JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Furukawa, T.
Right arrow Articles by Nukada, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Furukawa, T.
Right arrow Articles by Nukada, T.

J Biol Chem, Vol. 273, Issue 28, 17595-17603, July 10, 1998


Differential Interactions of the C terminus and the Cytoplasmic I-II Loop of Neuronal Ca2+ Channels with G-protein alpha  and beta gamma Subunits
II. EVIDENCE FOR DIRECT BINDING*

Taiji Furukawaab, Reiko Miuraa, Yasuo Moricd, Mark Strobeckcd, Kazuyuki Suzukia, Yoshiyasu Ogiharaae, Tomiko Asanof, Rika Morishitaf, Minako Hashiig, Haruhiro Higashidag, Mitsunobu Yoshiih, and Toshihide Nukadaai

From the a Department of Neurochemistry and h Department of Neurophysiology, Tokyo Institute of Psychiatry, 2-1-8 Kamikitazawa, Setagaya-ku, Tokyo 156, the b Department of Internal Medicine, Faculty of Medicine, Teikyo University, 2-11-1 Kaga, Itabashi-ku, Tokyo 173, the c Department of Information Physiology, National Institute for Physiological Sciences, Okazaki, Aichi 444, Japan, the d Institute of Molecular Pharmacology and Biophysics, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267-0828, e New Product Research Laboratories III, Daiichi Pharmaceutical Co., Tokyo R&D Center, 1-16-13 Kita-Kasai, Edogawa-ku, Tokyo 134, the f Department of Biochemistry, Institute for Developmental Research, Aichi Human Service Center, 713-8 Kamiya-cho, Kasugai, Aichi 480-03, and the g Department of Biophysics, Neuroinformation Research Institute, Kanazawa University School of Medicine, 13-1 Takaramachi, Kanazawa, Ishikawa 920, Japan

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The present study was designed to obtain evidence for direct interactions of G-protein alpha  (Galpha ) and beta gamma subunits (Gbeta gamma ) with N- (alpha 1B) and P/Q-type (alpha 1A) Ca2+ channels, using synthetic peptides and fusion proteins derived from loop 1 (cytoplasmic loop between repeat I and II) and the C terminus of these channels. For N-type, prepulse facilitation as mediated by Gbeta gamma was impaired when a synthetic loop 1 peptide was applied intracellularly. Receptor agonist-induced inhibition of N-type as mediated by Galpha was also impaired by the loop 1 peptide but only when applied in combination with a C-terminal peptide. For P/Q-type channels, by contrast, the Galpha -mediated inhibition was diminished by application of a C-terminal peptide alone. Moreover, in vitro binding analysis for N- and P/Q-type channels revealed direct interaction of Galpha with C-terminal fusion proteins as well as direct interaction of Gbeta gamma with loop 1 fusion proteins. These findings define loop 1 of N- and P/Q-type Ca2+ channels as an interaction site for Gbeta gamma and the C termini for Galpha .

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

High voltage-activated (HVA)1 Ca2+ channels are negatively regulated by guanine nucleotide-binding regulatory proteins (G-proteins) in various neuronal preparations, including neuroblastoma × glioma hybrid NG108-15 cells (1, 2), dorsal root ganglion neurons (3, 4), sympathetic neurons (5), and rat pituitary GH3 cells (6). This response appears to be controlled by a membrane-delimited mechanism via pertussis toxin (PTX)-sensitive G-proteins, in which the Go alpha  subunit has been shown to mediate an inhibitory signal to HVA Ca2+ channels. The primary structures of multiple subtypes of G-protein alpha  subunits (Galpha ) including Goalpha have been deduced by molecular cloning and sequencing of their cDNAs. These studies revealed very similar but distinct amino acid sequences for each subtype cloned (7). It remains to be seen, however, which subtypes of Galpha preferentially interact with HVA Ca2+ channels such as N- and P/Q-types. In the previous study using mutant and chimeric channels expressed in Xenopus oocytes (8), our results provided evidence that the cytoplasmic I-II loop (referred to as "loop 1" in the present study) of N-type (alpha 1B) Ca2+ channels is a regulatory site for the G-protein beta gamma dimer (Gbeta gamma ) and the C termini of P/Q- (alpha 1A) and N-type Ca2+ channels for Galpha . However, this does not answer the question as to whether Galpha , as well as Gbeta gamma (9, 10), directly interact with these Ca2+ channels.

To address these issues, we have expressed alpha 1B and alpha 1A HVA Ca2+ channels in Xenopus oocytes, in which the effects of intracellularly applied loop 1 and C-terminal peptides derived from alpha 1B and alpha 1A were investigated. Furthermore, a direct association of Galpha and Gbeta gamma with these Ca2+ channels was determined by in vitro binding using glutathione S-transferase (GST) proteins fused with the loop 1 and the C-terminal segments of alpha 1B or alpha 1A. These results, taken together with the findings of the previous study (8), define the interaction sites of Galpha and Gbeta gamma within Ca2+ channels.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In Vitro Transcription-- The 1.8-kilobase pair NcoI/SalI fragment containing the entire coding region of the beta 2-adrenergic receptor (beta 2AR) (11) was inserted into the HindIII site of the pSPA2 vector (12), to yield pSPbeta 2AR. The beta 2AR cDNA was kindly provided by Dr. Robert J. Lefkowitz. The pSPA1, pSPA2, pSP72, pSP65, and pSP64 recombinant plasmids carrying the entire protein-coding sequences of Galpha (Gi1alpha , Gi2alpha , Gi3alpha , Go1alpha , Gzalpha , and Gsalpha ), Gbeta 1, Ggamma 2, delta -opioid receptor (DOR), and the Ca2+ channel alpha 1B, alpha 1A, alpha 1C, alpha 2, and beta 1a subunits were described previously (8, 12-16). Nucleotide sequence analyses revealed that the deduced amino acid sequence of Gi2alpha was similar to that reported (17) except that Gln-99, Ala-113, Met-119, Thr-280, and Gln-281 were determined as Ser (TCC), Thr (ACG), Val (GTG), Ile (ATA), and His (CAC), respectively, in our clone, pG2alpha 2 (15).

cRNAs specific for alpha 1A, alpha 1B, alpha 1C, alpha 2, and beta 1a subunits of the Ca2+ channel, DOR, beta 2AR, and six isoforms of Galpha , Gbeta 1, or Ggamma 2 were synthesized in vitro using the MEGAscript SP6 kit (Ambion).

