGC itself is not sensitive to Ca²⁺, but it can interact with Ca²⁺ sensor proteins, GCAP-1 and GCAP-2 (3, 4, 11-13). A unique property of GCAPs is that they can be either activators or inhibitors of RetGC (17): at Ca²⁺ concentrations below 100 nM, characteristic of light-adapted photoreceptors, GCAPs activate the cyclase, and at free Ca²⁺ concentrations above 500 nM, characteristic of dark-adapted photoreceptors, GCAPs inhibit RetGC. GCAP-1 and GCAP-2 have four EF-hand Ca²⁺-binding domains, and GCAPs can be turned into constitutive activators of RetGC by mutations that inactivate the ability of their EF-hands to bind Ca²⁺ (17-18).

The intracellular level of cGMP may be important not only for the phototransduction, but also for the viability of photoreceptors. Several types of rod or cone degeneration have been linked to the mutations in those photoreceptor proteins that regulate either synthesis or hydrolysis of cGMP (19-23). Recently Payne et al. (1) described a new case of human autosomal dominant cone dystrophy associated with a point mutation in GCAP-1 gene. In this paper we present the evidence that this mutation, Y99C, causes a dramatic change in Ca²⁺ sensitivity of GCAP-1. As a result, RetGC stimulated by the Y99C GCAP-1 remains active even at high free Ca²⁺ concentrations. We also demonstrate that the corresponding mutation in GCAP-2 produces a different effect. Our data indicate that dominant cone degeneration associated with the Y99C substitution in GCAP-1 can be caused by permanent activation of cGMP synthesis.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results & Discussion References

Recombinant GCAP-1 and GCAP-2-- Recombinant GCAP-1 and GCAP-2 were expressed in Escherichia coli according to the procedure described previously in detail (17, 24), except that we used BLR(DE3)pLysS E. coli strain (Novagen) instead of BL21(DE3)pLysS. Myristoylated GCAP-2 was expressed as described previously (24). The N terminus of GCAP-1 is a poor substrate for yeast N-myristoyltransferase (NMT; Ref. 25). Substitution D6S makes it a better substrate (25), that allows us to produce GCAP-1, which is >90% myristoylated and is fully capable of regulating RetGC (Fig. 1). To make the GCAP-1 expression system, a cDNA encoding GCAP-1 was isolated from a bovine retinal cDNA library (a gift from Dr. D. Oprian, Brandeis University), amplified by polymerase chain reaction using forward primer AAAAAACCCATGGGGAACATTATGAGCGGTAAGTCGGTG and reverse primer ATATATGGATCCTTAAAGAGTAGGCAGTGAGCTCA. The resulting 0.65-kilobase pair fragment was inserted into the NcoI/BamHI restriction endonucleases sites of pET11d vector (Novagen) and expressed under the lac-controlled T7 promoter in the BLR(DE3)pLysS E. coli strain (Novagen) that harbored a plasmid encoding yeast NMT (a gift from Dr. J. Gordon, Washington University) as described previously (24). To produce Y  C substitutions fragments of GCAPs cDNAs were amplified by polymerase chain reaction using Pfu polymerase (Stratagene) and spliced by "splicing by overlap extension" (26). Pairs of primers encoding the base substitutions were: GGTACTTCAAGCTCTGCGACGTGGACGGCAA and TTGCCGTCCACGTCGCAGAGCTTGAAGTACC for making Y99C GCAP-1 and AGTGGACCTTCAAGATCTGCGACAAGGACCGCAA and TTGCGGTCCTTGTCGCAGATCTTGAAGGTCCACT for making Y104C GCAP-2. Mutant GCAP-1 and GCAP-2 were expressed using the same method (24). Expressed proteins were purified as described previously (24) using chromatography on Sephacryl S-100 column. Positions of the mutations were verified by automated DNA sequencing (ABI Prizm, Perkin-Elmer). Calculated average isotopic mass for the myristoylated Y99C used in this study is 23,500.00. The actual average isotopic mass of purified Y99C GCAP-1 found by electrospray mass-spectrometry was 23,500.0 ± 1.3. The nonmyristoylated form was undetectable.

