JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Furukawa, T.
Right arrow Articles by Yoshii, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Furukawa, T.
Right arrow Articles by Yoshii, M.

J Biol Chem, Vol. 273, Issue 28, 17585-17594, July 10, 1998


Differential Interactions of the C terminus and the Cytoplasmic I-II Loop of Neuronal Ca2+ Channels with G-protein alpha  and beta gamma Subunits
I. MOLECULAR DETERMINATION*

Taiji FurukawaDagger §, Toshihide NukadaDagger , Yasuo Moriparallel **, Minoru Wakamoriparallel **, Yoshihiko FujitaDagger Dagger , Hiroyuki IshidaDagger Dagger , Kazuhiko Fukuda§§, Shigehisa Kato§§, and Mitsunobu Yoshii¶¶

From the Dagger  Department of Neurochemistry and ¶¶ Department of Neurophysiology, Tokyo Institute of Psychiatry, 2-1-8 Kamikitazawa, Setagaya-ku, Tokyo 156, the § Department of Internal Medicine, Faculty of Medicine, Teikyo University, 2-11-1 Kaga, Itabashi-ku, Tokyo 173, the parallel  Department of Information Physiology, National Institute for Physiological Sciences, Okazaki, Aichi 444, Japan, the ** Institute of Molecular Pharmacology and Biophysics, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267-0828, and the Dagger Dagger  Department of Molecular Genetics, Kyoto University Faculty of Medicine, Yoshidakonoe-cho and §§ Department of Anesthesia, Kyoto University Hospital, 54 Shogoin-Kawaharacho, Sakyo-ku, Kyoto 606-01, Japan

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Interactions of G-protein alpha  (Galpha ) and beta gamma subunits (Gbeta gamma ) with N- (alpha 1B) and P/Q-type (alpha 1A) Ca2+ channels were investigated using the Xenopus oocyte expression system. Gi3alpha was found to inhibit both N- and P/Q-type channels by receptor agonists, whereas Gbeta 1gamma 2 was responsible for prepulse facilitation of N-type channels. L-type channels (alpha 1C) were not regulated by Galpha or Gbeta gamma . For N-type, prepulse facilitation mediated via Gbeta gamma was impaired when the cytoplasmic I-II loop (loop 1) was deleted or replaced with the alpha 1C loop 1. Galpha -mediated inhibitions were also impaired by substitution of the alpha 1C loop 1, but only when the C terminus was deleted. For P/Q-type, by contrast, deletion of the C terminus alone diminished Galpha -mediated inhibition. Moreover, a chimera of L-type with the alpha 1B loop 1 gained Gbeta gamma -dependent facilitation, whereas an L-type chimera with the N- or P/Q-type C terminus gained Galpha -mediated inhibition. These findings provide evidence that loop 1 of N-type channels is a regulatory site for Gbeta gamma and the C termini of P/Q- and N-types for Galpha .

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

A family of membrane-associated guanine nucleotide-binding regulatory proteins (G-proteins)1 is essential for mediating signal transduction between cell-surface receptors and intracellular effectors such as adenylate cyclase, phospholipase C, phospholipase A2, and ion channels (1-4). G-proteins are composed of three subunits termed alpha , beta , and gamma . The alpha  subunit (Galpha ) contains a binding site for guanine nucleotides and possesses GTPase activity. Upon receptor stimulation, heterotrimeric G-proteins disassociate into an alpha -GTP complex and beta /gamma dimer. In most systems, a GTP-bound Galpha activates or inhibits an effector system, and the functional half-life is determined by the intrinsic GTPase activity of Galpha . Recently, it has been shown that the beta gamma dimer (Gbeta gamma ) is significantly important in signal transduction as well (3).

High voltage-activated (HVA) Ca2+ channels are negatively regulated by G-proteins in a membrane-delimited manner (2, 4). This response is primarily mediated by pertussis toxin-sensitive G-proteins (Go/Gi), in which Goalpha has been shown to inhibit current from HVA Ca2+ channels (5-7). Additionally, it has been shown that Gbeta gamma also transduces an inhibitory signal to HVA Ca2+ channels (8, 9). It remains to be determined, however, which subunit arm of the G-protein complex preferentially interacts with N- and P/Q-types of HVA Ca2+ channels. Recently, it has been determined that the intracellular loop joining motif I and II (referred to as "loop 1" in the present study) is an interaction site on neuronal HVA Ca2+ channels for Gbeta gamma (10-13). Nevertheless, mapping of region(s) on HVA Ca2+ channels responsible for interactions with Galpha and/or Gbeta gamma is still very incomplete (14).

To address these issues at the molecular level, we have functionally expressed alpha 1A, alpha 1B, and alpha 1C of HVA Ca2+ channels in Xenopus oocytes. These subunits were derived from rabbit brain N-type, P/Q-type, and cardiac L-type Ca2+ channels, respectively. In addition, we have co-expressed delta -opioid receptor (DOR) together with Galpha or Gbeta gamma as we did in determining a region of the muscarinic-gated K+ channel critical for activation by Gbeta gamma with the presumption that co-expression with Galpha or Gbeta gamma determines which kind of modulation takes place (15). In this paper, interactions of Galpha and Gbeta gamma with Ca2+ channels were characterized using mutant and chimeric N- (alpha 1B) and P/Q-type (alpha 1A) Ca2+ channels. The results, together with evidence for a direct binding provided by the companion paper (16), define the interaction sites of Ca2+ channels for Galpha and Gbeta gamma .