Functional Expression of Ca2+ Channels in Xenopus Oocytes-- According to the methods described in the companion paper (8), Xenopus oocytes were injected with cRNAs and subjected to electrophysiological measurements. cRNAs were used either with 0.3 µg/µl alpha 1 (alpha 1B, alpha 1A, or alpha 1C) cRNA in combination with 0.2 µg/µl alpha 2 cRNA and 0.1 µg/µl beta 1a cRNA; 0.03 µg/µl receptor (DOR or beta 2AR) cRNA; 0.05 µg/µl Galpha cRNA; or 0.05 µg/µl Gbeta 1 cRNA and 0.025 µg/µl Ggamma 2 cRNA, unless otherwise specified.

The antisense oligonucleotide AGO (0.1 µg/µl, 50 nl) complementary to the Xenopus Goalpha mRNA (8) was injected 12-16 h prior to electrophysiological measurements. The sense oligonucleotide SGO, TCCCCCCCCGAGCAGTCATG, complementary to AGO was applied in the same manner as AGO. The following six kinds of peptides (Sawady, Japan) were synthesized based upon the amino acid sequence of the alpha 1B or alpha 1A subunits (see Fig. 4): PL1 (amino acid residues 366-384 of alpha 1B), PB3T1 (amino acid residues 1934-1943 of alpha 1B), PB3T2 (amino acid residues 2016-2025 of alpha 1B), PB3T3 (amino acid residues 1907-1925 of alpha 1B), PB3T4 (amino acid residues 1931-1949 of alpha 1B), and PPQT1 (amino acid residues 2028-2046 of alpha 1A). The peptide, PL1, also corresponds to the amino acid residues 370-388 of alpha 1A. These synthetic peptides (10 µM) were injected 15 h prior to electrophysiological measurements. Injection of 50 nl of 10 µM cyclic AMP or 10 units/µl catalytic subunit of cyclic AMP-dependent protein kinase A (PKA) (Sigma) was carried out 30 min prior to electrophysiological measurements. For the pretreatment with 1-(5-isoquinolinylsulfonyl)-2-methyl-piperazine (H7), the oocytes were incubated with 100 µM H7 for 1 h prior to measurement. In experiments in which PTX was used, the oocytes were preincubated with the toxin (200 ng/ml) for about 24 h prior to electrophysiological measurements.

In some experiments, multiple single channel events in a membrane patch were recorded from oocytes as an ensemble average (or "pseudomacroscopic"), using an EPC-7 patch-clamp amplifier (List Electronics, Darmstadt, Germany). The procedure was similar to that described elsewhere (14). Cell-attached membrane patches were obtained using fire-polished borosilicate pipettes (Narishige, GD-1.5, Japan) having a resistance of 2-4 megohms (tip diameter ~1 µm) when filled with the pipette solution. The pipette solution contained 110 mM BaCl2 and 10 mM HEPES (pH 7.4 with tetraethylammonium-OH). Oocytes that were implanted with alpha 1B, alpha 2, beta 1a, DOR, and Gi3alpha , and then injected with the antisense AGO, were bathed in a depolarizing solution consisting of 90 mM K+, 10 mM Na+, 1 mM Mg2+, 1 mM Ca2+, 104 mM Cl-, and 5 mM HEPES (pH 7.5 with KOH). Under these experimental conditions, the average membrane potential was -2 ± 4 mV (n = 5). To apply Leu-enkephalin (Leu-EK) inside the patch electrode, a thin polyethylene tube having a tapered tip of about 100 µm in diameter was inserted into the glass pipette and used as an inlet tubing (18). Through this thin tubing, near (about 0.5 mm) the tip of the patch pipette, the pipette solution containing 50 µM Leu-EK was applied slowly using a syringe microinjector. Because the volume of injection was small (0.5-1.0 µl, about 1/50 volume of the solution in the pipette), no waste chamber (reservoir) was attached to the patch electrode. A negative pressure of about 30-40 cm H2O was applied to the patch electrode to minimize the mechanical effects of the pressure injection. Data acquisition and analysis were done on a computer using the software, DAAD system (19).

Unless otherwise stated, statistical data were represented by the mean and S.E.

Expression of Exogenous Galpha in NG108-15 Cells-- By using a HindIII linker, the Galpha cDNA fragment (15) containing the entire protein coding segment of Gi1alpha , Gi2alpha , Gi3alpha , or Go1alpha was inserted into the HindIII site of the pKGSalpha N (20), to yield expression vector, pKGi1alpha , pKGi2alpha , pKGi3alpha , or pKGo1alpha . NG108-15 cells in culture were transfected with the above plasmids by electroporation (20); the voltage was set at 1.7 kV and the capacitance at 20 microfarads. Transformants were selected in culture medium supplemented with 800 µg/ml G418 for 2-3 weeks. One hundred clones of the ~1 × 107 cells transfected were transformed to G418 resistance. Among these G418-resistant transformants, Galpha -transformed NG108-15 clones were selected out by blot hybridization analysis (20), using total cellular RNA prepared from each transformant and each cDNA fragment containing a protein coding segment as a probe. The presence of a hybridizable RNA species with an expected size from the construction was used to measure the transformants of NG108-15 cells by Gi1alpha , Gi2alpha , Gi3alpha , or Go1alpha (20).