RetGC Activity Assay-- Washed bovine OS membranes (containing both RetGC-1 and RetGC-2) were prepared, depleted of endogenous GCAPs, reconstituted with recombinant GCAPs, and assayed as described previously (12, 24). The assay mixtures (25 µl) contained 50 mM MOPS-KOH (pH 7.5), 60 mM KCl, 8 mM NaCl, 10 mM MgCl₂, 2 mM Ca/EGTA buffer, 10 µM each of dipyridamole and zaprinast, 1 mM ATP, 1 mM GTP, 4 mM cGMP, 1 µCi of [-³²P]GTP, 0.1 µCi of [8-³H]cGMP (NEN Life Science Products) and washed bovine OS membranes (3.5 µg of rhodopsin). Reaction mixtures were incubated under infrared illumination for 12 min at 30 °C. The reaction was stopped by heating for 2 min at 95 °C. Samples were chilled on ice, centrifuged, and analyzed by TLC using fluorescent plastic-backed polyethylenimine cellulose plates (Merck). After development in 0.2 M LiCl, cGMP spots were visualized under UV illumination, cut, eluted with 1 ml of 2 M LiCl, mixed with 10 ml of an Ecolume scintillation mixture, and both ³H and ³²P radioactivity were counted. [³H]cGMP was used as an internal standard to ensure the absence of cGMP hydrolysis by light-sensitive phosphodiesterase. Ca/EGTA buffers were prepared according to (27).

	RESULTS AND DISCUSSION

Top Abstract Introduction Procedures Results & Discussion References

Mutation Y99C Affects Ca²⁺ Sensitivity of GCAP-1-- GCAPs are highly conserved proteins (28). Human, mouse, and bovine GCAP-1 are virtually identical within their EF-hands regions, and this is also true for GCAP-2 (Ref. 19; also, see Fig. 1, top panel). When expressed as recombinant proteins, both GCAP-1 and GCAP-2 stimulate RetGC in a Ca²⁺-sensitive manner as it is shown in Fig. 1. It is also important to notice that GCAPs regulate RetGC within the submicromolar range of free Ca²⁺ concentrations. The exact free Ca²⁺ concentrations in rods and cones of mammals and humans have yet to be determined, but in dark-adapted resting rods of lower vertebrate, the free Ca²⁺ concentration is near 550 nM, and it decreases to near 50 nM (10) after strong illumination. Therefore we consider the submicromolar range of free Ca²⁺ as "physiologically relevant."

View larger version (41K): [in this window] [in a new window]   Fig. 1.   The Y99C GCAP-1, unlike the Y104C GCAP-2, causes constitutive activation of RetGC. The top panel demonstrates homology between human (hGCAP) and bovine (BGCAP) GCAPs (sequences are from Refs. 12 and 28). Tyrosine (marked with asterisk) immediately adjacent to the Ca2+-binding domain EF-3 was substituted for cysteine to replicate the mutation reported by Payne et al. (1). A, RetGC activity as a function of free Ca2+ concentrations in the presence of 1 µM GCAP-1 (), Y99C (), or without GCAPs (). B, RetGC activity in the presence of 1 µM GCAP-2 (), Y104C GCAP-2 (), or without GCAPs (). Data are representative of three similar results obtained using two independent preparations of GCAPs. See "Experimental Procedures" for details.

To evaluate the potential functional significance of Y99C substitution reported by Payne et al. (1), we replicated this mutation in recombinant GCAP-1. The mutant protein was expressed in E. coli and purified as described under "Experimental procedures." We have found that the Y99C substitution does not hamper the ability of GCAP-1 to stimulate RetGC (Fig. 1A). Instead, the Y99C GCAP-1 fails to inhibit the cyclase at high Ca²⁺, so that RetGC remains equally active within the whole range of free Ca²⁺ concentrations between 6 nM an 1 µM. The Ca²⁺ sensitivity of RetGC in the presence of the mutant GCAP-1 is decreased to such extent that the cyclase remains at near 50% of its maximal activity at Ca²⁺ concentrations higher than 10 µM.