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In Vitro Transcription

The 1.4-kb ApaI/ApaI and 6.8-kb HindIII/HindIII fragment containing the entire coding regions of DOR (17) and the Ca2+ channel alpha 1C subunit (18) were inserted into the HindIII site of the pSPA2 vector (19), to yield pSPDOR and pSPCDR, respectively. The plasmid pSPCDR was digested with XbaI, blunted with T4 DNA polymerase, and ligated with a SalI linker to yield pSPCDRS. The alpha 1C subunit cDNA was kindly provided by Drs. Atsushi Mikami and Tsutomu Tanabe. The pSPA1, pSPA2, pSP72, pSP65, and pSP64 recombinant plasmids carrying the entire protein-coding sequences of Gi3alpha , Gbeta 1, Ggamma 2, and Ca2+ channel alpha 1B, alpha 1A, alpha 2, and beta 1a subunits were described previously (15, 18-21). Nucleotide sequence analyses revealed that the deduced amino acid sequence of Gi3alpha was the same as that reported (22) except that Ser-16, Asp-64, Ser-165, Glu-261, and Pro-282 were determined as Thr (ACG), Glu (GAA), Thr (ACC), Asp (GAC), and Ser (TCA), respectively, in our clone, pG3alpha 1 (15).

cRNAs specific for alpha 1A, alpha 1B, alpha 1C, alpha 2, and beta 1a subunits of the Ca2+ channel, 17 kinds of mutants and chimeric alpha 1 subunits (see below), DOR, Gi3alpha , Gbeta 1, and Ggamma 2 were synthesized in vitro using a MEGAscript SP6 kit (Ambion).

Construction of Mutant and Chimeric Ca2+ Channels

B3TDelta 1-- The plasmid pSPB3 carrying the entire protein-coding sequences of alpha 1B (21) was digested with BamHI and circularized with T4 DNA ligase to yield pSPB3BH. The 5.5-kb NotI/SrfI fragment excised from pSPB3BH was ligated with the 55-bp NotI/BglI fragment from pSPB3 and the annealed oligodeoxyribonucleotides, GGGCTGGCGGTCC and GGACCGCCAGCCCCGC. The 1.7-kb NotI/PflMI fragment from the resulting plasmid was ligated with the 8.6-kb NotI/PflMI fragment from pSPB3 to obtain pSPB3S. The plasmid pSPB3S was digested with SrfI and SpeI, blunted with T4 DNA polymerase, and ligated with the annealed oligonucleotides, GGGCTTAGCTGCGGAGAAGAGTTCTGAGACGTGCACCGGTT and AACCGGTGCACGTCTCAGAACTCTTCTCCGCAGCTAAGCCC, to yield pSPB3TDelta 1. In this plasmid, the codon TTC for Tyr-1913 was replaced with the codon TAG for termination.

B3TCD-- The 8.7-kb SrfI/SalI fragment excised from pSPB3S was ligated with the 2.2-kb ScaI/SalI fragment from pSPCDRS to obtain pSPB3TCD. In this plasmid, the codon CGG for Arg-1911 of the alpha 1B subunit was replaced with the codon CAC for (His), and the segment encoding amino acid residues 1658-2171 of the alpha 1C subunit was substituted for amino acid residues 1912-2339 of the alpha 1B subunit.

B3LCD and B3LCDTDelta 1-- The plasmid pSPB3S was digested with EcoRI, blunted, and circularized to delete the EcoRI site. The resulting plasmid and the plasmid pSPB3TDelta 1 were digested with BsmI, blunted, and ligated with the EcoRI linker, dGGAATTCC, to produce pSPB3S.E. and pSPB3TDelta 1E. The plasmids pSPB3S.E. and pSPB3TDelta 1E were digested with PmlI and EcoRI, and the 9.3-kb PmlI/EcoRI fragment from pSPB3S.E. or the 7.8-kb PmlI/EcoRI fragment from pSPB3TDelta 1E was ligated with the 950-bp BamHI/EcoRI fragment from pSPCDR and the annealed oligonucleotides, GTGGCCCTGGGTGTATTTTGTCAGTCTGGTCATCTTTG and GATCCAAAGATGACCAGACTGACAAAATACACCCAGGGCCAC, to yield pSPB3LCD or pSPB3LCDTDelta 1. In these plasmids, the segment encoding amino acid residues 411-740 of the alpha 1C subunit was substituted for amino acid residues 332-668 of the alpha 1B subunit.

B3LCDTCD-- The 8.6-kb SrfI/SalI fragment was excised from pSPB3LCD and ligated with the 2.2-kb ScaI/SalI fragment from pSPCDRS to yield pSPB3LCDTCD.

CDTDelta 1-- The plasmid pSPCDR was partially digested with AvrII, blunted with T4 DNA polymerase, and circularized with T4 DNA ligase to obtain pSPCDTD1. In this plasmid, the codon AGG and CCC for Arg-1980 and Pro-1981 of the alpha 1C subunit was replaced with the codon AGC (Ser) and TAG for termination.

CDTB3-- The 5.2-kb HindIII/ScaI and the 3.0-kb HindIII/SalI fragments excised from pSPCDRS were ligated with the 1.6-kb SrfI/SalI fragment from pSPB3 to obtain pSPCDTB3. In this plasmid, the segment encoding amino acid residues 1912-2339 of the alpha 1B subunit was substituted for amino acid residues of 1658-2171 of the alpha 1C subunit, and the codon TAC for Tyr-1657 of the alpha 1C subunit was replaced with the codon TGG (Trp).

CDLB3 and CDLB3TB3-- To delete an internal SacI site, the plasmids pSPCDRS and pSPCDTB3 were partially digested with SacI, blunted, and circularized to produce pSPCDRSS and pSPCDTB3S. Another SacI site on pSPCDRSS was deleted by the same procedure. The resulting plasmid and the plasmid pSPCDTB3S were digested with SacI and StuI and blunted. The 9.5-kb SacI/StuI fragment from the former or the 8.9-kb SacI/StuI fragment from the latter was ligated with the 890-bp XhoI/ApaI fragment that was excised from pSPB3 and blunted with T4 DNA polymerase, in order to yield pSPCDLB3 or pSPCDLB3TB3. In these plasmids, the segment encoding amino acid residues 242-537 of the alpha 1B subunit were substituted for amino acid residues 318-610 of the alpha 1C subunit, and the codon CTC for Leu-242 of the alpha 1B subunit and CAG for Gln-611 of the alpha 1C subunit were replaced with the codon GTC for (Val) and GAG for (Glu), respectively.