The Gi1alpha - (NGi1-1 and NGi1-3), Gi2alpha - (NGi2-5 and NGi2-6), Gi3alpha - (NGi3-6 and NGi3-13), and Go1alpha -transformed clones (NGo-13 and NGo-18) and non-transfected NG108-15 cells were plated at a density of 1-5 × 105 cells/35-mm polyornithine-coated dish, as described previously (21). The cells were cultured for 2-3 weeks in "differentiation" medium supplemented with 0.25 mM dibutyryl cyclic AMP to induce differentiation (22).

Ca2+ currents were recorded by a whole cell variation of the patch-clamp technique (23) using the continuous or discontinuous single electrode voltage-clamp amplifier (Axoclamp-2, Axon Instruments). Low voltage-activated (T-type) and HVA (N/L-type) Ca2+ channel currents were recorded by a continuous mode (24); the N-type component was observed by a discontinuous mode as described previously (21). The extracellular solution consisted of 50 mM BaCl2, 30 mM NaCl, 1 mM MgCl2, 5 mM CsCl, 20 mM glucose, 20 mM tetraethylammonium chloride, 1 µM tetrodotoxin, and 10 mM HEPES (pH 7.24). The patch electrode contained solutions of the following composition: 150 mM CsCl, 1 mM MgCl2, 10 mM EGTA, 1 mM ATP, 10 mM HEPES (pH 7.3).

Muscarinic acetylcholine (ACh) receptors were stimulated by a focal application of 1 mM ACh (3 µl). In experiments in which PTX was used, the cells were preincubated with the toxin (500 ng/ml) for 12-14 h prior to the measurements. The electrophysiological experiments were carried out at approximately 30 °C. Statistical data were represented by the mean and S.E.

Goalpha and Gbeta gamma 2 Bindings-- The 1.6-kilobase pair SrfI/SalI fragment (encoding amino acid residues 1912-2339 of the alpha 1B subunit) and the 1.4-kilobase pair ScaI/BamHI fragment (encoding amino acid residues 1975-2424 of the alpha 1A subunit) were excised from the plasmids pSPB3 (16) and pSPCBI-2 (14) and fused in-frame to the GST coding sequence in pGEX-2T (Amersham Pharmacia Biotech) to produce GST fusion proteins of C terminus (GST-B3T and GST-B1T), respectively. Similarly, to produce GST fusion proteins of loop 1 (GST-B3L1 or GST-B1L1), the 380-base pair fragment amplified by polymerase chain reaction (PCR), encoding either amino acid residues 361-483 of the alpha 1B subunit or 365-489 of the alpha 1A subunit, was fused in-frame. The sets of primers for PCR were GGAGAATTCGTAAGGAGCGCGAGAGA and TCTGTGCCTTCACCATGCGCC for alpha 1B and GGGGAATTCGCAAAGAAAGGGAGCGG and AGAAGGCCTGAGTTTTGACCATG for alpha 1A. The plasmids pSPB3 and pSPCBI-2 were used as a template for PCR. Four kinds of fusion proteins or GST proteins were expressed in Escherichia coli DH5alpha , induced with 0.5 mM isopropyl-1-thio-beta -D-galactoside, and prepared according to the procedure described previously (25). The solubilized proteins were incubated with glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) at 4 °C for 5 h and washed five times with 40 volumes of phosphate-buffered saline containing 1% Triton X-100. Approximately 10 µg of GST, or GST-fusion proteins, bound to beads were used in each binding assay.

Ten micrograms of purified bovine brain Goalpha (26) and Gbeta gamma 2 complex (27) were incubated at 4 °C for 12 h with the beads that had been equilibrated with buffer solutions supplemented with 0.1% Lubrol PX and 0.6% sodium cholate, respectively. These buffers contained 20 mM Tris-HCl (pH 8), 0.1 mM EDTA, 0.5 mM dithiothreitol, 20 mM NaPO4, and a mixture of protease inhibitors (2.5 µg/ml pepstatin, 2 µg/ml phenylmethylsulfonyl fluoride, 0.02 mg/ml leupeptin, and 0.5 mM benzamidine). Then, the beads were washed with 40 volumes of the same buffer solutions and denatured by heating to 90 °C for 3 min in 200 µl of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer. Proteins (70 µl) were separated by SDS-PAGE and transferred to Immobilon membrane (Millipore) for Western blotting and detection by the ECL system (Amersham Pharmacia Biotech) as described previously (28). The antibody, GoAB, raised against the C-terminal decapeptide of Goalpha (FGo) (29) was kindly provided by Dr. Tatsuya Haga, and the antibodies, K-20 and M-14, against Goalpha and Gbeta 1, respectively, were purchased from Santa Cruz. The first antibody when used was diluted appropriately to reduce nonspecific reactivity, and the second antibody (biotinylated anti-rabbit Ig, Amersham Pharmacia Biotech) and the peroxidase-streptavidin (Vector) were both diluted at 1:2000. Each incubation was for 1 h at room temperature. The decapeptide FGo (Sawady, Japan) was synthesized based upon the amino acid sequence corresponding to the amino acid residues 345-354 of Goalpha (29). The peptide antigens sc-387P (for K-20) and sc-261P (for M-14) were also purchased from Santa Cruz. The GST fusion proteins (GST-B3T, GST-B1T, GST-B3L1, and GST-B1L1) and GST proteins were tested more than three times for their ability to bind Goalpha and Gbeta gamma 2. There was no essential difference between GoAB and K-20 in detecting specific bindings of Goalpha to the fusion proteins.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Effects of Galpha on the N- and P/Q-type Ca2+ Channels-- In the previous study (8), N-type (alpha 1B), P/Q-type (alpha 1A), and L-type (alpha 1C) Ca2+ channels were shown to be functionally expressed in Xenopus oocytes, and alpha 1B and alpha 1A channels were negatively regulated by Gi3alpha and Gbeta 1gamma 2. To determine further which Galpha isoforms regulate HVA Ca2+ channels, either Galpha cRNA (for six different isoforms: Gi1alpha , Gi2alpha , Gi3alpha , Go1alpha , Gzalpha , and Gsalpha ) or Gbeta 1 plus Ggamma 2 cRNAs were injected into oocytes in combination with the Ca2+ channel alpha 1 (alpha 1B or alpha 1A), alpha 2 and beta 1a subunits cRNAs and receptor (DOR or beta 2AR) cRNA. When Gsalpha was expressed, beta 2AR was co-expressed, and the receptor was stimulated by 1 µM isoproterenol, an agonist of the beta -adrenergic receptor.