GCAP-1 and GCAP-2 are nearly 40% identical to each other (12, 28). However, despite the overall functional and structural similarity between GCAP-2 and GCAP-1, a similar substitution, Y104C, in GCAP-2 results in different biochemical phenotype than the Y99C mutation in GCAP-1 (Fig. 1B). The Y104C GCAP-2 inhibits activation of RetGC at low Ca²⁺, but its Ca²⁺ sensitivity remains practically unaffected. Hence, the region adjacent to the EF-3 in GCAP-1 apparently plays a different role in RetGC regulation than the same region in GCAP-2. The difference between the Y99C GCAP-1 and the Y104C GCAP-2 in our experiments is consistent with other recent observations. First, unlike GCAP-1, inactivation of EF-3 in GCAP-2 has relatively minor effect on the regulatory properties of GCAP-2 (17, 18). Second, EF-2 is very important for the Ca²⁺ sensitivity of GCAP-2 (17), although it was postulated not to be essential for the activity of GCAP-1 (18). Third, a calcium-myristoyl switch has been postulated to be critical for the GCAP-1 activity (29); however myristoylation has only a minor significance for the general regulatory properties of GCAP-2 (24).

The Y99C GCAP-1 Competes with the Wild Type GCAP-1 and GCAP-2-- Payne et al. (1) reported that the Y99C mutation in GCAP-1 gene had a dominant phenotype. The question is why does the presence of the normal allele(s) of GCAP(s) not protect cone cells from degeneration?

Even though the exact level of GCAP-1 and GCAP-2 expression in cones and rods has not been unambiguously defined, it has been well established that both GCAP-1 and GCAP-2 are expressed in photoreceptors (11-13, 29-32). Several antibodies were raised in different laboratories that could detect both GCAP-1 and GCAP-2 in rods (12, 30) and in cones (30, 31) (some conclusions about the distribution of GCAP-1 and GCAP-2 in rods versus cones (29) were at variance apparently because of the different masking of GCAP-2 epitopes in animal species (30)). Both immunocytochemical (13, 30-32) and in situ hybridization analyses (11) indicate that GCAP-1 is strongly expressed in cones. At the same time, Y99C mutation in GCAP-1 results only in cone dystrophy, and rods appear to be unaffected (1). This fact suggests that GCAP-1 is either not functioning in rods, or its concentration in rods is insignificant for RetGC regulation. It also strongly argues that GCAP-1 plays an important role in RetGC regulation in cones. On the other hand, GCAP-2 was initially found in rod outer segments (12). This localization of GCAP-2 in rods has been confirmed by other groups (30, 32). However, a lower level of GCAP-2 expression in cones has also been detected (30, 32). It is therefore possible that the normal alleles of GCAP-1 and GCAP-2 can both be present in the affected human cones along with the Y99C GCAP-1. Based on that assumption, we tested whether Y99C GCAP-1 could activate RetGC in the presence of both Ca²⁺-loaded GCAP-1 and GCAP-2 in vitro.

We have found that the Y99C GCAP-1 efficiently competes with Ca²⁺-loaded GCAP-1 and GCAP-2 and prevents their inhibitory effect at free Ca²⁺ as high as 1 µM (Fig. 2). The addition of nonmutant GCAP-1 and GCAP-2 increases the EC₅₀ for the RetGC activation by the Y99C GCAP-1, but it does not prevent RetGC from being activated by the mutant protein (Fig. 2A). The Y99C GCAP-1 stimulates RetGC in the presence of equimolar concentrations of either wild type GCAP-1 or GCAP-2 (Fig. 2B). The normal GCAP-1 and GCAP-2 are able to only partially decrease RetGC activity stimulated by the Y99C GCAP-1, at free Ca²⁺ above 1 µM. Therefore, given that the intracellular free Ca²⁺ in human photoreceptors in the dark is within the micromolar range (10), the Y99C mutation should be able to cause an excessive synthesis of cGMP in resting photoreceptors, even in the presence of normal GCAPs. That could explain the dominant phenotype of Y99C mutation in GCAP-1 found in vivo.