B3LDelta 1-- The 9.6-kb PmlI/PflMI fragment from pSPB3S was ligated with the 99-bp PmlI/HhaI and 610-bp KpnI/PflMI fragments excised from pSPB3 and the annealed oligonucleotides, CGAGAGAGAGCTCAACGGGTAC and CCGTTGAGCTCTCTCTCGCG, to yield pSPB3LDelta 1. In this plasmid, the segment encoding amino acid residues 366-383 of the alpha 1B subunit were deleted.

B3LDelta 2, B3LDelta 3, and B3LDelta 4-- The plasmid pSPB3 was digested with SacI, blunted with T4 DNA polymerase, and cleaved with NotI, PvuII, XmnI, and/or PflMI. The 1.1-kb NotI/SacI and 510-bp PvuII/PflMI fragments, the 1.2-kb NotI/PvuII and 360-bp XmnI/PflMI fragments, and the 1.1-kb NotI/SacI and 360-bp XmnI/PflMI fragments were ligated with the 8.6-kb NotI/PflMI fragment from pSPB3S to produce pSPB3LDelta 2, pSPB3LDelta 3, and pSPB3LDelta 4, respectively. In the plasmid pSPB3LDelta 2, the segment encoding amino acid residues 384-420 of the alpha 1B subunit was deleted. In the plasmid pSPB3LDelta 3, the segment encoding amino acid residues 421-470 of the alpha 1B subunit was deleted, and the codon ATG for Met-471 was replaced with the codon GTG for (Val). In the plasmid pSPB3LDelta 4, the segment encoding amino acid residues 384-470 of the alpha 1B subunit was deleted, and the codon ATG for Met-471 was replaced with the codon GTG for (Val).

B1TDelta 1-- pSPCBI-1 (20) was digested with HindIII or SphI, blunted with T4 DNA polymerase, and digested with SalI. The resulting 5.6-kb SalI/SphI (blunted) and 3.6-kb HindIII (blunted)/SalI fragments were ligated to yield pSPBICDelta 1 (originally pSPCBIDelta SH-1). In the plasmid pSPBICDelta 1, the segment encoding amino acid residues 1856-2273 of the alpha 1A (BI-1 alpha 1) subunit was deleted, and the amino acid residues AFRLRAAERGR were attached.

B1TDelta 2-- Oligonucleotides GATCTATGCCGCCATGATGATCATGGAGTACTAC, CGGCAGAGCAAAGCCAAAAAGCTGCAGGCCATGCGCGAGGAG, CAGAACCGGACACCGCTCATGTTCCAGCGCATGGAGCCCCCG, and CCGGATGAGGGGGGCGCCGGCCAGAACGCCCTGCCCTAGCGC were annealed with GGCCGCGCTAGGGCAGGGCGTTCTGGCCGGCGCCCCCCTC, ATCCGGCGGGGGCTCCATGCGCTGGAACATGAGCGGTGTCCG, GTTCTGCTCCTCGCGCATGGCCTGCAGCTTTTTGGCTTTGCT, and CTGCCGGTAGTACTCCATGATCATCATGGCGGCATA, respectively, ligated, and cleaved with BglII and NotI. The resulting 170-bp BglII/NotI fragment was ligated with the 5.8-kb XbaI/NheI, 2.6-kb NheI/BglII, and 1.1-kb NotI/XbaI fragment from pSPCBI-1 to yield pSPBICDelta 4. The plasmid carries cDNA encoding the alpha 1A (BI-1 alpha 1) subunit with a deletion of the C-terminal amino acid residues 2015-2273.

CDB1-- The 640-bp BamHI/BstXI and 420-bp BstXI/XmnI fragments from pCARD3 (18), the 87-bp XmnI/HindIII fragment from pSPCBI-2 (20), and the HindIII/BamHI 2.4-kb fragment from pSP72 were ligated to yield pCB(Bm-Hd). The 1.5-kb XhoI/BamHI fragment from pCARD3, the 1.1-kb BamHI/HindIII fragment from pCB(Bm-Hd), and the 9.3-kb HindIII/SalI fragment from pSPCBI-2 were ligated to yield pBC2. In the plasmid pBC2, the alpha 1A (BI-2 alpha 1) subunit cDNA has a substitution of the nucleotide sequence encoding residues 1-777 of the alpha 1C subunit for the sequence encoding the amino acid residues 1-707.

CDTB1-- The 7.2-kb XbaI/PflMI fragment from pCARD3, the 3.1-kb SphI/XbaI fragment from pSPCBI-2, and the annealed oligonucleotides CTGGATGAATACGTGCGGGTCTGGGCCGAGTACGACCCTGCTGCTTGGGGACGCATG and CGTCCCCAAGCAGCAGGGTCGTACTCGGCCCAGACCCGCACGTATTCATCCAGATG were ligated to yield pBC4. The plasmid pBC4 carries cDNA for the alpha 1C subunit which has the C-terminal tail residues 1524-2127 replaced with the tail residues 1838-2424 of the alpha 1A (BI-2 alpha 1) subunit.

Subcloning and mutagenesis procedures were verified by restriction enzyme analysis and DNA sequencing.

Functional Expression of Wild-type, Mutant, and Chimeric Ca2+ Channels in Xenopus Oocytes

After removal of the follicular cell layer (15), Xenopus oocytes were injected either with 0.3 µg/µl alpha 1 (alpha 1B, alpha 1A, alpha 1C, mutant alpha 1, or chimeric alpha 1) cRNA in combination with 0.2 µg/µl alpha 2 cRNA and 0.1 µg/µl beta 1a cRNA; 0.03 µg/µl DOR cRNA; 0.05 µg/µl Gi3alpha cRNA, or 0.05 µg/µl Gbeta 1 cRNA, and 0.025 µg/µl Ggamma 2 cRNA, unless otherwise specified. The average volume of injection was ~50 nl per oocyte. The injected oocytes were incubated for 3-5 days and then subjected to electrophysiological measurements at 21 ± 2 °C.