Agonist-induced inhibitions of alpha 1B channels were less pronounced in oocytes co-injected with Gi1alpha , Gi2alpha , or Gbeta 1gamma 2 cRNA, as compared with control oocytes injected with Ca2+ channel subunits (alpha 1B, alpha 2, and beta 1a) and DOR (Fig. 1A, upper). Also, Leu-EK-induced inhibition was diminished in oocytes implanted with Gzalpha . Alternatively, the response to Leu-EK of alpha 1B channels was not affected significantly in oocytes co-expressed with Gi3alpha , Go1alpha , or Gsalpha . As shown in Fig. 1A (upper), PTX (200 ng/ml) blocked the agonist-induced inhibition of alpha 1B channels with Gi3alpha but not with Gzalpha nor Gsalpha . These observations are consistent with the fact that Gi3alpha is PTX-sensitive, and Gzalpha and Gsalpha are PTX-insensitive G-proteins (30). Because a PTX-insensitive component of the response was increased in oocytes co-expressed with the PTX-insensitive Gzalpha or Gsalpha , it was presumed that a maximal inhibition of the alpha 1B channel was already attained by endogenous oocyte G-proteins and that introduced Gzalpha or Gsalpha was capable of replacing endogenous G-proteins when exerting current inhibition. Therefore, in order to unmask the effects of exogenous Galpha , the antisense oligonucleotide, AGO, directed against mRNAs encoding Xenopus Goalpha (8), was injected prior to the electrophysiological studies. As expected, Leu-EK-induced inhibition of alpha 1B channels in control oocytes (without exogenous Galpha subtypes) was reduced by 42.3 ± 7.4% (n = 25) in the presence of antisense oligonucleotide AGO. As a result, the hierarchy of exogenous Galpha subtypes in inhibiting alpha 1B channels could be more clearly recognized (Fig. 1A, lower) when compared with antisense-free control experiments (Fig. 1A, upper). Sense oligonucleotide, SGO, to Xenopus Goalpha had no effects on the inhibition of alpha 1B channels (n = 6).


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1.   Comparisons of the potencies of various G-protein subunit combinations in mediating agonist-induced inhibitions of alpha 1B and alpha 1A channels or native HVA Ca2+ channels. A and B, effects of Galpha and Gbeta gamma on the agonist-induced inhibition of alpha 1B (A) or alpha 1A (B) currents without (upper) or with (lower) the injection of the antisense oligonucleotide, AGO, directed against mRNA encoding Xenopus Goalpha (8). The receptor (DOR or beta 2AR) and Ca2+ channel alpha 1 (alpha 1B or alpha 1A), alpha 2, and beta 1a subunits were co-expressed with Galpha or Gbeta 1gamma 2 as indicated in Xenopus oocytes. In control oocytes, no exogenous Galpha nor Gbeta 1gamma 2 was expressed. When Gsalpha was co-expressed, beta 2AR, instead of DOR, was expressed, and 1 µM isoproterenol, instead of 1 µM Leu-EK, was used for stimulating the receptor. In practice, the membrane was held at -80 mV and depolarized by a 250-ms test pulse from -80 mV to +10 mV. Since the peak current is inhibited prominently by Leu-EK (8), the amplitude of peak currents before and during exposure to Leu-EK or isoproterenol was used as a measure of the response to the agonist, and the change was expressed as a ratio of inhibition. Pretreatment (hatched bars) with 200 ng/ml PTX was carried out according to the procedures described under "Experimental Procedures." The number of oocytes examined are indicated in parentheses. * and ** indicate significant differences (p < 0.05 and p < 0.01, respectively, by analysis of variance with post hoc test) when compared with controls for the three types of experiments such as antisense(-)/PTX(-), antisense(-)/PTX(+) and antisense(+). C, dose-dependent effects of Galpha such as Go1alpha (open bars), Gi3alpha (filled bars), and Gzalpha (hatched bars) in potentiating Leu-EK-induced inhibition of alpha 1B currents. Ca2+ channel alpha 1B, alpha 2 and beta 1a subunits cRNAs and DOR cRNA were co-injected with Galpha cRNA at various concentrations indicated into Xenopus oocytes. The responses to 1 µM Leu-EK were measured and expressed as ratios of them to those in control oocytes, in which only Ca2+ channel subunits and DOR cRNAs were injected. The antisense oligonucleotide, AGO, was used. The number of oocytes examined are 8. The original responses for each before being normalized were 32.7 ± 3.5, 31.1 ± 4.2, and 25.8 ± 6.1%, respectively. D, potentiating effects of specific subtypes of Galpha on ACh-induced inhibitions of HVA Ca2+ channels in NG108-15 cells. Current responses to a focal application of 1 mM ACh (3 µl) in untransfected NG108-15 cells (NG108) and their Galpha -transformed clones with (hatched bars) or without (open bars) pretreatment of 500 ng/ml PTX were expressed as ratios of inhibition. NG108-15 cells were transformed by Galpha as indicated. The number of oocytes examined are indicated in parentheses. *p < 0.05 when compared with control untransfected NG108-15 cells for the two types of experiment such as PTX(-) and PTX(+).