View larger version (26K): [in this window] [in a new window]   Fig. 2.   The Y99C GCAP-1 competes with calcium-loaded nonmutant GCAP-1 and GCAP-2. A, Dose dependence of RetGC activation by Y99C at 1 µM free Ca2+ in the absence () or in the presence () of 2 µM GCAP-1 plus 2 µM GCAP-2. B, RetGC activation by 1 µM GCAP-1 () or Y99C GCAP-1 (, , ) as a function of free Ca2+ concentrations either in the absence () or in the presence of 1 µM GCAP-1 () or 1 µM GCAP-2 (). , no GCAPs added. Data are representative of three similar results obtained using two independent preparations of GCAPs. See "Experimental Procedures" for details.

The steady-state dark/resting level of free cGMP in photoreceptors is maintained at the level of 3-4 µM, and that keeps a few percent of cGMP gated ion channels in the open state (10). It is not immediately apparent why and how the Y99C GCAP-1 effect on RetGC activity would cause photoreceptors to degenerate. So, we can only suggest various scenarios that could potentially lead to the cell death. It is likely that constitutive synthesis of cGMP, especially when it is not balanced by phosphodiesterase activity in the resting photoreceptors, may increase the steady-state level of the free cGMP in the cytoplasm. In such case, high cGMP level, for example, would be able to alter the activity of the cyclic nucleotide-regulated protein kinase(s). Also, higher than normal cGMP concentrations can keep too many cGMP gated channels open in the dark and create excessive influx of both Na⁺ and Ca²⁺. Because the activity of RetGC in the presence of the Y99C GCAP-1 is not completely inhibited even by [Ca²⁺]_free above 10 µM (Figs. 1A and 2B), cGMP synthesis may continue until the free concentration of Ca²⁺ (and perhaps Na⁺) in the cell dramatically exceeds the normal resting level. That may affect cellular metabolism in general. For example, more ATP will be constantly utilized to extrude both Na⁺ and Ca²⁺ from the resting cell. The elevated intracellular Ca²⁺ concentrations could be also toxic for other vital cell functions.

	ACKNOWLEDGEMENTS

We thank Dr. James Hurley and Greg Niemi (University of Washington) for the electrospray mass-spectrometry analysis of the recombinant GCAPs. We are also grateful to the anonymous reviewer for stimulating criticism.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant EY11522 and by a Career Development Award from Research to Prevent Blindness (to A. M. D.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed: Dept. of Ophthalmology/Kresge Eye Institute, Wayne State University School of Medicine, 4717 St. Antoine, Detroit, MI 48201. Tel.: 313-577-1573; Fax: 313-577-7635; E-mail: adizhoor{at}med.wayne.edu.

¹ The abbreviations used are: RetGC, photoreceptor membrane guanylate cyclases; GCAP, guanylate cyclase-activating protein; NMT, N-myristoyltransferase; OS, photoreceptor outer segments; MOPS, 4-morpholinepropanesulfonic acid.