In order to unmask the effect of endogenous Galpha (16), a deoxyoligonucleotide 20-mer (AGO) of the following sequence was used in antisense experiments, CATGACTGCTCGGGGGGGGA. The AGO antisense oligonucleotide is complementary to nucleotides (-17 to 3) of the Xenopus Goalpha mRNA (23). The endogenous Xenopus Goalpha nucleotide sequence shows 40% identity with the corresponding nucleotide sequence of Goalpha cRNA injected. This antisense oligonucleotide (0.1 µg/µl, 50 nl) was injected 12-16 h prior to electrophysiological measurements.

The oocytes were positioned in a recording chamber (1.0 ml in volume) and were perfused with a Ba2+ solution containing 40 mM Ba2+, 50 mM Na+, 2 mM K+, and 5 mM HEPES (pH 7.5 with methanesulfonic acid). Membrane currents through the expressed Ca2+ channels were measured with the two-microelectrode voltage-clamp method as described previously (15). Also, the membrane potential recorded by the potential electrode was monitored. The membrane was held at -80 or -100 mV, and step depolarizations were applied to activate the Ca2+ channels. Microelectrodes were filled with 3 M KCl, and those showing resistances of 0.5-1.5 megohms were used.

We noticed slow tail currents upon repolarization as shown in Fig. 1. In these cases, the time resolution of clamping was within 4 ms and the potential error was within 3% of the command pulse, indicating no serious space-clamping problems in characterizing Ca2+ channel currents.

Unless otherwise stated, statistical data were represented by the mean and S.E.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Functional Expression of the N-, P/Q-, and L-type Ca2+ Channels in Xenopus Oocytes-- To establish a recombinant expression system, where current inhibition mediated by G-proteins can be reconstituted individually, HVA N-, P/Q-, and L-type Ca2+ channels were co-expressed in Xenopus oocytes by injection of cRNAs for three (alpha 1, alpha 2, and beta 1) Ca2+ channel subunits and the delta -opioid receptor (DOR). Their responses to the opioid peptide, Leu-enkephalin (Leu-EK), were examined by the two-microelectrode voltage-clamp technique.

Fig. 1 illustrates inward membrane currents recorded from Xenopus oocytes that were injected with the N-type alpha 1B (Fig. 1, A and B), P/Q-type alpha 1A (Fig. 1, C and D), and L-type alpha 1C (Fig. 1, E and F) cRNA in combination with alpha 2 and beta 1a subunits and DOR. As shown by the current-voltage (I-V) relationships in Fig. 1, step depolarizations from a holding potential of -80 mV produced long lasting inward currents at potentials more positive than -30 mV for oocytes injected with alpha 1B (Fig. 1B) and alpha 1A subunits (Fig. 1D) and at potentials positive to -50 mV with alpha 1C (Fig. 1F).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   Functional expression of N- (alpha 1B), P/Q- (alpha 1A), and L-type (alpha 1C) Ca2+ channels in Xenopus oocytes. Membrane currents were recorded from oocytes injected with cRNA for one of three kinds of Ca2+ channel alpha 1 subunits (alpha 1B (A and B), alpha 1A (C and D), and alpha 1C (E and F)) in combination with cRNAs for Ca2+ channel alpha 2 and beta 1a subunits and cRNA for DOR. The external solution contained 40 mM Ba2+. A, C, and E; B, D, and F, left, inward Ba2+ currents induced by step depolarizations (250 or 300 ms in duration) from a holding potential of -80 mV to +10 mV. The records were taken before (A, C, and E; control; B, D, and F; line 1) and 20 s after application of 0.1 or 1 µM omega -CTx (A), 0.3 µM omega -Aga (C), 10 µM nifedipine (E), or 1 µM Leu-EK (B, D, and F; line 2), and 10 min after removal of Leu-EK (B, D and F; line 3). B, D, and F, right, current-voltage (I-V) relationships for the records shown in B, D, and F, left. The membranes were held at -80 mV and depolarized by a 250 (or 300)-ms test pulse from -80 mV to +50 mV with 10 mV steps. Peak currents before (open circles) and during (filled circles) exposure to 1 µM Leu-EK and after removal of Leu-EK (filled triangles) are plotted against the membrane potential of test pulses. Note that the peak current is inhibited prominently by Leu-EK either in B or D. Therefore, in the following experiments, the amplitude of peak currents was used as a measure of the response to Leu-EK. In practice, peak currents were measured before and after application of a receptor agonist, and the change was expressed as their ratio.

As shown in Fig. 1A, inward currents recorded from oocytes implanted with alpha 1B, alpha 2, beta 1a and DOR showed a time-dependent inactivation and a sensitivity to 0.1 µM omega -conotoxin GVIA (omega -CTx), an N-type Ca2+ channel blocker. This current was not blocked by 0.3 µM omega -agatoxin IVA (omega -Aga), a P/Q-type Ca2+ channel blocker (n = 3), nor 10 µM nifedipine, a dihydropyridine (DHP)-derivative L-type Ca2+ channel blocker (n = 12). Application of Leu-EK (1 µM) to the bathing solution inhibited inward current from N-type channels within seconds (Fig. 1B). The inhibited current displayed "kinetic slowing" of the current activation as well as an overall reduction in peak current (24, 25).