After antisense treatment, the agonist-induced inhibition of N-type alpha 1B currents was further pronounced in oocytes injected with Gi3alpha , Go1alpha , Gzalpha , or Gsalpha cRNA (Fig. 1A, lower). Here, the action of Gsalpha would not be associated with adenylate cyclase, since the injection of 50 nl of 10 µM cyclic AMP (n = 3) or 10 units/µl catalytic subunit of PKA (n = 3) failed to influence alpha 1B currents. Moreover, the pretreatment with 100 µM H7, a inhibitor of cyclic nucleotide-dependent protein kinase and protein kinase C, did not affect the agonist-induced inhibition of alpha 1B currents (n = 6). However, in the case of L-type alpha 1C channels, the catalytic subunit of PKA increased their current amplitude by 82.8 ± 10.9% (n = 6). In oocytes injected with cRNAs for Ca2+ channel subunits (alpha 1B, alpha 2, and beta 1a) and beta 2AR, isoproterenol-induced inhibition of alpha 1B channels was 17.5 ± 1.2% (n = 45).

To exclude further the possibility that such diffusible second messengers might be involved in the effects of G-proteins in potentiating the agonist-induced inhibition of N-type alpha 1B channels, cell-attached patch recordings were performed (see "Experimental Procedures"). In oocytes implanted with N-type Ca2+ channel subunits, DOR and Gi3alpha , multiple single channel currents through a membrane patch were suppressed by Leu-EK applied to the patch, but the application to the rest of the cell membrane was ineffective (n = 4). The extent of inhibition was 48.0 ± 8.0% (n = 4), which was comparable to that observed for the whole cell currents of oocytes (Fig. 1A, lower). Thus, Leu-EK has to be applied directly to the recording membrane patch to induce current inhibition, indicating that the Leu-EK-induced inhibition of alpha 1B channels associated with Gi3alpha employs a membrane-delimited pathway as predicted in native neurons.

As shown in Fig. 1C, the extent to which Leu-EK inhibited alpha 1B channels was dependent on the amount of Galpha cRNA injected. The rank order of efficiency among Galpha subtypes examined was Gi3alpha  > Go1alpha  > Gzalpha . The agonist-induced current inhibition was considerably reduced when a low concentration (15 ng/µl) of Gzalpha cRNA was applied. By contrast, oocytes implanted with Gi2alpha or Gbeta 1gamma 2 cRNA showed no effect on the Leu-EK-induced current inhibition, whereas oocytes injected with Gi1alpha showed an attenuating effect (Fig. 1A, lower).

Unlike N-type alpha 1B channels (Fig. 1A, upper), P/Q-type alpha 1A channels revealed more conspicuous intensifications of the agonist-induced inhibition by exogenous Galpha , probably a result of weak masking effects of endogenous G-proteins (Fig. 1B, upper). The agonist-induced inhibition of currents was potentiated in those oocytes co-expressed with Gi1alpha , Gi2alpha , Gi3alpha , or Go1alpha but not with Gzalpha or Gsalpha , regardless of antisense oligonucleotide (AGO) injection (Fig. 1B), although AGO did attenuate the Leu-EK-induced inhibition of alpha 1A channels by 23.2 ± 8.6% (n = 6), as compared with its effect on alpha 1B channels (42.3 ± 7.4%, n = 25). In addition, the agonist-induced inhibition of alpha 1A channels was diminished in PTX-treated oocytes co-expressed with Gi3alpha (Fig. 1B, upper). In oocytes co-expressed with the PTX-insensitive Gsalpha , the blockade of agonist-induced inhibition of alpha 1A channels by PTX was at the same level as in control oocytes absent of exogenous Galpha . This finding is consistent with the observation that the agonist-induced inhibition of alpha 1A currents was not potentiated in oocytes co-expressed with Gsalpha . The inhibition of alpha 1A channels was not potentiated in oocytes co-expressed with Gbeta 1gamma 2, similar to alpha 1B channels.

By contrast, the agonists never evoked an inhibition of L-type alpha 1C currents in oocytes expressed with the Ca2+ channel alpha 1C, alpha 2, and beta 1a subunits and the receptor (DOR or beta 2AR) in combination with either of the six different isoforms of Galpha (n = 6-30) or Gbeta 1gamma 2 (n = 6), even if the concentration of Gi3alpha cRNA injected was increased to 150 ng/µl (n = 4).

To examine whether specifications of Galpha -mediated inhibition of HVA Ca2+ channels are reproducible in neuronal cells, we investigated the mechanism by which native HVA Ca2+ channels are regulated by Galpha in NG108-15 neuroblastoma-glioma hybrid cells. NG108-15 cells express N- and L-type Ca2+ channels (31, 32) and DOR (24) and muscarinic ACh receptors (21) which inhibit the Ca2+ channel activity. These native HVA Ca2+ channels were sensitive to 10 µM nifedipine (n = 10) or 0.3 µM omega -conotoxin GVIA (omega -CTx) (n = 6), but not to 0.3 µM omega -agatoxin IVA (n = 3). Puff application of 1 mM ACh inhibited HVA Ca2+ currents in the presence of nifedipine (n = 5). On the other hand, ACh did not inhibit HVA Ca2+ currents in the presence of both nifedipine and omega -CTx (n = 4). These results indicate that ACh inhibits N-type Ca2+ channel currents in NG108-15 cells. When exogenous Galpha isoforms were stably expressed in NG108-15 cells according to the procedures described previously (20), the ACh-induced inhibition of HVA Ca2+ currents was potentiated in the clones transfected by the exogenous Gi3alpha and Go1alpha but not potentiated by Gi1alpha or Gi2alpha (Fig. 1D). Thus, the specificities of Galpha in inhibiting native N-type Ca2+ channels were similar to those observed in Xenopus oocytes. PTX (500 ng/ml, a supramaximal dose) impaired the potentiation by Gi3alpha and Go1alpha of the ACh-induced inhibition of Ca2+ channels (Fig. 1D).

