INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

A family of membrane-associated guanine nucleotide-binding regulatory proteins (G-proteins)¹ is essential for mediating signal transduction between cell-surface receptors and intracellular effectors such as adenylate cyclase, phospholipase C, phospholipase A₂, and ion channels (1-4). G-proteins are composed of three subunits termed , , and . The  subunit (G) contains a binding site for guanine nucleotides and possesses GTPase activity. Upon receptor stimulation, heterotrimeric G-proteins disassociate into an -GTP complex and / dimer. In most systems, a GTP-bound G activates or inhibits an effector system, and the functional half-life is determined by the intrinsic GTPase activity of G. Recently, it has been shown that the dimer (G) is significantly important in signal transduction as well (3).

High voltage-activated (HVA) Ca²⁺ channels are negatively regulated by G-proteins in a membrane-delimited manner (2, 4). This response is primarily mediated by pertussis toxin-sensitive G-proteins (G_o/G_i), in which G_o has been shown to inhibit current from HVA Ca²⁺ channels (5-7). Additionally, it has been shown that G also transduces an inhibitory signal to HVA Ca²⁺ channels (8, 9). It remains to be determined, however, which subunit arm of the G-protein complex preferentially interacts with N- and P/Q-types of HVA Ca²⁺ channels. Recently, it has been determined that the intracellular loop joining motif I and II (referred to as "loop 1" in the present study) is an interaction site on neuronal HVA Ca²⁺ channels for G (10-13). Nevertheless, mapping of region(s) on HVA Ca²⁺ channels responsible for interactions with G and/or G is still very incomplete (14).

To address these issues at the molecular level, we have functionally expressed _1A, _1B, and _1C of HVA Ca²⁺ channels in Xenopus oocytes. These subunits were derived from rabbit brain N-type, P/Q-type, and cardiac L-type Ca²⁺ channels, respectively. In addition, we have co-expressed -opioid receptor (DOR) together with G or G as we did in determining a region of the muscarinic-gated K⁺ channel critical for activation by G with the presumption that co-expression with G or G determines which kind of modulation takes place (15). In this paper, interactions of G and G with Ca²⁺ channels were characterized using mutant and chimeric N- (_1B) and P/Q-type (_1A) Ca²⁺ channels. The results, together with evidence for a direct binding provided by the companion paper (16), define the interaction sites of Ca²⁺ channels for G and G.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

In Vitro Transcription

The 1.4-kb ApaI/ApaI and 6.8-kb HindIII/HindIII fragment containing the entire coding regions of DOR (17) and the Ca²⁺ channel _1C subunit (18) were inserted into the HindIII site of the pSPA2 vector (19), to yield pSPDOR and pSPCDR, respectively. The plasmid pSPCDR was digested with XbaI, blunted with T4 DNA polymerase, and ligated with a SalI linker to yield pSPCDRS. The _1C subunit cDNA was kindly provided by Drs. Atsushi Mikami and Tsutomu Tanabe. The pSPA1, pSPA2, pSP72, pSP65, and pSP64 recombinant plasmids carrying the entire protein-coding sequences of G_i3, G₁, G₂, and Ca²⁺ channel _1B, _1A, ₂, and _1a subunits were described previously (15, 18-21). Nucleotide sequence analyses revealed that the deduced amino acid sequence of G_i3 was the same as that reported (22) except that Ser-16, Asp-64, Ser-165, Glu-261, and Pro-282 were determined as Thr (ACG), Glu (GAA), Thr (ACC), Asp (GAC), and Ser (TCA), respectively, in our clone, pG31 (15).

cRNAs specific for _1A, _1B, _1C, ₂, and _1a subunits of the Ca²⁺ channel, 17 kinds of mutants and chimeric ₁ subunits (see below), DOR, G_i3, G₁, and G₂ were synthesized in vitro using a MEGAscript SP6 kit (Ambion).