	REFERENCES

Top Abstract Introduction Procedures Results & Discussion References

1. Payne, A. M., Downes, S. M., Bessant, D. A. R., Taylor, R., Holder, G. E., Warren, M. J., Bird, A. C., and Bhattachraya, S. S. (1998) Hum. Mol. Genet. 7, 273-277[Abstract/Free Full Text]
2. Shyjan, A. W., DeSauvage, F. J., Gilett, N. A., and Lowe, D. G. (1992) Neuron 9, 727-737[CrossRef][Medline] [Order article via Infotrieve]
3. Dizhoor, A. M., Lowe, D. G., Olshevskaya, E. V., Laura, R. P., and Hurley, J. B. (1994) Neuron 12, 1345-1352[CrossRef][Medline] [Order article via Infotrieve]
4. Lowe, D. G., Dizhoor, A. M., Liu, K., Gu, O., Laura, R., Lu, L., and Hurley, J. B. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5535-5539[Abstract/Free Full Text]
5. Goraczniak, R. M., Duda, T., Sitaramayya, A., and Sharma, R. K. (1994) Biochem. J. 302, 455-461
6. Sitaramayya, A., Duda, T., and Sharma, R. K. (1995) Mol. Cell. Biochem. 148, 139-145[CrossRef][Medline] [Order article via Infotrieve]
7. Yang, R. B., Foster, D. C., Garbers, D. L., and Fulle, H. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 602-606[Abstract/Free Full Text]
8. Hayashi, F., and Yamazaki, A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4746-4750[Abstract/Free Full Text]
9. Garbers, D. L., and Lowe, D. G. (1994) J. Biol. Chem. 269, 30741-30744[Free Full Text]
10. Pugh, E. N., Jr., Duda, T., Sitaramayya, A., and Sharma, R. K. (1997) Biosci. Rep. 17, 429-472[CrossRef][Medline] [Order article via Infotrieve]
11. Palczewski, K., Subbaraya, I., Gorczyca, W. A., Helekar, B. S., Ruiz, C. C., Ohguro, H., Huang, J., Zhao, X., Crabb, J. W., Johnson, R. S., Walsh, K. A., Gray-Keller, M. P., Detwiler, P. B., and Baehr, W. (1994) Neuron 13, 395-404[CrossRef][Medline] [Order article via Infotrieve]
12. Dizhoor, A. M., Olshevskaya, E. V., Henzel, W. J., Wong, S. C., Stults, J. T., Ankoudinova, I., and Hurley, J. B. (1995) J. Biol. Chem. 270, 25200-25206[Abstract/Free Full Text]
13. Gorczyca, W. A., Polans, A. S., Surgucheva, I. G., Subbaraya, I., Baehr, W., and Palczewski, K. (1995) J. Biol. Chem. 270, 22029-22036[Abstract/Free Full Text]
14. Baylor, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 560-565[Abstract/Free Full Text]
15. Koutalos, Y., and Yau, K.-W. (1996) Trends Neurosci. 19, 73-81[CrossRef][Medline] [Order article via Infotrieve]
16. Koch, K.-W., and Stryer, L. (1988) Nature 334, 64-66[CrossRef][Medline] [Order article via Infotrieve]
17. Dizhoor, A. M., and Hurley, J. B. (1996) J. Biol. Chem. 271, 19346-19350[Abstract/Free Full Text]
18. Rudnicka-Nawrot, M., Surgucheva, I., Hulmes, J. D., Haeseleer, F., Sokal, I., Crabb, J. W., Baehr, W., and Palczewski, K. (1998) Biochemistry 37, 248-257[CrossRef][Medline] [Order article via Infotrieve]
19. Farber, D. B., Danciger, J. S., and Aquirre, G. (1992) Neuron 9, 349-356[CrossRef][Medline] [Order article via Infotrieve]
20. Pittler, S. J., and Baehr, W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 322-326
21. Perrault, I., Rozet, J. M., Calvas, P., Gerber, S., Camuzat, A., Dollfus, H., Chatelin, S., Souied, E., Ghazi, I., Leowski, C., Bonnemaison, M., Le Paslier, D., Frezal, J., Dufier, J. L., Pittler, S., Munnich, A., and Kaplan, J. (1996) Nat. Genet. 14, 461-464[CrossRef][Medline] [Order article via Infotrieve]
22. Semple-Rowland, S. L., Gorczyca, W. A., Buczylko, J., Helekar, B. S., Ruiz, C. C., Subbaraya, I., Palczewski, K., and Baehr, W. (1996) FEBS Lett. 385, 47-52[CrossRef][Medline] [Order article via Infotrieve]
23. Frins, S., Bonigk, W., Muller, F., Kellner, R., and Koch, K.-W. (1996) J. Biol. Chem. 271, 8022-8027[Abstract/Free Full Text]
24. Olshevskaya, E. V., Hughes, R. E., Hurley, J. B., and Dizhoor, A. M. (1997) J. Biol. Chem. 272, 14327-14333[Abstract/Free Full Text]
25. Rocque, W. J., McWherter, C. A., Wood, D. C., and Gordon, J. I. (1993) J. Biol. Chem. 268, 9964-9971[Abstract/Free Full Text]
26. Horton, R. M, and Pease, L. R. (1991) in Directed Mutagenesis: A Practical Approach (McPherson, M. J., ed), pp. 217-250, Oxford University Press, Oxford
27. Tsien, R., and Pozzan, T. (1989) Methods Enzymol. 172, 230-262[Medline] [Order article via Infotrieve]
28. Surguchev, A., Bronson, J. D., Banerjee, P., Knowels, J. A., Ruiz, C., Subbaraya, I., Palczewski, K., and Baehr, W. (1997) Genomics 39, 312-322[CrossRef][Medline] [Order article via Infotrieve]
29. Otto-Bruc, A., Fariss, R. N., Haeseleer, F., Huang, J., Buczylko, J., Surgucheva, I., Baehr, W., Milam, A. H., and Palczewski, K. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4727-4732[Abstract/Free Full Text]
30. Howes, K., Bronson, J. D., Dang, Y. L., Li, N., Zhang, K., Rouz, C., Helekar, B., Lee, M., Subbaraya, I., Kolb, H., Chen, J., and Baehr, W. (1998) Invest. Ophthalm. Vis. Sci. 39, 867-875[Abstract/Free Full Text]
31. Cuenca, N., Wall, S., Lopez, S., Howes, K., Baehr, W., and Kolb, H. (1997) Invest. Ophthalm. Vis. Sci. 38, S21
32. Kachi, S., Dizhoor, A., Nishizava, Y., Watanabe, N., Yamazaki, A., and Usukura, J. (1998) Invest. Ophthalm. Vis. Sci. 39, S1051

