J Biol Chem, Vol. 273, Issue 28, 17595-17603, July 10, 1998
Differential Interactions of the C terminus and the Cytoplasmic
I-II Loop of Neuronal Ca2+ Channels with G-protein
and

Subunits
II. EVIDENCE FOR DIRECT BINDING*
Taiji
Furukawaab,
Reiko
Miuraa,
Yasuo
Moricd,
Mark
Strobeckcd,
Kazuyuki
Suzukia,
Yoshiyasu
Ogiharaae,
Tomiko
Asanof,
Rika
Morishitaf,
Minako
Hashiig,
Haruhiro
Higashidag,
Mitsunobu
Yoshiih, and
Toshihide
Nukadaai
From the a Department of Neurochemistry and
h Department of Neurophysiology, Tokyo Institute of Psychiatry,
2-1-8 Kamikitazawa, Setagaya-ku, Tokyo 156, the b Department
of Internal Medicine, Faculty of Medicine, Teikyo University,
2-11-1 Kaga, Itabashi-ku, Tokyo 173, the c Department of
Information Physiology, National Institute for Physiological Sciences,
Okazaki, Aichi 444, Japan, the d Institute of Molecular
Pharmacology and Biophysics, University of Cincinnati College of
Medicine, Cincinnati, Ohio 45267-0828, e New Product Research
Laboratories III, Daiichi Pharmaceutical Co., Tokyo R&D Center,
1-16-13 Kita-Kasai, Edogawa-ku, Tokyo 134, the f Department of
Biochemistry, Institute for Developmental Research, Aichi Human Service
Center, 713-8 Kamiya-cho, Kasugai, Aichi 480-03, and the
g Department of Biophysics, Neuroinformation Research Institute,
Kanazawa University School of Medicine, 13-1 Takaramachi, Kanazawa,
Ishikawa 920, Japan
 |
ABSTRACT |
The present study was designed to obtain evidence
for direct interactions of G-protein
(G
) and 
subunits
(G
) with N- (
1B) and P/Q-type
(
1A) Ca2+ channels, using synthetic peptides
and fusion proteins derived from loop 1 (cytoplasmic loop between
repeat I and II) and the C terminus of these channels. For N-type,
prepulse facilitation as mediated by G
was impaired when a
synthetic loop 1 peptide was applied intracellularly. Receptor
agonist-induced inhibition of N-type as mediated by G
was also
impaired by the loop 1 peptide but only when applied in combination
with a C-terminal peptide. For P/Q-type channels, by contrast, the
G
-mediated inhibition was diminished by application of a C-terminal
peptide alone. Moreover, in vitro binding analysis for N-
and P/Q-type channels revealed direct interaction of G
with
C-terminal fusion proteins as well as direct interaction of G
with loop 1 fusion proteins. These findings define loop 1 of N- and
P/Q-type Ca2+ channels as an interaction site for G
and the C termini for G
.
 |
INTRODUCTION |
High voltage-activated
(HVA)1 Ca2+
channels are negatively regulated by guanine nucleotide-binding
regulatory proteins (G-proteins) in various neuronal preparations,
including neuroblastoma × glioma hybrid NG108-15 cells (1, 2),
dorsal root ganglion neurons (3, 4), sympathetic neurons (5), and rat
pituitary GH3 cells (6). This response appears to be
controlled by a membrane-delimited mechanism via pertussis toxin
(PTX)-sensitive G-proteins, in which the Go
subunit has
been shown to mediate an inhibitory signal to HVA Ca2+
channels. The primary structures of multiple subtypes of G-protein
subunits (G
) including Go
have been deduced by
molecular cloning and sequencing of their cDNAs. These studies
revealed very similar but distinct amino acid sequences for each
subtype cloned (7). It remains to be seen, however, which subtypes of
G
preferentially interact with HVA Ca2+ channels such as
N- and P/Q-types. In the previous study using mutant and chimeric
channels expressed in Xenopus oocytes (8), our results
provided evidence that the cytoplasmic I-II loop (referred to as
"loop 1" in the present study) of N-type (
1B)
Ca2+ channels is a regulatory site for the G-protein 
dimer (G
) and the C termini of P/Q- (
1A) and
N-type Ca2+ channels for G
. However, this does not
answer the question as to whether G
, as well as G
(9, 10),
directly interact with these Ca2+ channels.
To address these issues, we have expressed
1B and
1A HVA Ca2+ channels in Xenopus
oocytes, in which the effects of intracellularly applied loop 1 and
C-terminal peptides derived from
1B and
1A were investigated. Furthermore, a direct association
of G
and G
with these Ca2+ channels was determined
by in vitro binding using glutathione S-transferase (GST) proteins fused with the loop 1 and the
C-terminal segments of
1B or
1A. These
results, taken together with the findings of the previous study (8),
define the interaction sites of G
and G
within
Ca2+ channels.
 |
EXPERIMENTAL PROCEDURES |
In Vitro Transcription--
The 1.8-kilobase pair
NcoI/SalI fragment containing the entire coding
region of the
2-adrenergic receptor (
2AR)
(11) was inserted into the HindIII site of the pSPA2 vector
(12), to yield pSP
2AR. The
2AR cDNA was kindly
provided by Dr. Robert J. Lefkowitz. The pSPA1, pSPA2, pSP72, pSP65,
and pSP64 recombinant plasmids carrying the entire protein-coding
sequences of G
(Gi1
, Gi2
,
Gi3
, Go1
, Gz
, and
Gs
), G
1, G
2,
-opioid
receptor (DOR), and the Ca2+ channel
1B,
1A,
1C,
2, and
1a subunits were described previously (8, 12-16).