Construction of Mutant and Chimeric Ca²⁺ Channels

B3T1-- The plasmid pSPB3 carrying the entire protein-coding sequences of _1B (21) was digested with BamHI and circularized with T₄ DNA ligase to yield pSPB3BH. The 5.5-kb NotI/SrfI fragment excised from pSPB3BH was ligated with the 55-bp NotI/BglI fragment from pSPB3 and the annealed oligodeoxyribonucleotides, GGGCTGGCGGTCC and GGACCGCCAGCCCCGC. The 1.7-kb NotI/PflMI fragment from the resulting plasmid was ligated with the 8.6-kb NotI/PflMI fragment from pSPB3 to obtain pSPB3S. The plasmid pSPB3S was digested with SrfI and SpeI, blunted with T₄ DNA polymerase, and ligated with the annealed oligonucleotides, GGGCTTAGCTGCGGAGAAGAGTTCTGAGACGTGCACCGGTT and AACCGGTGCACGTCTCAGAACTCTTCTCCGCAGCTAAGCCC, to yield pSPB3T1. In this plasmid, the codon TTC for Tyr-1913 was replaced with the codon TAG for termination.

B3TCD-- The 8.7-kb SrfI/SalI fragment excised from pSPB3S was ligated with the 2.2-kb ScaI/SalI fragment from pSPCDRS to obtain pSPB3TCD. In this plasmid, the codon CGG for Arg-1911 of the _1B subunit was replaced with the codon CAC for (His), and the segment encoding amino acid residues 1658-2171 of the _1C subunit was substituted for amino acid residues 1912-2339 of the _1B subunit.

B3LCD and B3LCDT1-- The plasmid pSPB3S was digested with EcoRI, blunted, and circularized to delete the EcoRI site. The resulting plasmid and the plasmid pSPB3T1 were digested with BsmI, blunted, and ligated with the EcoRI linker, dGGAATTCC, to produce pSPB3S.E. and pSPB3T1E. The plasmids pSPB3S.E. and pSPB3T1E were digested with PmlI and EcoRI, and the 9.3-kb PmlI/EcoRI fragment from pSPB3S.E. or the 7.8-kb PmlI/EcoRI fragment from pSPB3T1E was ligated with the 950-bp BamHI/EcoRI fragment from pSPCDR and the annealed oligonucleotides, GTGGCCCTGGGTGTATTTTGTCAGTCTGGTCATCTTTG and GATCCAAAGATGACCAGACTGACAAAATACACCCAGGGCCAC, to yield pSPB3LCD or pSPB3LCDT1. In these plasmids, the segment encoding amino acid residues 411-740 of the _1C subunit was substituted for amino acid residues 332-668 of the _1B subunit.

B3LCDTCD-- The 8.6-kb SrfI/SalI fragment was excised from pSPB3LCD and ligated with the 2.2-kb ScaI/SalI fragment from pSPCDRS to yield pSPB3LCDTCD.

CDT1-- The plasmid pSPCDR was partially digested with AvrII, blunted with T₄ DNA polymerase, and circularized with T₄ DNA ligase to obtain pSPCDTD1. In this plasmid, the codon AGG and CCC for Arg-1980 and Pro-1981 of the _1C subunit was replaced with the codon AGC (Ser) and TAG for termination.

CDTB3-- The 5.2-kb HindIII/ScaI and the 3.0-kb HindIII/SalI fragments excised from pSPCDRS were ligated with the 1.6-kb SrfI/SalI fragment from pSPB3 to obtain pSPCDTB3. In this plasmid, the segment encoding amino acid residues 1912-2339 of the _1B subunit was substituted for amino acid residues of 1658-2171 of the _1C subunit, and the codon TAC for Tyr-1657 of the _1C subunit was replaced with the codon TGG (Trp).

CDLB3 and CDLB3TB3-- To delete an internal SacI site, the plasmids pSPCDRS and pSPCDTB3 were partially digested with SacI, blunted, and circularized to produce pSPCDRSS and pSPCDTB3S. Another SacI site on pSPCDRSS was deleted by the same procedure. The resulting plasmid and the plasmid pSPCDTB3S were digested with SacI and StuI and blunted. The 9.5-kb SacI/StuI fragment from the former or the 8.9-kb SacI/StuI fragment from the latter was ligated with the 890-bp XhoI/ApaI fragment that was excised from pSPB3 and blunted with T₄ DNA polymerase, in order to yield pSPCDLB3 or pSPCDLB3TB3. In these plasmids, the segment encoding amino acid residues 242-537 of the _1B subunit were substituted for amino acid residues 318-610 of the _1C subunit, and the codon CTC for Leu-242 of the _1B subunit and CAG for Gln-611 of the _1C subunit were replaced with the codon GTC for (Val) and GAG for (Glu), respectively.