---

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. L. Woodruff, E. V. Olshevskaya, A. B. Savchenko, I. V. Peshenko, R. Barrett, R. A. Bush, P. A. Sieving, G. L. Fain, and A. M. Dizhoor Constitutive Excitation by Gly90Asp Rhodopsin Rescues Rods from Degeneration Caused by Elevated Production of cGMP in the Dark J. Neurosci., August 15, 2007; 27(33): 8805 - 8815. [Abstract] [Full Text] [PDF]

				I. V. Peshenko and A. M. Dizhoor Activation and Inhibition of Photoreceptor Guanylyl Cyclase by Guanylyl Cyclase Activating Protein 1 (GCAP-1): THE FUNCTIONAL ROLE OF Mg2+/Ca2+ EXCHANGE IN EF-HAND DOMAINS J. Biol. Chem., July 27, 2007; 282(30): 21645 - 21652. [Abstract] [Full Text] [PDF]

				A. P. Yamniuk, H. Ishida, and H. J. Vogel The Interaction between Calcium- and Integrin-binding Protein 1 and the {alpha}IIb Integrin Cytoplasmic Domain Involves a Novel C-terminal Displacement Mechanism J. Biol. Chem., September 8, 2006; 281(36): 26455 - 26464. [Abstract] [Full Text] [PDF]

				I. V. Peshenko and A. M. Dizhoor Ca2+ and Mg2+ Binding Properties of GCAP-1: EVIDENCE THAT Mg2+-BOUND FORM IS THE PHYSIOLOGICAL ACTIVATOR OF PHOTORECEPTOR GUANYLYL CYCLASE J. Biol. Chem., August 18, 2006; 281(33): 23830 - 23841. [Abstract] [Full Text] [PDF]

				C. L. Makino, X.-H. Wen, N. Michaud, I. V. Peshenko, B. Pawlyk, R. S. Brush, M. Soloviev, X. Liu, M. L. Woodruff, P. D. Calvert, et al. Effects of Low AIPL1 Expression on Phototransduction in Rods Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 2185 - 2194. [Abstract] [Full Text] [PDF]

				I. Sokal, W. J. Dupps, M. A. Grassi, J. Brown Jr, L. M. Affatigato, N. Roychowdhury, L. Yang, S. Filipek, K. Palczewski, E. M. Stone, et al. A Novel GCAP1 Missense Mutation (L151F) in a Large Family with Autosomal Dominant Cone-Rod Dystrophy (adCORD) Invest. Ophthalmol. Vis. Sci., April 1, 2005; 46(4): 1124 - 1132. [Abstract] [Full Text] [PDF]

				K. M. Nishiguchi, I. Sokal, L. Yang, N. Roychowdhury, K. Palczewski, E. L. Berson, T. P. Dryja, and W. Baehr A Novel Mutation (I143NT) in Guanylate Cyclase-Activating Protein 1 (GCAP1) Associated with Autosomal Dominant Cone Degeneration Invest. Ophthalmol. Vis. Sci., November 1, 2004; 45(11): 3863 - 3870. [Abstract] [Full Text] [PDF]