As shown in Fig. 1, C and D, oocytes expressing alpha 1A, alpha 2, beta 1a, and DOR exhibited inward currents which were blocked by 0.3 µM omega -Aga (Fig. 1C) but not by 0.3 µM omega -CTx (n = 3) nor 10 µM nifedipine (n = 9), consistent with previous findings. Application of Leu-EK to oocytes expressing alpha 1A also displayed Ca2+ channel modulation, similar to that observed with alpha 1B. Since DOR translates a signal to downstream effectors through activation of G-proteins (26), it is conceivable that the Leu-EK-induced inhibition of alpha 1B and alpha 1A currents is mediated by endogenous oocyte G-proteins.

Following the injection of L-type alpha 1C cRNA in combination with alpha 2, beta 1a, and DOR cRNAs, inward currents were observed (Fig. 1, E and F), which were sensitive to 10 µM nifedipine (Fig. 1E) (18), but were not blocked by 0.3 µM omega -CTx (n = 3) nor 0.3 µM omega -Aga (n = 3). By contrast to the omega -CTx-sensitive N-type or omega -Aga-sensitive P/Q-type currents, these currents were not inhibited by Leu-EK (Fig. 1F).

Thus, based on the electrophysiological and pharmacological properties, alpha 1B, alpha 1A, and alpha 1C channels functionally expressed in oocytes possessed the native characteristics of omega -CTx-sensitive N-type, omega -Aga-sensitive P/Q-type, and DHP-sensitive L-type Ca2+ channels, respectively. The Leu-EK-induced inhibition of inward Ba2+ currents was not appreciably observed when either DOR (n = 6) or the alpha 1 subunit of Ca2+ channel (n = 6) cRNA was injected alone. In addition, omega -CTx- (n = 13), omega -Aga- (n = 3), and DHP (n = 15)-sensitive Ba2+ currents were not detectable without injection of alpha 1B, alpha 1A, and alpha 1C subunit cRNAs.

Effects of Galpha and Gbeta gamma on the N- and P/Q-type Ca2+ Channels-- To determine which arm of the G-protein complex contributes to regulation of N- and P/Q-type Ca2+ channels, either Gi3alpha cRNA or Gbeta 1 plus Ggamma 2 cRNAs were injected into oocytes in combination with Ca2+ channel alpha 1 (alpha 1B or alpha 1A), alpha 2, and beta 1a subunits cRNAs and DOR cRNA.

As detailed in the companion paper (16), agonist-induced inhibition of N-type alpha 1B currents (Figs. 2A and 3A, B3) and P/Q-type alpha 1A currents (Fig. 4, A and C, B1) was further pronounced in oocytes injected with Gi3alpha cRNA. By contrast, inhibition of alpha 1B and alpha 1A channels was not potentiated in oocytes co-expressed with Gbeta 1gamma 2. However, Ba2+ currents recorded from oocytes expressed with Ca2+ channel alpha 1B, alpha 2, and beta 1a subunits, DOR and Gbeta 1gamma 2, were increased by a large conditioning depolarization to +80 mV without receptor stimulation (Fig. 3A, B3, open bar; also see Fig. 2 in the companion paper). This may indicate that the exogenous Gbeta gamma can inhibit the N-type Ca2+ channel by itself, therefore not requiring receptor-mediated activation of G-proteins. Prepulse facilitations were not prominent, but still significant, for the alpha 1A channel when injected with Gbeta gamma (Fig. 4C, B1). Moreover, L-type alpha 1C currents were never inhibited by the application of agonist nor facilitated by administration of a prepulse (Figs. 2A and 3A, CD).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Multiple structural domains in alpha 1B channels for the inhibition mediated by Gi3alpha and Gbeta 1gamma 2. A, left, schematic representation of mutant alpha 1B and alpha 1C channels and chimeric channels composed of alpha 1B (hatched boxes) and alpha 1C sequences (open boxes). Deletion or replacement of the C terminus and/or substitution of the intracellular loop between segment I and II (loop 1) were carried out in the two types of alpha 1 subunit of Ca2+ channels. Nomenclature is as follows: B3, wild-type alpha 1B; CD, wild-type alpha 1C; T or Tail, C terminus; L or L1, loop 1; Delta , deletion. Functional expression of Ca2+ channels is also indicated (+ and -). A, right, responsiveness of mutant and chimeric alpha 1 channels to 1 µM Leu-EK in oocytes implanted with DOR, alpha 1, alpha 2, and beta 1a in combination with Gi3alpha (filled boxes), Gbeta 1gamma 2 (hatched boxes), or no exogenous G-protein (open boxes). Positive and negative responses represent inhibition and facilitation of channels, respectively. In oocytes from which endogenous Ca2+ currents were recorded, alpha 1 subunit was not co-expressed (No exogenous Ca2+ channel). In other oocytes, wild-type, mutant, and chimeric alpha 1 subunits as indicated for each on the left side were co-expressed. The antisense oligonucleotide, AGO, was used. The responses to Leu-EK were measured (see Fig. 1 legend) and expressed as ratios of inhibition. The number of oocytes examined for each data are 4-68. B, representative current traces for the mutant alpha 1B (B3TDelta 1) and alpha 1C (CDTDelta 1) channels and the chimeric alpha 1B/alpha 1C (B3LCD, B3LCDTDelta 1, CDTB3, CDLB3, and CDLB3TB3) channels in oocytes co-expressed with DOR, Gi3alpha , and Ca2+ channel alpha 2 and beta 1a subunits. The pulse protocol was identical to that in Fig. 1 for alpha 1B channels. Concentrations of Leu-EK, omega -CTx, and nifedipine used were 1, 0.3, and 10 µM, respectively. The antisense oligonucleotide, AGO, was used.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3.   The C terminus and the loop 1 of alpha 1B channels determining the interactions with Gi3alpha and Gbeta 1gamma 2. A and B, upper, comparisons of wild-type, mutant, and chimeric alpha 1B and alpha 1C channels with respect to the Leu-EK-induced inhibition via Gi3alpha and to the prepulse facilitation via Gbeta 1gamma 2. The responses of 7 different channel types, as indicated with schemes, to 1 µM Leu-EK (horizontal bars), prepulse (open circles), or both (filled circles) were measured in oocytes co-expressing with DOR, alpha 2, and beta 1a in combination with G-protein subunit as indicated. The pulse protocols were as follows: a 200-ms test pulse was applied to +10 mV from a holding potential of -100 mV, which was preceded, if necessary, by a depolarizing prepulse (30 ms in duration) to +80 mV and then by a 20-ms repolarization to -100 mV. The antisense oligonucleotide, AGO, was used. The number of oocytes examined for each data are 4-23 in A and 4-10 in B. The deletion sites for these mutant alpha 1B channels in B are represented schematically in Fig. 5A. A and B, lower, Leu-EK-induced inhibition as mediated by Gi3alpha (filled bars) and prepulse-induced facilitation as mediated by Gbeta 1gamma 2 (open bars). Differences in the response to Leu-EK between oocytes with and without expression of Gi3alpha and changes induced by prepulse without Leu-EK in oocytes expressing Gbeta 1gamma 2, as shown in upper, are represented as Delta  Response.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4.   Regulation of P/Q-type (alpha 1A) channels by Galpha and Gbeta gamma . A, left, schematic representation of mutant alpha 1A channels and chimeric channels composed of alpha 1A (filled boxes) and alpha 1C sequences (open boxes). Nomenclature is given in the legend of Fig. 2A, except that B1 denotes wild-type alpha 1A. Functional expression of Ca2+ channels is also indicated (+ and -). A, right, responsiveness of mutant alpha 1A and chimeric alpha 1A/alpha 1C channels to 1 µM Leu-EK in oocytes implanted with DOR, alpha 1, alpha 2, and beta 1a in combination with Gi3alpha (filled boxes), Gbeta 1gamma 2 (hatched boxes), or no exogenous G-protein (open boxes). In oocytes from which endogenous Ca2+ currents were recorded, alpha 1 subunit was not co-expressed (No exogenous Ca2+ channel). In other oocytes, wild-type, mutant, and chimeric alpha 1 subunits as indicated for each on the left side were co-expressed. The antisense oligonucleotide, AGO, was used. The responses to Leu-EK were measured (see Fig. 2A) and expressed as ratios. The number of oocytes examined for each data are 4-18. B, representative current traces for the mutant (B1TDelta 2) and chimeric (CDTB1) alpha 1A channels in oocytes implanted with DOR, Gi3alpha , alpha 2, and beta 1a in combination with each mutant or chimeric alpha 1. The pulse protocol was identical to that as in Fig. 1 for the alpha 1A channel. Concentrations of Leu-EK and nifedipine used were 1 and 10 µM, respectively. The antisense oligonucleotide, AGO, was used. C, comparisons of wild-type, mutant, and chimeric alpha 1A channels with respect to the Leu-EK-induced inhibition via Gi3alpha and to the prepulse facilitation via Gbeta 1gamma 2. The responses of three different channel types, as indicated, to 1 µM Leu-EK (horizontal bars), prepulse (open circles), or both (filled circles) were measured (see Fig. 3A) and expressed as ratios. The antisense oligonucleotide, AGO, was used. The number of oocytes examined for each data are 4-18.