B3L1-- The 9.6-kb PmlI/PflMI fragment from pSPB3S was ligated with the 99-bp PmlI/HhaI and 610-bp KpnI/PflMI fragments excised from pSPB3 and the annealed oligonucleotides, CGAGAGAGAGCTCAACGGGTAC and CCGTTGAGCTCTCTCTCGCG, to yield pSPB3L1. In this plasmid, the segment encoding amino acid residues 366-383 of the _1B subunit were deleted.

B3L2, B3L3, and B3L4-- The plasmid pSPB3 was digested with SacI, blunted with T₄ DNA polymerase, and cleaved with NotI, PvuII, XmnI, and/or PflMI. The 1.1-kb NotI/SacI and 510-bp PvuII/PflMI fragments, the 1.2-kb NotI/PvuII and 360-bp XmnI/PflMI fragments, and the 1.1-kb NotI/SacI and 360-bp XmnI/PflMI fragments were ligated with the 8.6-kb NotI/PflMI fragment from pSPB3S to produce pSPB3L2, pSPB3L3, and pSPB3L4, respectively. In the plasmid pSPB3L2, the segment encoding amino acid residues 384-420 of the _1B subunit was deleted. In the plasmid pSPB3L3, the segment encoding amino acid residues 421-470 of the _1B subunit was deleted, and the codon ATG for Met-471 was replaced with the codon GTG for (Val). In the plasmid pSPB3L4, the segment encoding amino acid residues 384-470 of the _1B subunit was deleted, and the codon ATG for Met-471 was replaced with the codon GTG for (Val).

B1T1-- pSPCBI-1 (20) was digested with HindIII or SphI, blunted with T4 DNA polymerase, and digested with SalI. The resulting 5.6-kb SalI/SphI (blunted) and 3.6-kb HindIII (blunted)/SalI fragments were ligated to yield pSPBIC1 (originally pSPCBISH-1). In the plasmid pSPBIC1, the segment encoding amino acid residues 1856-2273 of the _1A (BI-1 ₁) subunit was deleted, and the amino acid residues AFRLRAAERGR were attached.

B1T2-- Oligonucleotides GATCTATGCCGCCATGATGATCATGGAGTACTAC, CGGCAGAGCAAAGCCAAAAAGCTGCAGGCCATGCGCGAGGAG, CAGAACCGGACACCGCTCATGTTCCAGCGCATGGAGCCCCCG, and CCGGATGAGGGGGGCGCCGGCCAGAACGCCCTGCCCTAGCGC were annealed with GGCCGCGCTAGGGCAGGGCGTTCTGGCCGGCGCCCCCCTC, ATCCGGCGGGGGCTCCATGCGCTGGAACATGAGCGGTGTCCG, GTTCTGCTCCTCGCGCATGGCCTGCAGCTTTTTGGCTTTGCT, and CTGCCGGTAGTACTCCATGATCATCATGGCGGCATA, respectively, ligated, and cleaved with BglII and NotI. The resulting 170-bp BglII/NotI fragment was ligated with the 5.8-kb XbaI/NheI, 2.6-kb NheI/BglII, and 1.1-kb NotI/XbaI fragment from pSPCBI-1 to yield pSPBIC4. The plasmid carries cDNA encoding the _1A (BI-1 ₁) subunit with a deletion of the C-terminal amino acid residues 2015-2273.

CDB1-- The 640-bp BamHI/BstXI and 420-bp BstXI/XmnI fragments from pCARD3 (18), the 87-bp XmnI/HindIII fragment from pSPCBI-2 (20), and the HindIII/BamHI 2.4-kb fragment from pSP72 were ligated to yield pCB(Bm-Hd). The 1.5-kb XhoI/BamHI fragment from pCARD3, the 1.1-kb BamHI/HindIII fragment from pCB(Bm-Hd), and the 9.3-kb HindIII/SalI fragment from pSPCBI-2 were ligated to yield pBC2. In the plasmid pBC2, the _1A (BI-2 ₁) subunit cDNA has a substitution of the nucleotide sequence encoding residues 1-777 of the _1C subunit for the sequence encoding the amino acid residues 1-707.