Nucleotide sequence analyses revealed that the deduced amino acid
sequence of Gi2
was similar to that reported (17) except
that Gln-99, Ala-113, Met-119, Thr-280, and Gln-281 were determined as
Ser (TCC), Thr (ACG), Val (GTG), Ile (ATA), and His (CAC),
respectively, in our clone, pG2
2 (15).
cRNAs specific for
1A,
1B,
1C,
2, and
1a subunits of
the Ca2+ channel, DOR,
2AR, and six isoforms
of G
, G
1, or G
2 were synthesized
in vitro using the MEGAscript SP6 kit (Ambion).
Functional Expression of Ca2+ Channels in Xenopus
Oocytes--
According to the methods described in the companion
paper (8), Xenopus oocytes were injected with cRNAs and
subjected to electrophysiological measurements. cRNAs were used either
with 0.3 µg/µl
1 (
1B,
1A, or
1C) cRNA in combination with 0.2 µg/µl
2 cRNA and 0.1 µg/µl
1a
cRNA; 0.03 µg/µl receptor (DOR or
2AR) cRNA; 0.05 µg/µl G
cRNA; or 0.05 µg/µl G
1 cRNA and 0.025 µg/µl G
2 cRNA, unless otherwise specified.
The antisense oligonucleotide AGO (0.1 µg/µl, 50 nl) complementary
to the Xenopus Go
mRNA (8) was injected
12-16 h prior to electrophysiological measurements. The sense
oligonucleotide SGO, TCCCCCCCCGAGCAGTCATG, complementary to AGO was
applied in the same manner as AGO. The following six kinds of peptides
(Sawady, Japan) were synthesized based upon the amino acid sequence of the
1B or
1A subunits (see Fig. 4): PL1
(amino acid residues 366-384 of
1B), PB3T1 (amino acid
residues 1934-1943 of
1B), PB3T2 (amino acid residues
2016-2025 of
1B), PB3T3 (amino acid residues 1907-1925
of
1B), PB3T4 (amino acid residues 1931-1949 of
1B), and PPQT1 (amino acid residues 2028-2046 of
1A). The peptide, PL1, also corresponds to the amino
acid residues 370-388 of
1A. These synthetic peptides
(10 µM) were injected 15 h prior to
electrophysiological measurements. Injection of 50 nl of 10 µM cyclic AMP or 10 units/µl catalytic subunit of
cyclic AMP-dependent protein kinase A (PKA) (Sigma) was
carried out 30 min prior to electrophysiological measurements. For the
pretreatment with 1-(5-isoquinolinylsulfonyl)-2-methyl-piperazine (H7),
the oocytes were incubated with 100 µM H7 for 1 h
prior to measurement. In experiments in which PTX was used, the oocytes were preincubated with the toxin (200 ng/ml) for about 24 h prior to electrophysiological measurements.
In some experiments, multiple single channel events in a membrane patch
were recorded from oocytes as an ensemble average (or
"pseudomacroscopic"), using an EPC-7 patch-clamp amplifier (List
Electronics, Darmstadt, Germany). The procedure was similar to that
described elsewhere (14). Cell-attached membrane patches were obtained
using fire-polished borosilicate pipettes (Narishige, GD-1.5, Japan)
having a resistance of 2-4 megohms (tip diameter ~1 µm) when
filled with the pipette solution. The pipette solution contained 110 mM BaCl2 and 10 mM HEPES (pH 7.4 with tetraethylammonium-OH). Oocytes that were implanted with
1B,
2,
1a, DOR, and
Gi3
, and then injected with the antisense AGO, were
bathed in a depolarizing solution consisting of 90 mM
K+, 10 mM Na+, 1 mM
Mg2+, 1 mM Ca2+, 104 mM
Cl
, and 5 mM HEPES (pH 7.5 with KOH). Under
these experimental conditions, the average membrane potential was
2 ± 4 mV (n = 5). To apply Leu-enkephalin
(Leu-EK) inside the patch electrode, a thin polyethylene tube having a
tapered tip of about 100 µm in diameter was inserted into the glass
pipette and used as an inlet tubing (18). Through this thin tubing,
near (about 0.5 mm) the tip of the patch pipette, the pipette solution
containing 50 µM Leu-EK was applied slowly using a
syringe microinjector. Because the volume of injection was small
(0.5-1.0 µl, about 1/50 volume of the solution in the pipette), no
waste chamber (reservoir) was attached to the patch electrode. A
negative pressure of about 30-40 cm H2O was applied to the
patch electrode to minimize the mechanical effects of the pressure
injection. Data acquisition and analysis were done on a computer using
the software, DAAD system (19).
Unless otherwise stated, statistical data were represented by the mean
and S.E.
Expression of Exogenous G
in NG108-15 Cells--
By using a
HindIII linker, the G
cDNA fragment (15) containing
the entire protein coding segment of Gi1
,
Gi2
, Gi3
, or Go1
was
inserted into the HindIII site of the pKGS
N (20), to
yield expression vector, pKGi1
, pKGi2
, pKGi3
, or pKGo1
. NG108-15 cells in culture were transfected with the above plasmids by
electroporation (20); the voltage was set at 1.7 kV and the capacitance
at 20 microfarads. Transformants were selected in culture medium
supplemented with 800 µg/ml G418 for 2-3 weeks. One hundred clones
of the ~1 × 107 cells transfected were transformed
to G418 resistance. Among these G418-resistant transformants,
G
-transformed NG108-15 clones were selected out by blot
hybridization analysis (20), using total cellular RNA prepared from
each transformant and each cDNA fragment containing a protein
coding segment as a probe. The presence of a hybridizable RNA species
with an expected size from the construction was used to measure the
transformants of NG108-15 cells by Gi1
, Gi2
, Gi3
, or Go1
(20).