Combination of alpha 1B, alpha 2, and beta 1a Subunits Is Required for the Inhibitory Regulations by Gi3alpha and Gbeta gamma -- The alpha 1 subunit of the Ca2+ channel forms the channel pore (4). As a result of this, N-type Ca2+ channel currents were not detectable without the injection of alpha 1B subunit cRNA (n = 13). However, when the alpha 1B subunit was expressed without the alpha 2 and beta 1a subunits, Leu-EK still produced channel inhibition and slowing of the alpha 1B currents via Gi3alpha (n = 8). Moreover, the opioid-induced inhibition of alpha 1B currents was larger in the absence of beta 1a subunit (n = 15) and did not change without the alpha 2 subunit (n = 8) (27, 28). In addition, the prepulse facilitation of alpha 1B currents mediated via Gbeta 1gamma 2 (see Fig. 3) was also present without the alpha 2 and beta 1a subunits (n = 5). These results suggest that both Galpha and Gbeta gamma can interact with the alpha 1 subunit regardless of subunit composition and are able to produce channel modulation.

Interaction of Galpha and Gbeta gamma with Mutant and Chimeric alpha 1B Channels-- By aiming at identifying the regions on the alpha 1B channel interacting with Gi3alpha and Gbeta 1gamma 2, chimeric channels between alpha 1B (Fig. 2A, B3) and alpha 1C (Fig. 2A, CD) were constructed. These constructs were generated (Fig. 2), taking advantage of the inability of alpha 1C channels to be inhibited by G-proteins (Figs. 1F, 2A, and 3A). Neither a deletion of the C-terminal region of alpha 1B (amino acid residues 1913-2339, see Fig. 5) nor a replacement of the C-terminal region of alpha 1B (amino acid residues 1912-2339) by that of alpha 1C (amino acid residues 1658-2171) affected the Leu-EK-induced inhibition of Ca2+ channels in oocytes co-expressed with Gi3alpha and Gbeta 1gamma 2 (Fig. 2, A and B; B3TDelta 1 and B3TCD, respectively). Moreover, currents through the chimeric alpha 1B channel, B3LCD, in which a region of alpha 1C (amino acid residues 411-740) containing the intracellular loop joining motif I and II (loop 1) was substituted for that of alpha 1B (amino acid residues 332-668), were inhibited by Leu-EK in oocytes co-expressed with Galpha or Gbeta gamma (Fig. 2, A and B, B3LCD). However, a deletion of the C-terminal region of B3LCD (corresponding to amino acid residues 1913-2339 of alpha 1B) produced a chimeric channel, B3LCDTDelta 1, which was insensitive to Leu-EK (Fig. 2, A and B, B3LCDTDelta 1).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Schematic representation of the sites on alpha 1B subunit for making the deletion mutants. A, positions of the deletion (LDelta 1, LDelta 2, LDelta 3, and TDelta 1), the loop 1, and the C terminus are indicated by the number of the amino acid residues for alpha 1B subunit (33) and alpha 1A (BI-1 alpha 1) subunit (20) in parentheses. The deletion sites are indicated by the crossing bars, and the cytoplasmic side below the horizontal lines. The asterisk denotes the binding site for Ca2+ channel beta  subunit (31), and the filled circle denotes the phosphorylation sites for protein kinase C (10). B, mutations introduced into the alpha 1B and alpha 1A subunits. The numbers of amino acid residues deleted are indicated.