These results indicate that the N-type alpha 1B channel is negatively regulated by Gi3alpha , Go1alpha , Gzalpha , and Gsalpha and that the P/Q-type alpha 1A channel is also negatively regulated by Gi1alpha , Gi2alpha , Gi3alpha , and Go1alpha . It is further suggested that the N- and P/Q-type Ca2+ channels are regulated differentially by distinct Galpha subtypes. In order to unmask the effect of endogenous Galpha , the antisense oligonucleotide, AGO, was routinely used in the following experiments using Xenopus oocytes (Figs. 2 and 3).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Differential responses of alpha 1B and alpha 1A channels to the depolarizing prepulse in Xenopus oocytes co-expressed with Gbeta 1gamma 2 or Galpha . A, N-type (alpha 1B, left), but not P/Q-type (alpha 1A, right), Ca2+ channels in an oocyte implanted with DOR, Ca2+ channel alpha 1 (alpha 1B or alpha 1A), alpha 2 and beta 1a subunits, and Gbeta 1gamma 2 were prominently facilitated by a depolarizing prepulse (30 ms in duration) to +80 mV in the absence of Leu-EK. A 200-ms test pulse was applied to +10 mV from a holding potential of -100 mV. When preceded by the conditioning depolarization, the test pulse was applied 20 ms after cessation of the prepulse. B, effects of changing duration of the prepulse on alpha 1B (filled circles) and alpha 1A currents (open circles) in oocytes expressed with DOR, Ca2+ channel alpha 1 (alpha 1B or alpha 1A), alpha 2 and beta 1a subunits, and Gbeta 1gamma 2. In practice, peak currents were measured before and after application of a prepulse to +80 mV, and the ratios were expressed as a function of the duration of prepulse. The number of oocytes examined are 5. C, prepulse-resistant responses to Leu-EK in alpha 1A channels. DOR and Ca2+ channel alpha 1A, alpha 2, and beta 1a subunits were co-expressed with Galpha or Gbeta 1gamma 2 as indicated. In control oocytes (None), no exogenous Galpha nor Gbeta 1gamma 2 was expressed. The responses of alpha 1A currents to 1 µM Leu-EK (horizontal bars), prepulse (open circles), and both (filled circles) were measured and expressed as ratios. The same experimental protocols were used as in Fig. 1 for Leu-EK and as in Fig. 2A for prepulse. The number of oocytes examined for each data are 4-9. The antisense oligonucleotide, AGO, was used in A-C.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of loop 1 and C-terminal peptides derived from alpha 1B or alpha 1A subunit on N- and P/Q-type Ca2+ channels. Synthetic peptides (10 µM) derived from the loop 1 and C terminus of alpha 1B or alpha 1A subunit (see Fig. 4) were injected 15 h prior to electrophysiological measurements by various combinations indicated into Xenopus oocytes, which were implanted with Ca2+ channel alpha 1, alpha 2, and beta 1a subunits, DOR, and/or G-protein subunit (Gi3alpha , Go1alpha , or Gbeta 1gamma 2). The amino acid sequence of PL1 is shared by the alpha 1B and alpha 1A subunits. The responses of wild-type alpha 1B (A) and alpha 1A (B) channels to 1 µM Leu-EK (horizontal bars), prepulse (open circles), or both (filled circles) were measured in oocytes co-expressed with or without Gi3alpha , Go1alpha , or Gbeta 1gamma 2, as indicated, and expressed as ratios. The pulse protocols were the same as those in Fig. 2C. The antisense oligonucleotide, AGO, was used. The number of oocytes examined for each data are 4-68 in A and 4-16 in B.

Effects of Gbeta gamma on the N- and P/Q-type Ca2+ Channels-- Leu-EK-induced inhibitions of N-type, alpha 1B (Fig. 1A), and P/Q-type, alpha 1A (Fig. 1B), Ca2+ channels were not potentiated when Gbeta 1gamma 2 was co-expressed. Alternatively, Ba2+ currents recorded from oocytes expressed with the Ca2+ channel alpha 1B, alpha 2, and beta 1a subunits, DOR and Gbeta 1gamma 2 were facilitated by application of a large conditioning depolarization to +80 mV, in the absence of receptor stimulation (Fig. 2A, left). As mentioned before (8), this may indicate that the exogenous Gbeta gamma can inhibit the N-type Ca2+ channel by itself, therefore without need for receptor-mediated activation of G-proteins. The prepulse facilitation was not prominent, but still significant, in the alpha 1A channel (Fig. 2A, right).

Changing the prepulse duration more clearly revealed the difference in facilitation between alpha 1B and alpha 1A channels in oocytes co-expressed with Gbeta 1gamma 2 (Fig. 2B). A positive correlation between the extent of facilitation and prepulse duration was clearly observed in both alpha 1B and alpha 1A channels. However, the currents through alpha 1A channels became suppressed as the duration of the prepulse was increased.

As shown in Fig. 2C (horizontal bar), Leu-EK-induced inhibition of alpha 1A channel currents was markedly potentiated in oocytes co-expressed with Gi1alpha , Gi3alpha , or Go1alpha , but this was not the case in oocytes co-expressed with Gbeta 1gamma 2. The prepulse procedure did not abolish the current inhibitions by Galpha isoforms (filled circles), whereas it was abolished in alpha 1B channels (Fig. 3A) as shown in the previous paper (8). Thus, the difference between alpha 1B and alpha 1A channels in G-protein modulation appeared to be more prominent for Galpha than Gbeta 1gamma 2. Prepulse depolarization in the presence of Gbeta 1gamma 2 facilitated both alpha 1B and alpha 1A channels, but facilitation of currents that were suppressed by Galpha was only observed for the alpha 1B channel. These results suggest that Galpha s are capable of distinguishing between HVA Ca2+ channel types.