The Gi1
- (NGi1-1 and NGi1-3), Gi2
-
(NGi2-5 and NGi2-6), Gi3
- (NGi3-6 and NGi3-13), and
Go1
-transformed clones (NGo-13 and NGo-18) and
non-transfected NG108-15 cells were plated at a density of 1-5 × 105 cells/35-mm polyornithine-coated dish, as described
previously (21). The cells were cultured for 2-3 weeks in
"differentiation" medium supplemented with 0.25 mM
dibutyryl cyclic AMP to induce differentiation (22).
Ca2+ currents were recorded by a whole cell variation of
the patch-clamp technique (23) using the continuous or discontinuous single electrode voltage-clamp amplifier (Axoclamp-2, Axon
Instruments). Low voltage-activated (T-type) and HVA (N/L-type)
Ca2+ channel currents were recorded by a continuous mode
(24); the N-type component was observed by a discontinuous mode as
described previously (21). The extracellular solution consisted of 50 mM BaCl2, 30 mM NaCl, 1 mM MgCl2, 5 mM CsCl, 20 mM glucose, 20 mM tetraethylammonium chloride,
1 µM tetrodotoxin, and 10 mM HEPES (pH 7.24).
The patch electrode contained solutions of the following composition:
150 mM CsCl, 1 mM MgCl2, 10 mM EGTA, 1 mM ATP, 10 mM HEPES (pH
7.3).
Muscarinic acetylcholine (ACh) receptors were stimulated by a focal
application of 1 mM ACh (3 µl). In experiments in which PTX was used, the cells were preincubated with the toxin (500 ng/ml)
for 12-14 h prior to the measurements. The electrophysiological experiments were carried out at approximately 30 °C. Statistical data were represented by the mean and S.E.
Go
and G
2 Bindings--
The
1.6-kilobase pair SrfI/SalI fragment (encoding
amino acid residues 1912-2339 of the
1B subunit) and
the 1.4-kilobase pair ScaI/BamHI fragment
(encoding amino acid residues 1975-2424 of the
1A
subunit) were excised from the plasmids pSPB3 (16) and pSPCBI-2 (14)
and fused in-frame to the GST coding sequence in pGEX-2T (Amersham
Pharmacia Biotech) to produce GST fusion proteins of C terminus
(GST-B3T and GST-B1T), respectively. Similarly, to produce GST fusion
proteins of loop 1 (GST-B3L1 or GST-B1L1), the 380-base pair fragment
amplified by polymerase chain reaction (PCR), encoding either amino
acid residues 361-483 of the
1B subunit or 365-489 of
the
1A subunit, was fused in-frame. The sets of primers
for PCR were GGAGAATTCGTAAGGAGCGCGAGAGA and TCTGTGCCTTCACCATGCGCC for
1B and GGGGAATTCGCAAAGAAAGGGAGCGG and
AGAAGGCCTGAGTTTTGACCATG for
1A. The plasmids pSPB3 and
pSPCBI-2 were used as a template for PCR. Four kinds of fusion proteins
or GST proteins were expressed in Escherichia coli DH5
,
induced with 0.5 mM
isopropyl-1-thio-
-D-galactoside, and prepared according
to the procedure described previously (25). The solubilized proteins
were incubated with glutathione-Sepharose 4B beads (Amersham Pharmacia
Biotech) at 4 °C for 5 h and washed five times with 40 volumes
of phosphate-buffered saline containing 1% Triton X-100. Approximately
10 µg of GST, or GST-fusion proteins, bound to beads were used in
each binding assay.
Ten micrograms of purified bovine brain Go
(26) and
G
2 complex (27) were incubated at 4 °C for 12 h with the beads that had been equilibrated with buffer solutions
supplemented with 0.1% Lubrol PX and 0.6% sodium cholate,
respectively. These buffers contained 20 mM Tris-HCl (pH
8), 0.1 mM EDTA, 0.5 mM dithiothreitol, 20 mM NaPO4, and a mixture of protease inhibitors
(2.5 µg/ml pepstatin, 2 µg/ml phenylmethylsulfonyl fluoride, 0.02 mg/ml leupeptin, and 0.5 mM benzamidine). Then, the beads
were washed with 40 volumes of the same buffer solutions and denatured
by heating to 90 °C for 3 min in 200 µl of sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer.
Proteins (70 µl) were separated by SDS-PAGE and transferred to
Immobilon membrane (Millipore) for Western blotting and detection by
the ECL system (Amersham Pharmacia Biotech) as described previously
(28). The antibody, GoAB, raised against the C-terminal
decapeptide of Go
(FGo) (29) was kindly
provided by Dr. Tatsuya Haga, and the antibodies, K-20 and M-14,
against Go
and G
1, respectively, were
purchased from Santa Cruz. The first antibody when used was diluted
appropriately to reduce nonspecific reactivity, and the second antibody
(biotinylated anti-rabbit Ig, Amersham Pharmacia Biotech) and the
peroxidase-streptavidin (Vector) were both diluted at 1:2000. Each
incubation was for 1 h at room temperature. The decapeptide
FGo (Sawady, Japan) was synthesized based upon the amino
acid sequence corresponding to the amino acid residues 345-354 of
Go
(29). The peptide antigens sc-387P (for K-20) and
sc-261P (for M-14) were also purchased from Santa Cruz. The GST fusion
proteins (GST-B3T, GST-B1T, GST-B3L1, and GST-B1L1) and GST proteins
were tested more than three times for their ability to bind
Go
and G
2. There was no essential difference between GoAB and K-20 in detecting specific
bindings of Go
to the fusion proteins.