On the other hand, chimeric alpha 1C channels such as CDTB3, CDLB3, and CDLB3TB3, in which the C-terminal region of alpha 1C (amino acid residues 1658-2171), the region of alpha 1C containing loop 1 (amino acid residues 318-610), or both, were replaced by the corresponding region(s) of alpha 1B (amino acid residues 1912-2339, 242-537, or both, respectively), gained sensitivities to Leu-EK (Fig. 2, A and B, CDTB3, CDLB3, and CDLB3TB3).

The mutant and chimeric alpha 1B (Fig. 2B, B3TDelta 1, B3LCD, and B3LCDTDelta 1; n = 5) and alpha 1C channels (Fig. 2B; CDTDelta 1, CDTB3; n = 5) were sensitive to omega -CTx and nifedipine, respectively, as expected from earlier studies locating interaction sites of both omega -CTx (29) and DHPs (30). In addition, deletion of the C-terminal region of alpha 1C (amino acid residues 1981-2171) produced a mutant channel, CDTDelta 1, whose activities were rather enhanced by Leu-EK, when Gi3alpha or Gbeta 1gamma 2 was co-expressed (Fig. 2, A and B).

Effects of Prepulse on the Inhibitions of Mutant and Chimeric N-type Ca2+ Channels via Gi3alpha or Gbeta 1gamma 2-- The experiments described above, in which the wild-type alpha 1B and alpha 1A channels were used, demonstrated that Galpha plays a significant role in G-protein-mediated inhibition of neuronal Ca2+ channels. However, there is a possibility that Galpha exerts its effect indirectly upon Ca2+ channels through Gbeta gamma . To exclude this possibility, it was necessary to investigate further molecularly and structurally the dependence of Galpha on Gbeta gamma when interacting with Ca2+ channel alpha 1 subunits.

In order to clarify further the modulation sites on the alpha 1B channel by Gi3alpha and Gbeta 1gamma 2, responses to Leu-EK and a large prepulse were studied in oocytes implanted with mutant and chimeric Ca2+ channel alpha 1, alpha 2, and beta 1a subunits, DOR, and Gi3alpha (or Gbeta 1gamma 2) (Fig. 3). For clarity, changes induced by application of a prepulse without Leu-EK, in oocytes expressing Gbeta 1gamma 2, and differences in the response to Leu-EK between oocytes with and without expression of Gi3alpha , are summarized in Fig. 3 (Delta  Response). In the case of wild-type alpha 1B channels, co-expressed with Gbeta 1gamma 2, a remarkable prepulse facilitation was observed in the absence of Leu-EK (Fig. 3A, B3, open bar), whereas the alpha 1B chimera, B3LCD (having a loop 1 region derived from alpha 1C), when co-expressed with Gbeta 1gamma 2, displayed a complete loss of prepulse facilitation (Fig. 3A, B3LCD, open bar). By contrast, the alpha 1C chimera, CDLB3 (having a loop 1 region derived from alpha 1B), restored the prepulse facilitation when Gbeta 1gamma 2 was co-expressed (Fig. 3A, CDLB3, open bar). Moreover, deletion of the C terminus of alpha 1B enhanced the prepulse facilitation in oocytes co-expressed with Gbeta 1gamma 2 (Fig. 3A, B3TDelta 1, open bar).

When Gi3alpha , instead of Gbeta 1gamma 2, was co-expressed, the agonist-induced inhibition of Ca2+ currents was strengthened in wild-type alpha 1B channels as compared with control oocytes, in which no exogenous G-proteins were co-expressed (Fig. 3A, B3, filled bar). This large inhibition was abolished by applying a large conditioning prepulse (filled circle). In chimeric alpha 1B channels, B3LCD, such a potentiation of current inhibition by Gi3alpha was still detectable (Fig. 3A, B3LCD, filled bar) and almost entirely relieved by applying a prepulse (filled circle). Furthermore, deletion of the C terminus of B3LCD abolished the sensitivity to the agonist-induced inhibition with Gi3alpha (Fig. 3A, B3LCDTDelta 1, filled bar). By contrast, the alpha 1C chimera, CDTB3, having a C terminus derived from alpha 1B, acquired sensitivity to the agonist-induced current inhibition with Gi3alpha (Fig. 3A, CDTB3, filled bar), but the prepulse procedure failed to influence this inhibition (filled circle). The deletion alone of the C terminus of alpha 1B channel did not affect the channel responsiveness to Gi3alpha (Fig. 3A, B3TDelta 1, filled bar).