CDTB1-- The 7.2-kb XbaI/PflMI fragment from pCARD3, the 3.1-kb SphI/XbaI fragment from pSPCBI-2, and the annealed oligonucleotides CTGGATGAATACGTGCGGGTCTGGGCCGAGTACGACCCTGCTGCTTGGGGACGCATG and CGTCCCCAAGCAGCAGGGTCGTACTCGGCCCAGACCCGCACGTATTCATCCAGATG were ligated to yield pBC4. The plasmid pBC4 carries cDNA for the _1C subunit which has the C-terminal tail residues 1524-2127 replaced with the tail residues 1838-2424 of the _1A (BI-2 ₁) subunit.

Functional Expression of Wild-type, Mutant, and Chimeric Ca²⁺ Channels in Xenopus Oocytes

After removal of the follicular cell layer (15), Xenopus oocytes were injected either with 0.3 µg/µl ₁ (_1B, _1A, _1C, mutant ₁, or chimeric ₁) cRNA in combination with 0.2 µg/µl ₂ cRNA and 0.1 µg/µl _1a cRNA; 0.03 µg/µl DOR cRNA; 0.05 µg/µl G_i3 cRNA, or 0.05 µg/µl G₁ cRNA, and 0.025 µg/µl G₂ cRNA, unless otherwise specified. The average volume of injection was ~50 nl per oocyte. The injected oocytes were incubated for 3-5 days and then subjected to electrophysiological measurements at 21 ± 2 °C.

In order to unmask the effect of endogenous G (16), a deoxyoligonucleotide 20-mer (AGO) of the following sequence was used in antisense experiments, CATGACTGCTCGGGGGGGGA. The AGO antisense oligonucleotide is complementary to nucleotides (17 to 3) of the Xenopus G_o mRNA (23). The endogenous Xenopus G_o nucleotide sequence shows 40% identity with the corresponding nucleotide sequence of G_o cRNA injected. This antisense oligonucleotide (0.1 µg/µl, 50 nl) was injected 12-16 h prior to electrophysiological measurements.

The oocytes were positioned in a recording chamber (1.0 ml in volume) and were perfused with a Ba²⁺ solution containing 40 mM Ba²⁺, 50 mM Na⁺, 2 mM K⁺, and 5 mM HEPES (pH 7.5 with methanesulfonic acid). Membrane currents through the expressed Ca²⁺ channels were measured with the two-microelectrode voltage-clamp method as described previously (15). Also, the membrane potential recorded by the potential electrode was monitored. The membrane was held at 80 or 100 mV, and step depolarizations were applied to activate the Ca²⁺ channels. Microelectrodes were filled with 3 M KCl, and those showing resistances of 0.5-1.5 megohms were used.

We noticed slow tail currents upon repolarization as shown in Fig. 1. In these cases, the time resolution of clamping was within 4 ms and the potential error was within 3% of the command pulse, indicating no serious space-clamping problems in characterizing Ca²⁺ channel currents.

Unless otherwise stated, statistical data were represented by the mean and S.E.

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Functional Expression of the N-, P/Q-, and L-type Ca²⁺ Channels in Xenopus Oocytes-- To establish a recombinant expression system, where current inhibition mediated by G-proteins can be reconstituted individually, HVA N-, P/Q-, and L-type Ca²⁺ channels were co-expressed in Xenopus oocytes by injection of cRNAs for three (₁, ₂, and ₁) Ca²⁺ channel subunits and the -opioid receptor (DOR). Their responses to the opioid peptide, Leu-enkephalin (Leu-EK), were examined by the two-microelectrode voltage-clamp technique.

View larger version (19K): [in this window] [in a new window]   Fig. 1.   Functional expression of N- (1B), P/Q- (1A), and L-type (1C) Ca2+ channels in Xenopus oocytes. Membrane currents were recorded from oocytes injected with cRNA for one of three kinds of Ca2+ channel 1 subunits (1B (A and B), 1A (C and D), and 1C (E and F)) in combination with cRNAs for Ca2+ channel 2 and 1a subunits and cRNA for DOR. The external solution contained 40 mM Ba2+. A, C, and E; B, D, and F, left, inward Ba2+ currents induced by step depolarizations (250 or 300 ms in duration) from a holding potential of 80 mV to +10 mV. The records were taken before (A, C, and E; control; B, D, and F; line 1) and 20 s after application of 0.1 or 1 µM -CTx (A), 0.3 µM -Aga (C), 10 µM nifedipine (E), or 1 µM Leu-EK (B, D, and F; line 2), and 10 min after removal of Leu-EK (B, D and F; line 3). B, D, and F, right, current-voltage (I-V) relationships for the records shown in B, D, and F, left. The membranes were held at 80 mV and depolarized by a 250 (or 300)-ms test pulse from 80 mV to +50 mV with 10 mV steps. Peak currents before (open circles) and during (filled circles) exposure to 1 µM Leu-EK and after removal of Leu-EK (filled triangles) are plotted against the membrane potential of test pulses. Note that the peak current is inhibited prominently by Leu-EK either in B or D. Therefore, in the following experiments, the amplitude of peak currents was used as a measure of the response to Leu-EK. In practice, peak currents were measured before and after application of a receptor agonist, and the change was expressed as their ratio.