Effects of Peptides Derived from Loop 1 and C terminus on the N- and P/Q-type Ca2+ Channels-- Based upon evidence uncovering the structural determinants of Gi3alpha and Gbeta 1gamma 2 interactions with alpha 1B (8), an attempt was made to see whether alpha 1B peptides derived from these interaction sites could quench the signaling accompanying exogenous expression of G-proteins in Xenopus oocytes. As shown in Fig. 3A (Gbeta 1gamma 2; None, PL1; open circles), the prepulse facilitation observed in oocytes co-expressed with Gbeta 1gamma 2 was almost abolished by the injection of PL1, an alpha 1B- (or alpha 1A)-derived peptide comprising an N-terminal cysteine and the amino acid residues 366-384 of alpha 1B (or the amino acid residues 370-388 of alpha 1A) in loop 1 (see Fig. 4). However, this peptide did not suppress the potentiation of Leu-Ek-induced inhibition of alpha 1B channels via Gi3alpha (Fig. 3A, Gi3alpha , PL1, horizontal bar). By contrast, such potentiated inhibition with Gi3alpha was reduced, as shown in Fig. 3A (Gi3alpha , PL1+PB3T1 and PL1+PB3T4, horizontal bars), by the injection of PL1 in combination with PB3T1 or PB3T4, an alpha 1B-derived peptide comprising a cysteine and the amino acid residues 1934-1943 (PB3T1) or 1931-1949 (PB3T4) in the C terminus (see Fig. 4). The combination of PL1 and PB3T4, a longer version of PB3T1, blocked more efficiently the potentiation of current inhibition than that of PL1 and PB3T1. However, injection of PL1 in combination with another alpha 1B-derived C-terminal peptide, PB3T2 or PB3T3 comprising a cysteine and the amino acid residues 2016-2025 or 1907-1925, respectively (see Fig. 4), failed to suppress this inhibitory potentiation via Gi3alpha (Fig. 3A, Gi3alpha , PL1+PB3T2 and PL1+PB3T3, horizontal bars). Moreover, injection of PB3T4 alone did not affect either the agonist-induced inhibition of alpha 1B channels via Gi3alpha (Gi3alpha , PB3T4, horizontal bar) or the prepulse facilitation via Gbeta 1gamma 2 (Gbeta 1gamma 2, PB3T4, open circle). On the other hand, both PL1 and PB3T4 diminished prepulse facilitation when DOR was stimulated by Leu-EK in oocytes co-expressed with Gi3alpha (Gi3alpha , PL1 and PB3T4, filled circles). These experiments using synthetic peptides revealed that both the loop 1 peptide (PL1) and the C-terminal peptide (PB3T4) were necessary to interrupt the interaction of the N-type alpha 1B channel with Galpha , whereas that the loop 1 peptide alone was capable of impairing the interaction with Gbeta gamma .


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.   Schematic representation of the sites on alpha 1B subunit for synthesizing the peptides. A, positions of the loop 1 and the C terminus, together with those of the deletion (LDelta 1, LDelta 2, LDelta 3, and TDelta 1) as described previously (8), are indicated by the number of the amino acid residues for alpha 1B subunit (42) and alpha 1A (BI-1 alpha 1) subunit (14) in parentheses. The deletion sites are indicated by the crossing bars, and the cytoplasmic side below the horizontal lines. The peptides were synthesized on the basis of the amino acid sequences indicated by the open circles attached. The asterisk denotes the binding site for Ca2+ channel beta  subunit (43), and the filled circle denotes the phosphorylation sites for protein kinase C (9). B, primary sequences of the synthetic peptides used representing their alignments with the predicted protein sequences of the alpha 1B and the alpha 1A subunits. An extra cysteine (in parentheses) was added to each peptide on the N-terminal side.

As in the case of alpha 1B channels, the potentiating effects of Go1alpha on the Leu-EK-induced inhibition of alpha 1A channels (Fig. 3B, Go1alpha , None, horizontal bar) were suppressed by the injection of the loop 1 peptide, PL1, together with one of the C-terminal peptides, PB3T1 or PPQT1 (Go1alpha , PL1+PB3T1 and PL1+PPQT1, horizontal bars). The peptide PPQT1, an alpha 1A-version of PB3T4, was comprised of a cysteine and the amino acid residues 2028-2046 (Fig. 4). However, in contrast to alpha 1B channels, PPQT1 by itself almost abolished the potentiating effects of Go1alpha (Go1alpha , PPQT1, horizontal bar), as observed with PL1 plus PPQT1. The amino acid sequences of alpha 1B-derived PB3T1, PB3T2, PB3T3, and PB3T4 (other than the attached cysteine residue) share 60, 80, 13, and 53% identity with alpha 1A, respectively (Fig. 4). PL1 alone, or combination of PL1 plus PB3T2 or PL1 plus PB3T3, did not reduce the potentiation of Leu-EK-induced current inhibition via Go1alpha (Fig. 3B, Go1alpha , PL1, PL1+PB3T2, and PL1+PB3T3, horizontal bars). Thus, the C-terminal peptide (PPQT1) was sufficient to impede the interaction of the P/Q-type alpha 1A channel with Galpha . On the other hand, the less prominent prepulse facilitation of the alpha 1A channel via Gbeta 1gamma 2 (relative response: 107.6 ± 0.6%, n = 4; also see Fig. 2, A and B) appeared to be inhibited by application of PL1 (98.2 ± 1.8%, n = 5).

Goalpha , but Not Gbeta gamma 2, Binds to the C Termini of N- and P/Q-type Ca2+ Channels-- The results so far obtained from electrophysiological observations in this and the previous (8) studies suggest that the inhibition of N- (alpha 1B) and P/Q-type (alpha 1A) Ca2+ channels by G-proteins involves direct interactions between the alpha 1B loop 1 and Gbeta gamma and between the alpha 1B/alpha 1A C termini and Galpha . To examine these possibilities, the C terminus (corresponding to amino acid residues 1912-2339) and the loop 1 (corresponding to amino acid residues 361-483) of N-type Ca2+ channels were expressed in E. coli as GST fusion proteins, GST-B3T and GST-B3L1, respectively. Similarly, the C terminus (corresponding to amino acid residues 1975-2424) and the loop 1 (corresponding to amino acid residues 365-489) of the P/Q-type channel were also fused with GST (GST-B1T and GST-B1L1), respectively. Then, as shown in Fig. 5, their ability to bind Galpha and Gbeta gamma was tested by immunoblot analysis using the antibodies GoAb and K-20 against Goalpha and the antibody M-14 against Gbeta 1 (see "Experimental Procedures").