To gain a clearer understanding of contributions of loop 1 in more detail, Ba2+ currents through mutant alpha 1B channels with four kinds of loop 1 deletions were studied (Fig. 3B). In the mutant channel, B3LDelta 2, with a deletion of amino acid residues 384-420 of alpha 1B (Fig. 5A, LDelta 2), the prepulse facilitation in oocytes co-expressed with Gbeta 1gamma 2 was diminished (Fig. 3B, B3LDelta 2, open bar). However, currents through the mutant channel, B3LDelta 3, with a deletion of amino acid residues 421-470 of alpha 1B (Fig. 5A, LDelta 3), were facilitated by a prepulse when Gbeta 1gamma 2 was co-expressed (Fig. 3B, B3LDelta 3, open bar). In both mutant channels, the potentiation by Gi3alpha of Leu-EK-induced inhibition of currents was observed (filled bar). These characteristics of B3LDelta 2 indicate that deletion of loop 1, which nearly abolished interaction of the alpha 1B subunit with Gbeta gamma , did not impair interactions with Galpha . On the other hand, we could not detect expression (n = 6) of the mutants, B3LDelta 1 and B3LDelta 4, in which either a part of the loop 1 of alpha 1B (amino acid residues 366-383, see Fig. 5A, LDelta 1) or a part of the loop 1 of alpha 1B that combines the regions covered by LDelta 2 and LDelta 3 (amino acid residues 384-470, see Fig. 5A) were deleted. Moreover, currents through the mutant channel, B3LDelta 2, were not detectable in the absence of Ca2+ channel beta  subunit expression (n = 5). Because B3LDelta 2 was devoid of the segment corresponding to the major binding site for the beta  subunit (31), this indicates that there may be another interaction site on the alpha 1B channel for beta  subunits (32).

Interaction Site on the P/Q-type Ca2+ Channel for G-protein-- In order to determine the interaction site on the P/Q-type Ca2+ channel for Galpha and Gbeta gamma , procedures similar to those for alpha 1B channels (Figs. 2 and 3) were applied to alpha 1A channels (Fig. 4). In oocytes co-expressed with Gi3alpha or Gbeta 1gamma 2 together with DOR and Ca2+ channel (alpha 1, alpha 2 and beta 1a subunits), deletion of the C terminus of alpha 1A (amino acid residues 2015-2273) reduced the sensitivity to Leu-EK (Fig. 4A, B1TDelta 2) as compared with the wild-type alpha 1A (B1). This stands clearly in contrast to the mutant alpha 1B channel (B3TDelta 1), in which deletion of the C terminus alone did not influence the sensitivity to Leu-EK (Fig. 2A). In addition, the chimeric alpha 1C channel (CDTB1), in which the C terminus of alpha 1C (amino acid residues 1524-2127) was replaced by that of alpha 1A (amino acid residues 1838-2424), acquired sensitivity to Leu-EK (Fig. 4A, CDTB1), whereas the wild-type alpha 1C channel was not affected by Leu-EK (Figs. 2A and 3A). Another chimeric alpha 1C/alpha 1A channel (CDB1), in which the N terminus of alpha 1C (amino acid residues 1-777) substituted for that of alpha 1A (amino acid residues 1-707), still exerted sensitivities to Leu-EK (Fig. 4A, CDB1). As shown in Fig. 4B, currents through the B1TDelta 2 and CDTB1 channels were comparable to those through the wild-type alpha 1A and alpha 1C channels (Fig. 1), and the CDTB1 currents were blocked by nifedipine.

Next, the mutant (B1TDelta 2) and chimeric (CDTB1) alpha 1A channels were further characterized using a double-pulse protocol. Fig. 4C illustrates responses to application of a prepulse and Leu-EK by these channels and also demonstrates changes induced by prepulse without Leu-EK in oocytes expressing Gbeta 1gamma 2 as well as differences in the response to Leu-EK between oocytes with and without expression of Gi3alpha . The potentiation by Gi3alpha of Leu-EK-induced inhibition observed in the wild-type alpha 1A (Fig. 4C, B1, filled bar) almost disappeared in the mutant alpha 1A, B1TDelta 2, having the deletion of C terminus (Fig. 4C, B1TDelta 2, filled bar). By contrast, the alpha 1C/alpha 1A chimera, CDTB1 (having the C terminus derived from alpha 1A), conferred Leu-EK sensitivity via Gi3alpha (Fig. 4C, CDTB1, filled bar). In both the wild-type alpha 1A and the chimera CDTB1, the prepulse did not abolish the potentiation of Leu-EK-induced inhibition via Gi3alpha (filled circles). In addition, when Gbeta 1gamma 2 was co-expressed instead of Gi3alpha , a small facilitation by prepulse was observed in the wild-type alpha 1A (Fig. 4C). In the mutant (B1TDelta 2) and chimera (CDTB1) channels, prepulse facilitation was not detected.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In the present study, the omega -CTx-sensitive N-type (alpha 1B) and omega -Aga-sensitive P/Q-type (alpha 1A) Ca2+ channels were functionally expressed in Xenopus oocytes, an in vivo expression system. As described, we found that Gi3alpha co-expressed in oocytes mediated receptor agonist-induced inhibition of N-type alpha 1B and P/Q-type alpha 1A channels. On the other hand, a depolarizing prepulse relieved current inhibition caused by the Gbeta 1gamma 2 complex, and the facilitatory effects were more pronounced in alpha 1B than in alpha 1A. Because responsiveness of the alpha 1B and alpha 1A channels to the inhibition mediated by Gi3alpha and Gbeta 1gamma 2 was maintained even in the absence of the Ca2+ channel auxiliary subunits alpha 2 and beta 1, the alpha 1 subunit should bear the interaction sites for both the Galpha subunit and the Gbeta gamma dimer. Finally, we defined loop 1 of alpha 1B as an interaction site for Gbeta gamma and the C termini of alpha 1B and alpha 1A for Galpha , based on the responses of mutant and chimeric channels to Galpha and Gbeta gamma .

The Native Type alpha 1B, alpha 1A, and alpha 1C Channels Expressed in Xenopus Oocytes-- The electrophysiological and pharmacological properties of the alpha 1B, alpha 1A, and alpha 1C channels determined were identical to those of the N-, P/Q-, and L-type Ca2+ channels described previously (18, 20, 33). This indicates that alpha 1B (N-type), alpha 1A (P/Q-type), and alpha 1C (L-type) Ca2+ channels were functionally expressed with the Ca2+ channel alpha 2 and beta 1 subunits in Xenopus oocytes. When DOR was further co-expressed,