Effects of G and G on the N- and P/Q-type Ca²⁺ Channels-- To determine which arm of the G-protein complex contributes to regulation of N- and P/Q-type Ca²⁺ channels, either G_i3 cRNA or G₁ plus G₂ cRNAs were injected into oocytes in combination with Ca²⁺ channel ₁ (_1B or _1A), ₂, and _1a subunits cRNAs and DOR cRNA.

View larger version (22K): [in this window] [in a new window]   Fig. 2.   Multiple structural domains in 1B channels for the inhibition mediated by Gi3 and G12. A, left, schematic representation of mutant 1B and 1C channels and chimeric channels composed of 1B (hatched boxes) and 1C sequences (open boxes). Deletion or replacement of the C terminus and/or substitution of the intracellular loop between segment I and II (loop 1) were carried out in the two types of 1 subunit of Ca2+ channels. Nomenclature is as follows: B3, wild-type 1B; CD, wild-type 1C; T or Tail, C terminus; L or L1, loop 1; , deletion. Functional expression of Ca2+ channels is also indicated (+ and ). A, right, responsiveness of mutant and chimeric 1 channels to 1 µM Leu-EK in oocytes implanted with DOR, 1, 2, and 1a in combination with Gi3 (filled boxes), G12 (hatched boxes), or no exogenous G-protein (open boxes). Positive and negative responses represent inhibition and facilitation of channels, respectively. In oocytes from which endogenous Ca2+ currents were recorded, 1 subunit was not co-expressed (No exogenous Ca2+ channel). In other oocytes, wild-type, mutant, and chimeric 1 subunits as indicated for each on the left side were co-expressed. The antisense oligonucleotide, AGO, was used. The responses to Leu-EK were measured (see Fig. 1 legend) and expressed as ratios of inhibition. The number of oocytes examined for each data are 4-68. B, representative current traces for the mutant 1B (B3T1) and 1C (CDT1) channels and the chimeric 1B/1C (B3LCD, B3LCDT1, CDTB3, CDLB3, and CDLB3TB3) channels in oocytes co-expressed with DOR, Gi3, and Ca2+ channel 2 and 1a subunits. The pulse protocol was identical to that in Fig. 1 for 1B channels. Concentrations of Leu-EK, -CTx, and nifedipine used were 1, 0.3, and 10 µM, respectively. The antisense oligonucleotide, AGO, was used.

View larger version (32K): [in this window] [in a new window]   Fig. 3.   The C terminus and the loop 1 of 1B channels determining the interactions with Gi3 and G12. A and B, upper, comparisons of wild-type, mutant, and chimeric 1B and 1C channels with respect to the Leu-EK-induced inhibition via Gi3 and to the prepulse facilitation via G12. The responses of 7 different channel types, as indicated with schemes, to 1 µM Leu-EK (horizontal bars), prepulse (open circles), or both (filled circles) were measured in oocytes co-expressing with DOR, 2, and 1a in combination with G-protein subunit as indicated. The pulse protocols were as follows: a 200-ms test pulse was applied to +10 mV from a holding potential of 100 mV, which was preceded, if necessary, by a depolarizing prepulse (30 ms in duration) to +80 mV and then by a 20-ms repolarization to 100 mV. The antisense oligonucleotide, AGO, was used. The number of oocytes examined for each data are 4-23 in A and 4-10 in B. The deletion sites for these mutant 1B channels in B are represented schematically in Fig. 5A. A and B, lower, Leu-EK-induced inhibition as mediated by Gi3 (filled bars) and prepulse-induced facilitation as mediated by G12 (open bars). Differences in the response to Leu-EK between oocytes with and without expression of Gi3 and changes induced by prepulse without Leu-EK in oocytes expressing G12, as shown in upper, are represented as  Response.