 |
RESULTS |
Effects of G
on the N- and P/Q-type Ca2+
Channels--
In the previous study (8), N-type (
1B),
P/Q-type (
1A), and L-type (
1C)
Ca2+ channels were shown to be functionally expressed in
Xenopus oocytes, and
1B and
1A
channels were negatively regulated by Gi3
and G
1
2. To determine further which G
isoforms regulate HVA Ca2+ channels, either G
cRNA (for
six different isoforms: Gi1
, Gi2
, Gi3
, Go1
, Gz
, and
Gs
) or G
1 plus G
2 cRNAs
were injected into oocytes in combination with the Ca2+
channel
1 (
1B or
1A),
2 and
1a subunits cRNAs and receptor (DOR
or
2AR) cRNA. When Gs
was expressed,
2AR was co-expressed, and the receptor was stimulated by
1 µM isoproterenol, an agonist of the
-adrenergic
receptor.
Agonist-induced inhibitions of
1B channels were less
pronounced in oocytes co-injected with Gi1
,
Gi2
, or G
1
2 cRNA, as compared with control oocytes injected with Ca2+ channel
subunits (
1B,
2, and
1a)
and DOR (Fig. 1A,
upper). Also, Leu-EK-induced inhibition was diminished in
oocytes implanted with Gz
. Alternatively, the response
to Leu-EK of
1B channels was not affected significantly
in oocytes co-expressed with Gi3
, Go1
, or
Gs
. As shown in Fig. 1A (upper),
PTX (200 ng/ml) blocked the agonist-induced inhibition of
1B channels with Gi3
but not with
Gz
nor Gs
. These observations are
consistent with the fact that Gi3
is PTX-sensitive, and
Gz
and Gs
are PTX-insensitive G-proteins
(30). Because a PTX-insensitive component of the response was increased
in oocytes co-expressed with the PTX-insensitive Gz
or
Gs
, it was presumed that a maximal inhibition of the
1B channel was already attained by endogenous oocyte
G-proteins and that introduced Gz
or Gs
was capable of replacing endogenous G-proteins when exerting current
inhibition. Therefore, in order to unmask the effects of exogenous
G
, the antisense oligonucleotide, AGO, directed against mRNAs
encoding Xenopus Go
(8), was injected prior
to the electrophysiological studies. As expected, Leu-EK-induced inhibition of
1B channels in control oocytes (without
exogenous G
subtypes) was reduced by 42.3 ± 7.4%
(n = 25) in the presence of antisense oligonucleotide
AGO. As a result, the hierarchy of exogenous G
subtypes in
inhibiting
1B channels could be more clearly recognized
(Fig. 1A, lower) when compared with
antisense-free control experiments (Fig. 1A,
upper). Sense oligonucleotide, SGO, to Xenopus
Go
had no effects on the inhibition of
1B
channels (n = 6).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 1.
Comparisons of the potencies of various
G-protein subunit combinations in mediating agonist-induced inhibitions
of 1B and 1A channels or native HVA
Ca2+ channels. A and B, effects of
G and G on the agonist-induced inhibition of 1B
(A) or 1A (B) currents without
(upper) or with (lower) the injection of the
antisense oligonucleotide, AGO, directed against mRNA encoding
Xenopus Go (8). The receptor (DOR or
2AR) and Ca2+ channel 1
( 1B or 1A), 2, and
1a subunits were co-expressed with G or
G 1 2 as indicated in Xenopus
oocytes. In control oocytes, no exogenous G nor
G 1 2 was expressed. When Gs
was co-expressed, 2AR, instead of DOR, was expressed,
and 1 µM isoproterenol, instead of 1 µM
Leu-EK, was used for stimulating the receptor. In practice, the
membrane was held at 80 mV and depolarized by a 250-ms test pulse
from 80 mV to +10 mV. Since the peak current is inhibited prominently
by Leu-EK (8), the amplitude of peak currents before and during
exposure to Leu-EK or isoproterenol was used as a measure of the
response to the agonist, and the change was expressed as a ratio of
inhibition. Pretreatment (hatched bars) with 200 ng/ml PTX
was carried out according to the procedures described under
"Experimental Procedures." The number of oocytes examined are
indicated in parentheses. * and ** indicate significant
differences (p < 0.05 and p < 0.01, respectively, by analysis of variance with post hoc test)
when compared with controls for the three types of experiments such as
antisense( )/PTX( ), antisense( )/PTX(+) and antisense(+).
C, dose-dependent effects of G such as
Go1 (open bars), Gi3
(filled bars), and Gz (hatched
bars) in potentiating Leu-EK-induced inhibition of
1B currents. Ca2+ channel 1B,
2 and 1a subunits cRNAs and DOR cRNA were
co-injected with G cRNA at various concentrations indicated into
Xenopus oocytes. The responses to 1 µM Leu-EK
were measured and expressed as ratios of them to those in control
oocytes, in which only Ca2+ channel subunits and DOR cRNAs
were injected. The antisense oligonucleotide, AGO, was used. The number
of oocytes examined are 8. The original responses for each before being
normalized were 32.7 ± 3.5, 31.1 ± 4.2, and 25.8 ± 6.1%, respectively. D, potentiating effects of specific
subtypes of G on ACh-induced inhibitions of HVA Ca2+
channels in NG108-15 cells. Current responses to a focal application of
1 mM ACh (3 µl) in untransfected NG108-15 cells
(NG108) and their G -transformed clones with
(hatched bars) or without (open bars)
pretreatment of 500 ng/ml PTX were expressed as ratios of inhibition.