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 5.   In vitro Goalpha bindings to the C termini of N- and P/Q-type Ca2+ channels. Immunoblot of Goalpha (A) and Gbeta gamma 2 (B) to GST fusion proteins. The purified GST proteins, GST-B3T (A, lanes 2 and 4; B, lane 2), GST-B3L1 (A, lanes 6 and 8; B, lane 4), GST-B1T (A, lanes 10 and 12; B, lane 6), and GST-B1L1 (B, lane 8) immobilized on glutathione-Sepharose 4B beads were incubated with purified bovine brain Goalpha (A, lanes 2, 4, 6, 8, 10, and 12) or Gbeta gamma 2 (B, lanes 2, 4, 6, and 8). After washing, proteins bound to beads were released by boiling and separated by 11% SDS-PAGE, together with 25 ng (A, lanes 1, 3, 5, and 7) or 5 ng (A, lanes 9 and 11) of purified Goalpha , or 25 ng of Gbeta gamma 2 (B, lanes 1, 3, 5, and 7). Immunoblot analysis was performed, as described under "Experimental Procedures," using the antibodies GoAB (A, lanes 1-8) and K-20 (A, lanes 9-12) against Goalpha , and the antibody M-14 against Gbeta 1 (B). The incubation with the antibody GoAB was carried out in the presence (A, lanes 3, 4, 7, and 8) or absence (A, lanes 1, 2, 5, and 6) of 0.1 mg/ml of the peptide antigen FGo for GoAB. In the case of K-20, the antibody was preincubated with (A, lanes 11 and 12) or without (A, lanes 9 and 10) the peptide antigen sc-387P for K-20 according to the procedure described by the vendor. The first antibodies described above were diluted at 1:2000 (B, lanes 1 and 2), 1:4000 (A, lanes 1-8; B, lanes 3 and 4), or 1:8000 (A, lanes 9-12; B, lanes 5-8). Arrowheads indicate the positions of purified Goalpha (A) and Gbeta (B). The size markers used were the Wide Range SigmaMarkers (Sigma). Note that the 39-kDa purified Goalpha (A, lane 5) is in a higher position than the major nonspecific bands (A, lane 6), which were not inhibited by the peptide antigen (A, lane 8).

The antibody GoAb reacted with a 39-kDa Goalpha purified from brain (Fig. 5A, lanes 1 and 5) and with several polypeptides released from the GST-B3T-bound beads that had been incubated with the purified Goalpha (Fig. 5A, lane 2). Among these immunoreactive polypeptides, a 39-kDa polypeptide obviously became devoid of its reactivity with GoAb by co-incubation with the peptide antigen FGo for GoAb (Fig. 5A, lane 4, arrowhead). This co-incubation also abolished the reactivity of the antibody with Goalpha (Fig. 5A, lanes 3 and 7). These results indicate that the 39-kDa immunoreactive polypeptide was recognized specifically by the antibody against Goalpha when released from the C terminus. By contrast, this antibody never detected a 39-kDa polypeptide released from GST-B3L1-bound beads (Fig. 5A, lanes 6 and 8) or from GST-bound beads (n = 3), the two kinds of beads that had been incubated with the purified Goalpha .

On the other hand, the antibody M-14 reacted with a 36-kDa Gbeta purified from brain (Fig. 5B, lanes 1, 3, 5 and 7), as well as a 36-kDa polypeptide released from the GST-B3L1-bound beads (Fig. 5B, lane 4, arrowhead) that had been incubated with the purified Gbeta gamma 2. Both reactivities of M-14 with the 36-kDa polypeptides were inhibited by preincubation of M-14 with the peptide antigen sc-261P for M-14 (n = 3). No 36-kDa polypeptide, however, was detected by M-14 in polypeptides released from GST-B3T-bound beads despite the incubation with the purified Gbeta gamma 2 (Fig. 5B, lane 2, arrowhead). These results support the idea that Galpha and Gbeta gamma inhibit the N-type Ca2+ channel by directly interacting with the C terminus and the loop 1 of the channel, respectively.

As also shown in Fig. 5A (lane 9), another antibody K-20 against Goalpha detected the purified Goalpha as well. K-20 mainly reacted with a 39-kDa polypeptide released from the GST-B1T-bound beads that had been incubated with the purified Goalpha (Fig. 5A, lane 10). This reactivity of K-20 with the 39-kDa polypeptide was diminished by preincubation of the antibody with the peptide antigen sc-387P for K-20 (Fig. 5A, lane 12), as observed in the purified Goalpha (lane 11). As shown in Fig. 5B, the antibody M-14 did not detect polypeptides released from the GST-B1T-bound beads (lane 6, arrowhead) but detected a 36-kDa polypeptide from the GST-B1L1-bound beads (lane 8, arrowhead), when these beads had been incubated with the purified Gbeta gamma 2. The reactivity of M-14 with the 36-kDa polypeptide released from the GST-B1L1-bound beads was inhibited by preincubation of M-14 with the peptide antigen sc-261P (n = 3). These results are consistent with the idea, obtained from the electrophysiological experiments, that the P/Q-type Ca2+ channel, like N-type, is under the regulation of Galpha and Gbeta gamma directly interacting with the C terminus and the loop 1 of the channel, respectively.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

In the present study, we found that distinct sets of Galpha co-expressed in oocytes mediated receptor agonist-induced inhibitions of N-type alpha 1B and P/Q-type alpha 1A channels; agonist-induced inhibition of the alpha 1B channel was potentiated by co-expression of Gi3alpha , Go1alpha , Gzalpha , and Gsalpha , whereas that of the alpha 1A channel was intensified by co-expression of Gi1alpha , Gi2alpha , Gi3alpha , or Go1alpha . Single channel recordings indicated that the molecular species Gi3alpha is a PTX-sensitive G-protein in native tissues and elicits channel inhibition through a membrane-delimited pathway (33, 3