View larger version (23K): [in this window] [in a new window]   Fig. 4.   Regulation of P/Q-type (1A) channels by G and G. A, left, schematic representation of mutant 1A channels and chimeric channels composed of 1A (filled boxes) and 1C sequences (open boxes). Nomenclature is given in the legend of Fig. 2A, except that B1 denotes wild-type 1A. Functional expression of Ca2+ channels is also indicated (+ and ). A, right, responsiveness of mutant 1A and chimeric 1A/1C channels to 1 µM Leu-EK in oocytes implanted with DOR, 1, 2, and 1a in combination with Gi3 (filled boxes), G12 (hatched boxes), or no exogenous G-protein (open boxes). In oocytes from which endogenous Ca2+ currents were recorded, 1 subunit was not co-expressed (No exogenous Ca2+ channel). In other oocytes, wild-type, mutant, and chimeric 1 subunits as indicated for each on the left side were co-expressed. The antisense oligonucleotide, AGO, was used. The responses to Leu-EK were measured (see Fig. 2A) and expressed as ratios. The number of oocytes examined for each data are 4-18. B, representative current traces for the mutant (B1T2) and chimeric (CDTB1) 1A channels in oocytes implanted with DOR, Gi3, 2, and 1a in combination with each mutant or chimeric 1. The pulse protocol was identical to that as in Fig. 1 for the 1A channel. Concentrations of Leu-EK and nifedipine used were 1 and 10 µM, respectively. The antisense oligonucleotide, AGO, was used. C, comparisons of wild-type, mutant, and chimeric 1A channels with respect to the Leu-EK-induced inhibition via Gi3 and to the prepulse facilitation via G12. The responses of three different channel types, as indicated, to 1 µM Leu-EK (horizontal bars), prepulse (open circles), or both (filled circles) were measured (see Fig. 3A) and expressed as ratios. The antisense oligonucleotide, AGO, was used. The number of oocytes examined for each data are 4-18.

Combination of _1B, ₂, and _1a Subunits Is Required for the Inhibitory Regulations by G_i3 and G-- The ₁ subunit of the Ca²⁺ channel forms the channel pore (4). As a result of this, N-type Ca²⁺ channel currents were not detectable without the injection of _1B subunit cRNA (n = 13). However, when the _1B subunit was expressed without the ₂ and _1a subunits, Leu-EK still produced channel inhibition and slowing of the _1B currents via G_i3 (n = 8). Moreover, the opioid-induced inhibition of _1B currents was larger in the absence of _1a subunit (n = 15) and did not change without the ₂ subunit (n = 8) (27, 28). In addition, the prepulse facilitation of _1B currents mediated via G₁₂ (see Fig. 3) was also present without the ₂ and _1a subunits (n = 5). These results suggest that both G and G can interact with the ₁ subunit regardless of subunit composition and are able to produce channel modulation.

Interaction of G and G with Mutant and Chimeric _1B Channels-- By aiming at identifying the regions on the _1B channel interacting with G_i3 and G₁₂, chimeric channels between _1B (Fig. 2A, B3) and _1C (Fig. 2A, CD) were constructed. These constructs were generated (Fig. 2), taking advantage of the inability of _1C channels to be inhibited by G-proteins (Figs. 1F, 2A, and 3A). Neither a deletion of the C-terminal region of _1B (amino acid residues 1913-2339, see Fig. 5) nor a replacement of the C-terminal region of _1B (amino acid residues 1912-2339) by that of _1C (amino acid residues 1658-2171) affected the Leu-EK-induced inhibition of Ca²⁺ channels in oocytes co-expressed with G_i3 and G₁₂ (Fig. 2, A and B; B3T1 and B3TCD, respectively). Moreover, currents through the chimeric _1B channel, B3LCD, in which a region of _1C (amino acid residues 411-740) containing the intracellular loop joining motif I and II (loop 1) was substituted for that of _1B (amino acid residues 332-668), were inhibited by Leu-EK in oocytes co-expressed with G or G (Fig. 2, A and B, B3LCD). However, a deletion of the C-terminal region of B3LCD (corresponding to amino acid residues 1913-2339 of _1B) produced a chimeric channel, B3LCDT1, which was insensitive to Leu-EK (Fig. 2, A and B, B3LCDT1).