NG108-15 cells were transformed by G as indicated. The number of
oocytes examined are indicated in parentheses.
*p < 0.05 when compared with control untransfected
NG108-15 cells for the two types of experiment such as PTX( ) and
PTX(+).
|
|
After antisense treatment, the agonist-induced inhibition of N-type
1B currents was further pronounced in oocytes injected with Gi3
, Go1
, Gz
, or
Gs
cRNA (Fig. 1A, lower). Here,
the action of Gs
would not be associated with adenylate
cyclase, since the injection of 50 nl of 10 µM cyclic AMP
(n = 3) or 10 units/µl catalytic subunit of PKA
(n = 3) failed to influence
1B currents.
Moreover, the pretreatment with 100 µM H7, a inhibitor of
cyclic nucleotide-dependent protein kinase and protein
kinase C, did not affect the agonist-induced inhibition of
1B currents (n = 6). However, in the
case of L-type
1C channels, the catalytic subunit of PKA
increased their current amplitude by 82.8 ± 10.9% (n = 6). In oocytes injected with cRNAs for
Ca2+ channel subunits (
1B,
2,
and
1a) and
2AR, isoproterenol-induced inhibition of
1B channels was 17.5 ± 1.2%
(n = 45).
To exclude further the possibility that such diffusible second
messengers might be involved in the effects of G-proteins in potentiating the agonist-induced inhibition of N-type
1B
channels, cell-attached patch recordings were performed (see
"Experimental Procedures"). In oocytes implanted with N-type
Ca2+ channel subunits, DOR and Gi3
, multiple
single channel currents through a membrane patch were suppressed by
Leu-EK applied to the patch, but the application to the rest of the
cell membrane was ineffective (n = 4). The extent of
inhibition was 48.0 ± 8.0% (n = 4), which was
comparable to that observed for the whole cell currents of oocytes
(Fig. 1A, lower). Thus, Leu-EK has to be applied directly to the recording membrane patch to induce current inhibition, indicating that the Leu-EK-induced inhibition of
1B
channels associated with Gi3
employs a
membrane-delimited pathway as predicted in native neurons.
As shown in Fig. 1C, the extent to which Leu-EK inhibited
1B channels was dependent on the amount of G
cRNA
injected. The rank order of efficiency among G
subtypes examined was
Gi3
> Go1
> Gz
. The
agonist-induced current inhibition was considerably reduced when a low
concentration (15 ng/µl) of Gz
cRNA was applied. By
contrast, oocytes implanted with Gi2
or
G
1
2 cRNA showed no effect on the
Leu-EK-induced current inhibition, whereas oocytes injected with
Gi1
showed an attenuating effect (Fig. 1A,
lower).
Unlike N-type
1B channels (Fig. 1A,
upper), P/Q-type
1A channels revealed more
conspicuous intensifications of the agonist-induced inhibition by
exogenous G
, probably a result of weak masking effects of endogenous
G-proteins (Fig. 1B, upper). The agonist-induced inhibition of currents was potentiated in those oocytes co-expressed with Gi1
, Gi2
, Gi3
, or
Go1
but not with Gz
or Gs
,
regardless of antisense oligonucleotide (AGO) injection (Fig.
1B), although AGO did attenuate the Leu-EK-induced
inhibition of
1A channels by 23.2 ± 8.6%
(n = 6), as compared with its effect on
1B channels (42.3 ± 7.4%, n = 25). In addition, the agonist-induced inhibition of
1A
channels was diminished in PTX-treated oocytes co-expressed with
Gi3
(Fig. 1B, upper). In oocytes
co-expressed with the PTX-insensitive Gs
, the blockade
of agonist-induced inhibition of
1A channels by PTX was
at the same level as in control oocytes absent of exogenous G
. This
finding is consistent with the observation that the agonist-induced inhibition of
1A currents was not potentiated in oocytes
co-expressed with Gs
. The inhibition of
1A channels was not potentiated in oocytes co-expressed
with G
1
2, similar to
1B
channels.
By contrast, the agonists never evoked an inhibition of L-type
1C currents in oocytes expressed with the
Ca2+ channel
1C,
2, and
1a subunits and the receptor (DOR or
2AR) in combination with either of the six different isoforms of G
(n = 6-30) or G
1
2
(n = 6), even if the concentration of
Gi3
cRNA injected was increased to 150 ng/µl
(n = 4).
To examine whether specifications of G
-mediated inhibition of HVA
Ca2+ channels are reproducible in neuronal cells, we
investigated the mechanism by which native HVA Ca2+
channels are regulated by G
in NG108-15 neuroblastoma-glioma hybrid
cells. NG108-15 cells express N- and L-type Ca2+ channels
(31, 32) and DOR (24) and muscarinic ACh receptors (21) which inhibit
the Ca2+ channel activity. These native HVA
Ca2+ channels were sensitive to 10 µM
nifedipine (n = 10) or 0.3 µM
-conotoxin GVIA (
-CTx) (n = 6), but not to 0.3 µM
-agatoxin IVA (n = 3). Puff
application of 1 mM ACh inhibited HVA Ca2+
currents in the presence of nifedipine (n = 5). On the
other hand, ACh did not inhibit HVA Ca2+ currents in the
presence of both nifedipine and
-CTx (n = 4). These
results indicate that ACh inhibits N-type Ca2+ channel
currents in NG108-15 cells. When exogenous G
isoforms were stably
expressed in NG108-15 cells according to the procedures described
previously (20), the ACh-induced inhibition of HVA Ca2+
currents was potentiated in the clones transfected by the exogenous Gi3
and Go1
but not potentiated by
Gi1
or Gi2
(Fig. 1D). Thus, the specificities of G
in inhibiting native N-type Ca2+
channels were similar to those observed in Xenopus oocytes.