				E. V. Olshevskaya, P. D. Calvert, M. L. Woodruff, I. V. Peshenko, A. B. Savchenko, C. L. Makino, Y.-S. Ho, G. L. Fain, and A. M. Dizhoor The Y99C Mutation in Guanylyl Cyclase-Activating Protein 1 Increases Intracellular Ca2+ and Causes Photoreceptor Degeneration in Transgenic Mice J. Neurosci., July 7, 2004; 24(27): 6078 - 6085. [Abstract] [Full Text] [PDF]

				I. V. Peshenko and A. M. Dizhoor Guanylyl Cyclase-activating Proteins (GCAPs) Are Ca2+/Mg2+ Sensors: IMPLICATIONS FOR PHOTORECEPTOR GUANYLYL CYCLASE (RetGC) REGULATION IN MAMMALIAN PHOTORECEPTORS J. Biol. Chem., April 23, 2004; 279(17): 16903 - 16906. [Abstract] [Full Text] [PDF]

				A. Yamazaki, H. Yu, M. Yamazaki, H. Honkawa, I. Matsuura, J. Usukura, and R. K. Yamazaki A Critical Role for ATP in the Stimulation of Retinal Guanylyl Cyclase by Guanylyl Cyclase-activating Proteins J. Biol. Chem., August 29, 2003; 278(35): 33150 - 33160. [Abstract] [Full Text] [PDF]

				J. E. Coleman, G. E. Fuchs, and S. L. Semple-Rowland Analyses of the Guanylate Cyclase Activating Protein-1 Gene Promoter in the Developing Retina Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1335 - 1343. [Abstract] [Full Text] [PDF]

				E. Carafoli Calcium signaling: A tale for all seasons PNAS, February 5, 2002; 99(3): 1115 - 1122. [Abstract] [Full Text] [PDF]

				I. Sokal, N. Li, C. S. Klug, S. Filipek, W. L. Hubbell, W. Baehr, and K. Palczewski Calcium-sensitive Regions of GCAP1 as Observed by Chemical Modifications, Fluorescence, and EPR Spectroscopies J. Biol. Chem., November 9, 2001; 276(46): 43361 - 43373. [Abstract] [Full Text] [PDF]

				R. J. Newbold, E. C. Deery, C. E. Walker, S. E. Wilkie, N. Srinivasan, D. M. Hunt, S. S. Bhattacharya, and M. J. Warren The destabilization of human GCAP1 by a proline to leucine mutation might cause cone-rod dystrophy Hum. Mol. Genet., January 1, 2001; 10(1): 47 - 54. [Abstract] [Full Text] [PDF]

				S. M. Downes, G. E. Holder, F. W. Fitzke, A. M. Payne, M. J. Warren, S. S. Bhattacharya, and A. C. Bird Autosomal Dominant Cone and Cone-Rod Dystrophy With Mutations in the Guanylate Cyclase Activator 1A Gene-Encoding Guanylate Cyclase Activating Protein-1 Arch Ophthalmol, January 1, 2001; 119(1): 96 - 105. [Abstract] [Full Text] [PDF]

				S. E. Wilkie, R. J. Newbold, E. Deery, C. E. Walker, I. Stinton, V. Ramamurthy, J. B. Hurley, S. S. Bhattacharya, M. J. Warren, and D. M. Hunt Functional characterization of missense mutations at codon 838 in retinal guanylate cyclase correlates with disease severity in patients with autosomal dominant cone-rod dystrophy Hum. Mol. Genet., December 1, 2000; 9(20): 3065 - 3073. [Abstract] [Full Text] [PDF]

				M. Nakamura, Y. Hotta, A. Tanikawa, H. Terasaki, and Y. Miyake A High Association with Cone Dystrophy in Fundus Albipunctatus Caused by Mutations of the RDH5 Gene Invest. Ophthalmol. Vis. Sci., November 1, 2000; 41(12): 3925 - 3932. [Abstract] [Full Text]

				K. A. Lucas, G. M. Pitari, S. Kazerounian, I. Ruiz-Stewart, J. Park, S. Schulz, K. P. Chepenik, and S. A. Waldman Guanylyl Cyclases and Signaling by Cyclic GMP Pharmacol. Rev., September 1, 2000; 52(3): 375 - 414. [Abstract] [Full Text] [PDF]