View larger version (15K): [in this window] [in a new window]   Fig. 5.   Schematic representation of the sites on 1B subunit for making the deletion mutants. A, positions of the deletion (L1, L2, L3, and T1), the loop 1, and the C terminus are indicated by the number of the amino acid residues for 1B subunit (33) and 1A (BI-1 1) subunit (20) in parentheses. The deletion sites are indicated by the crossing bars, and the cytoplasmic side below the horizontal lines. The asterisk denotes the binding site for Ca2+ channel  subunit (31), and the filled circle denotes the phosphorylation sites for protein kinase C (10). B, mutations introduced into the 1B and 1A subunits. The numbers of amino acid residues deleted are indicated.

B3T1

B3LCDT1

CDT1

Effects of Prepulse on the Inhibitions of Mutant and Chimeric N-type Ca²⁺ Channels via G_i3 or G₁₂-- The experiments described above, in which the wild-type _1B and _1A channels were used, demonstrated that G plays a significant role in G-protein-mediated inhibition of neuronal Ca²⁺ channels. However, there is a possibility that G exerts its effect indirectly upon Ca²⁺ channels through G. To exclude this possibility, it was necessary to investigate further molecularly and structurally the dependence of G on G when interacting with Ca²⁺ channel ₁ subunits.

B3T1

B3LCDT1

B3T1

L2

B3L2

L3

B3L3

L1

L2

L3

Interaction Site on the P/Q-type Ca²⁺ Channel for G-protein-- In order to determine the interaction site on the P/Q-type Ca²⁺ channel for G and G, procedures similar to those for _1B channels (Figs. 2 and 3) were applied to _1A channels (Fig. 4). In oocytes co-expressed with G_i3 or G₁₂ together with DOR and Ca²⁺ channel (₁, ₂ and _1a subunits), deletion of the C terminus of _1A (amino acid residues 2015-2273) reduced the sensitivity to Leu-EK (Fig. 4A, B1T2) as compared with the wild-type _1A (B1). This stands clearly in contrast to the mutant _1B channel (B3T1), in which deletion of the C terminus alone did not influence the sensitivity to Leu-EK (Fig. 2A). In addition, the chimeric _1C channel (CDTB1), in which the C terminus of _1C (amino acid residues 1524-2127) was replaced by that of _1A (amino acid residues 1838-2424), acquired sensitivity to Leu-EK (Fig. 4A, CDTB1), whereas the wild-type _1C channel was not affected by Leu-EK (Figs. 2A and 3A). Another chimeric _1C/_1A channel (CDB1), in which the N terminus of _1C (amino acid residues 1-777) substituted for that of _1A (amino acid residues 1-707), still exerted sensitivities to Leu-EK (Fig. 4A, CDB1). As shown in Fig. 4B, currents through the B1T2 and CDTB1 channels were comparable to those through the wild-type _1A and _1C channels (Fig. 1), and the CDTB1 currents were blocked by nifedipine.

B1T2

	DISCUSSION

Top Abstract Introduction Procedures Results Discussion References

In the present study, the -CTx-sensitive N-type (_1B) and -Aga-sensitive P/Q-type (_1A) Ca²⁺ channels were functionally expressed in Xenopus oocytes, an in vivo expression system. As described, we found that G_i3 co-expressed in oocytes mediated receptor agonist-induced inhibition of N-type _1B and P/Q-type _1A channels. On the other hand, a depolarizing prepulse relieved current inhibition caused by the G₁₂ complex, and the facilitatory effects were more pronounced in _1B than in _1A. Because responsiveness of the _1B and _1A channels to the inhibition mediated by G_i3 and G₁₂ was maintained even in the absence of the Ca²⁺ channel auxiliary subunits ₂ and ₁, the ₁ subunit should bear the interaction sites for both the G subunit and the G dimer. Finally, we defined loop 1 of _1B as an interaction site for G and the C termini of _1B and _1A for G, based on the responses of mutant and chimeric channels to G and G.

The Native Type _1B, _1A, and _1C Channels Expressed in Xenopus Oocytes-- The electrophysiological and pharmacological properties of the _1B, _1A, and _1C channels determined were identical to those of the N-, P/Q-, and L-type Ca²⁺ channels described previously (18, 20, 33). This indicates that _1B (N-type), _1A (P/Q-type), and _1C (L-type) Ca²⁺ channels were functionally expressed with the Ca²⁺ channel ₂ and ₁ subunits in Xenopus oocytes. When DOR was further co-expressed,