PTX (500 ng/ml, a supramaximal dose) impaired the potentiation by Gi3
and Go1
of the ACh-induced inhibition
of Ca2+ channels (Fig. 1D).
These results indicate that the N-type
1B channel is
negatively regulated by Gi3
, Go1
,
Gz
, and Gs
and that the P/Q-type
1A channel is also negatively regulated by
Gi1
, Gi2
, Gi3
, and
Go1
. It is further suggested that the N- and P/Q-type Ca2+ channels are regulated differentially by distinct G
subtypes. In order to unmask the effect of endogenous G
, the
antisense oligonucleotide, AGO, was routinely used in the following
experiments using Xenopus oocytes (Figs.
2 and
3).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
Differential responses of 1B
and 1A channels to the depolarizing prepulse in
Xenopus oocytes co-expressed with
G 1 2 or G . A, N-type
( 1B, left), but not P/Q-type
( 1A, right), Ca2+ channels in an
oocyte implanted with DOR, Ca2+ channel 1
( 1B or 1A), 2 and
1a subunits, and G 1 2 were
prominently facilitated by a depolarizing prepulse (30 ms in duration)
to +80 mV in the absence of Leu-EK. A 200-ms test pulse was applied to
+10 mV from a holding potential of 100 mV. When preceded by the
conditioning depolarization, the test pulse was applied 20 ms after
cessation of the prepulse. B, effects of changing duration
of the prepulse on 1B (filled circles) and
1A currents (open circles) in oocytes
expressed with DOR, Ca2+ channel 1
( 1B or 1A), 2 and
1a subunits, and G 1 2. In
practice, peak currents were measured before and after application of a
prepulse to +80 mV, and the ratios were expressed as a function of the
duration of prepulse. The number of oocytes examined are 5. C, prepulse-resistant responses to Leu-EK in
1A channels. DOR and Ca2+ channel
1A, 2, and 1a subunits
were co-expressed with G or G 1 2 as
indicated. In control oocytes (None), no exogenous G nor
G 1 2 was expressed. The responses of
1A currents to 1 µM Leu-EK
(horizontal bars), prepulse (open circles), and
both (filled circles) were measured and expressed as ratios.
The same experimental protocols were used as in Fig. 1 for Leu-EK and
as in Fig. 2A for prepulse. The number of oocytes examined
for each data are 4-9. The antisense oligonucleotide, AGO, was used in
A-C.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of loop 1 and C-terminal peptides
derived from 1B or 1A subunit on N- and
P/Q-type Ca2+ channels. Synthetic peptides (10 µM) derived from the loop 1 and C terminus of
1B or 1A subunit (see Fig. 4) were
injected 15 h prior to electrophysiological measurements by
various combinations indicated into Xenopus oocytes, which
were implanted with Ca2+ channel 1,
2, and 1a subunits, DOR, and/or G-protein
subunit (Gi3 , Go1 , or
G 1 2). The amino acid sequence of PL1 is
shared by the 1B and 1A subunits. The
responses of wild-type 1B (A) and
1A (B) channels to 1 µM Leu-EK
(horizontal bars), prepulse (open circles), or
both (filled circles) were measured in oocytes co-expressed
with or without Gi3 , Go1 , or
G 1 2, as indicated, and expressed as
ratios. The pulse protocols were the same as those in Fig.
2C. The antisense oligonucleotide, AGO, was used. The number
of oocytes examined for each data are 4-68 in A and 4-16
in B.
|
|
Effects of G
on the N- and P/Q-type Ca2+
Channels--
Leu-EK-induced inhibitions of N-type,
1B
(Fig. 1A), and P/Q-type,
1A (Fig.
1B), Ca2+ channels were not potentiated when
G
1
2 was co-expressed. Alternatively, Ba2+ currents recorded from oocytes expressed with the
Ca2+ channel
1B,
2, and
1a subunits, DOR and G
1
2
were facilitated by application of a large conditioning depolarization
to +80 mV, in the absence of receptor stimulation (Fig. 2A,
left). As mentioned before (8), this may indicate that the
exogenous G
can inhibit the N-type Ca2+ channel by
itself, therefore without need for receptor-mediated activation of
G-proteins. The prepulse facilitation was not prominent, but still
significant, in the
1A channel (Fig. 2A,
right).
Changing the prepulse duration more clearly revealed the difference in
facilitation between
1B and
1A channels
in oocytes co-expressed with G
1
2 (Fig.
2B). A positive correlation between the extent of
facilitation and prepulse duration was clearly observed in both
1B and
1A channels. However, the currents
through
1A channels became suppressed as the duration of
the prepulse was increased.
As shown in Fig. 2C (horizontal bar),
Leu-EK-induced inhibition of
1A channel currents was
markedly potentiated in oocytes co-expressed with Gi1
,
Gi3
, or Go1
, but this was not the case in
oocytes co-expressed with G
1
2. The
prepulse procedure did not abolish the current inhibitions by G
isoforms (filled circles), whereas it was abolished in
1B channels (Fig. 3A) as shown in the
previous paper (8). Thus, the difference between
1B and
1A channels in G-protein modulation appeared to be more
prominent for G
than G
1
2. Prepulse
depolarization in the presence of G
1
2
facilitated both
1B and
1A channels, but
facilitation of currents that were suppressed by G
was only observed
for the
1B channel. These results suggest that G
s are
capable of distinguishing between HVA Ca2+ channel
types.