				S. Tachibanaki, K. Nanda, K. Sasaki, K. Ozaki, and S. Kawamura Amino Acid Residues of S-modulin Responsible for Interaction with Rhodopsin Kinase J. Biol. Chem., February 4, 2000; 275(5): 3313 - 3319. [Abstract] [Full Text] [PDF]

				E. V. Olshevskaya, A. N. Ermilov, and A. M. Dizhoor Dimerization of Guanylyl Cyclase-activating Protein and a Mechanism of Photoreceptor Guanylyl Cyclase Activation J. Biol. Chem., September 3, 1999; 274(36): 25583 - 25587. [Abstract] [Full Text] [PDF]

				C. L. Tucker, S. C. Woodcock, R. E. Kelsell, V. Ramamurthy, D. M. Hunt, and J. B. Hurley Biochemical analysis of a dimerization domain mutation in RetGC-1 associated with dominant cone-rod dystrophy PNAS, August 3, 1999; 96(16): 9039 - 9044. [Abstract] [Full Text] [PDF]

				R.-B. Yang, S. W. Robinson, W.-H. Xiong, K.-W. Yau, D. G. Birch, and D. L. Garbers Disruption of a Retinal Guanylyl Cyclase Gene Leads to Cone-Specific Dystrophy and Paradoxical Rod Behavior J. Neurosci., July 15, 1999; 19(14): 5889 - 5897. [Abstract] [Full Text] [PDF]

				I. Sokal, A. E. Otto-Bruc, I. Surgucheva, C. L. M. J. Verlinde, C.-K. Wang, W. Baehr, and K. Palczewski Conformational Changes in Guanylyl Cyclase-activating Protein 1 (GCAP1) and Its Tryptophan Mutants as a Function of Calcium Concentration J. Biol. Chem., July 9, 1999; 274(28): 19829 - 19837. [Abstract] [Full Text] [PDF]

				J. B. Ames, A. M. Dizhoor, M. Ikura, K. Palczewski, and L. Stryer Three-dimensional Structure of Guanylyl Cyclase Activating Protein-2, a Calcium-sensitive Modulator of Photoreceptor Guanylyl Cyclases J. Biol. Chem., July 2, 1999; 274(27): 19329 - 19337. [Abstract] [Full Text] [PDF]

				M. Biel, M. Seeliger, A. Pfeifer, K. Kohler, A. Gerstner, A. Ludwig, G. Jaissle, S. Fauser, E. Zrenner, and F. Hofmann Selective loss of cone function in mice lacking the cyclic nucleotide-gated channel CNG3 PNAS, June 22, 1999; 96(13): 7553 - 7557. [Abstract] [Full Text] [PDF]

				H. Yu, E. Olshevskaya, T. Duda, K. Seno, F. Hayashi, R. K. Sharma, A. M. Dizhoor, and A. Yamazaki Activation of Retinal Guanylyl Cyclase-1 by Ca2+-binding Proteins Involves Its Dimerization J. Biol. Chem., May 28, 1999; 274(22): 15547 - 15555. [Abstract] [Full Text] [PDF]

				E. V. Olshevskaya, S. Boikov, A. Ermilov, D. Krylov, J. B. Hurley, and A. M. Dizhoor Mapping Functional Domains of the Guanylate Cyclase Regulator Protein, GCAP-2 J. Biol. Chem., April 16, 1999; 274(16): 10823 - 10832. [Abstract] [Full Text] [PDF]

				D. M. Krylov, G. A. Niemi, A. M. Dizhoor, and J. B. Hurley Mapping Sites in Guanylyl Cyclase Activating Protein-1 Required for Regulation of Photoreceptor Membrane Guanylyl Cyclases J. Biol. Chem., April 16, 1999; 274(16): 10833 - 10839. [Abstract] [Full Text] [PDF]

				F. Haeseleer, I. Sokal, N. Li, M. Pettenati, N. Rao, D. Bronson, R. Wechter, W. Baehr, and K. Palczewski Molecular Characterization of a Third Member of the Guanylyl Cyclase-activating Protein Subfamily J. Biol. Chem., March 5, 1999; 274(10): 6526 - 6535. [Abstract] [Full Text] [PDF]