Effects of Peptides Derived from Loop 1 and C terminus on the N-
and P/Q-type Ca2+ Channels--
Based upon evidence
uncovering the structural determinants of Gi3
and
G
1
2 interactions with
1B
(8), an attempt was made to see whether
1B peptides
derived from these interaction sites could quench the signaling
accompanying exogenous expression of G-proteins in Xenopus
oocytes. As shown in Fig. 3A
(G
1
2; None, PL1;
open circles), the prepulse facilitation observed in oocytes
co-expressed with G
1
2 was almost
abolished by the injection of PL1, an
1B- (or
1A)-derived peptide comprising an N-terminal cysteine
and the amino acid residues 366-384 of
1B (or the amino acid residues 370-388 of
1A) in loop 1 (see Fig.
4). However, this peptide did not
suppress the potentiation of Leu-Ek-induced inhibition of
1B channels via Gi3
(Fig. 3A,
Gi3
, PL1, horizontal bar). By contrast, such potentiated inhibition with
Gi3
was reduced, as shown in Fig. 3A
(Gi3
, PL1+PB3T1 and
PL1+PB3T4, horizontal bars), by the injection of
PL1 in combination with PB3T1 or PB3T4, an
1B-derived
peptide comprising a cysteine and the amino acid residues 1934-1943
(PB3T1) or 1931-1949 (PB3T4) in the C terminus (see Fig. 4). The
combination of PL1 and PB3T4, a longer version of PB3T1, blocked more
efficiently the potentiation of current inhibition than that of PL1 and
PB3T1. However, injection of PL1 in combination with another
1B-derived C-terminal peptide, PB3T2 or PB3T3 comprising
a cysteine and the amino acid residues 2016-2025 or 1907-1925,
respectively (see Fig. 4), failed to suppress this inhibitory
potentiation via Gi3
(Fig. 3A,
Gi3
, PL1+PB3T2 and PL1+PB3T3, horizontal bars). Moreover, injection
of PB3T4 alone did not affect either the agonist-induced inhibition of
1B channels via Gi3
(Gi3
, PB3T4, horizontal
bar) or the prepulse facilitation via
G
1
2
(G
1
2, PB3T4,
open circle). On the other hand, both PL1 and PB3T4
diminished prepulse facilitation when DOR was stimulated by Leu-EK in
oocytes co-expressed with Gi3
(Gi3
,
PL1 and PB3T4, filled circles). These
experiments using synthetic peptides revealed that both the loop 1 peptide (PL1) and the C-terminal peptide (PB3T4) were necessary to
interrupt the interaction of the N-type
1B channel with
G
, whereas that the loop 1 peptide alone was capable of impairing
the interaction with G
.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 4.
Schematic representation of the sites on
1B subunit for synthesizing the peptides. A,
positions of the loop 1 and the C terminus, together with those of the
deletion (L 1, L 2, L 3, and T 1) as described previously (8),
are indicated by the number of the amino acid residues for
1B subunit (42) and 1A (BI-1
1) subunit (14) in parentheses. The deletion
sites are indicated by the crossing bars, and the
cytoplasmic side below the horizontal lines. The peptides
were synthesized on the basis of the amino acid sequences indicated by
the open circles attached. The asterisk denotes
the binding site for Ca2+ channel subunit (43), and the
filled circle denotes the phosphorylation sites for protein
kinase C (9). B, primary sequences of the synthetic peptides
used representing their alignments with the predicted protein sequences
of the 1B and the 1A subunits. An extra
cysteine (in parentheses) was added to each peptide on the
N-terminal side.
|
|
As in the case of
1B channels, the potentiating effects
of Go1
on the Leu-EK-induced inhibition of
1A channels (Fig. 3B, Go1
, None, horizontal
bar) were suppressed by the injection of the loop 1 peptide, PL1,
together with one of the C-terminal peptides, PB3T1 or PPQT1
(Go1
, PL1+PB3T1 and
PL1+PPQT1, horizontal bars). The peptide PPQT1,
an
1A-version of PB3T4, was comprised of a cysteine and
the amino acid residues 2028-2046 (Fig. 4). However, in contrast to
1B channels, PPQT1 by itself almost abolished the
potentiating effects of Go1
(Go1
, PPQT1, horizontal
bar), as observed with PL1 plus PPQT1. The amino acid sequences of
1B-derived PB3T1, PB3T2, PB3T3, and PB3T4 (other than
the attached cysteine residue) share 60, 80, 13, and 53% identity with
1A, respectively (Fig. 4). PL1 alone, or combination of
PL1 plus PB3T2 or PL1 plus PB3T3, did not reduce the potentiation of
Leu-EK-induced current inhibition via Go1
(Fig.
3B, Go1
, PL1,
PL1+PB3T2, and PL1+PB3T3, horizontal
bars). Thus, the C-terminal peptide (PPQT1) was sufficient to
impede the interaction of the P/Q-type
1A channel with
G
. On the other hand, the less prominent prepulse facilitation of the
1A channel via G
1
2
(relative response: 107.6 ± 0.6%, n = 4; also
see Fig. 2, A and B) appeared to be inhibited by
application of PL1 (98.2 ± 1.8%, n = 5).
Go
, but Not G
2, Binds to the C
Termini of N- and P/Q-type Ca2+ Channels--
The results
so far obtained from electrophysiological observations in this and the
previous (8) studies suggest that the inhibition of N-
(
1B) and P/Q-type (
1A) Ca2+
channels by G-proteins involves direct interactions between the
1B loop 1 and G
and between the
1B/
1A C termini and G
. To examine
these possibilities, the C terminus (corresponding to amino acid
residues 1912-2339) and the loop 1 (corresponding to amino acid
residues 361-483) of N-type Ca2+ channels were expressed
in E. coli as GST fusion proteins, GST-B3T and GST-B3L1,
respectively. Similarly, the C terminus (corresponding to amino acid
residues 1975-2424) and the loop 1 (corresponding to amino acid
residues 365-489) of the P/Q-type channel were also fused with GST
(GST-B1T and GST-B1L1), respectively. Then, as shown in Fig.
5, their ability to bind G
and G
was tested by immunoblot analysis using the antibodies GoAb
and K-20 against Go
and the antibody M-14 against
G
1 (see "Experimental Procedures").

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 5.
In vitro Go bindings to
the C termini of N- and P/Q-type Ca2+ channels.
Immunoblot of Go (A) and G 2
(B) to GST fusion proteins. The purified GST proteins,
GST-B3T (A, lanes 2 and 4;
B, lane 2), GST-B3L1 (A, lanes
6 and 8; B, lane 4), GST-B1T
(A, lanes 10 and 12; B,
lane 6), and GST-B1L1 (B, lane 8)
immobilized on glutathione-Sepharose 4B beads were incubated with
purified bovine brain Go (A, lanes
2, 4, 6, 8, 10, and
12) or G 2 (B, lanes
2, 4, 6, and 8). After washing,
proteins bound to beads were released by boiling and separated by 11%
SDS-PAGE, together with 25 ng (A, lanes 1,
3, 5, and 7) or 5 ng (A,
lanes 9 and 11) of purified Go , or
25 ng of G 2 (B, lanes 1,
3, 5, and 7). Immunoblot analysis was
performed, as described under "Experimental Procedures," using the
antibodies GoAB (A, lanes
1-8) and K-20 (A, lanes
9-12) against Go , and the antibody M-14
against G 1 (B). The incubation with the
antibody GoAB was carried out in the presence
(A, lanes 3, 4, 7, and
8) or absence (A, lanes 1,
2, 5, and 6) of 0.1 mg/ml of the
peptide antigen FGo for GoAB. In the case of
K-20, the antibody was preincubated with (A, lanes
11 and 12) or without (A, lanes 9 and 10) the peptide antigen sc-387P for K-20 according to
the procedure described by the vendor. The first antibodies described
above were diluted at 1:2000 (B, lanes 1 and
2), 1:4000 (A, lanes 1-8;
B, lanes 3 and 4), or 1:8000
(A, lanes 9-12; B,
lanes 5-8). Arrowheads indicate the
positions of purified Go (A) and G
(B). The size markers used were the Wide Range SigmaMarkers
(Sigma). Note that the 39-kDa purified Go (A,
lane 5) is in a higher position than the major nonspecific
bands (A, lane 6), which were not inhibited by
the peptide antigen (A, lane 8).
|
|
The antibody GoAb reacted with a 39-kDa Go
purified from brain (Fig. 5A, lanes 1 and
5) and with several polypeptides released from the
GST-B3T-bound beads that had been incubated with the purified
Go
(Fig. 5A, lane 2). Among these
immunoreactive polypeptides, a 39-kDa polypeptide obviously became
devoid of its reactivity with GoAb by co-incubation with
the peptide antigen FGo for GoAb (Fig.
5A, lane 4, arrowhead). This
co-incubation also abolished the reactivity of the antibody with
Go
(Fig. 5A, lanes 3 and 7). These results indicate that the 39-kDa immunoreactive
polypeptide was recognized specifically by the antibody against
Go
when released from the C terminus. By contrast, this
antibody never detected a 39-kDa polypeptide released from
GST-B3L1-bound beads (Fig. 5A, lanes 6 and
8) or from GST-bound beads (n = 3), the two
kinds of beads that had been incubated with the purified
Go
.
On the other hand, the antibody M-14 reacted with a 36-kDa G
purified from brain (Fig. 5B, lanes 1,
3, 5 and 7), as well as a 36-kDa
polypeptide released from the GST-B3L1-bound beads (Fig. 5B,
lane 4, arrowhead) that had been incubated with
the purified G
2. Both reactivities of M-14 with the
36-kDa polypeptides were inhibited by preincubation of M-14 with the
peptide antigen sc-261P for M-14 (n = 3). No 36-kDa
polypeptide, however, was detected by M-14 in polypeptides released
from GST-B3T-bound beads despite the incubation with the purified
G
2 (Fig. 5B, lane 2, arrowhead). These results support the idea that G
and
G
inhibit the N-type Ca2+ channel by directly
interacting with the C terminus and the loop 1 of the channel,
respectively.
As also shown in Fig. 5A (lane 9), another
antibody K-20 against Go
detected the purified
Go
as well. K-20 mainly reacted with a 39-kDa
polypeptide released from the GST-B1T-bound beads that had been
incubated with the purified Go
(Fig. 5A,
lane 10). This reactivity of K-20 with the 39-kDa
polypeptide was diminished by preincubation of the antibody with the
peptide antigen sc-387P for K-20 (Fig. 5A, lane
12), as observed in the purified Go
(lane 11). As shown in Fig. 5B, the antibody M-14 did not
detect polypeptides released from the GST-B1T-bound beads (lane
6, arrowhead) but detected a 36-kDa polypeptide from
the GST-B1L1-bound beads (lane 8, arrowhead),
when these beads had been incubated with the purified G
2. The reactivity of M-14 with the 36-kDa
polypeptide released from the GST-B1L1-bound beads was inhibited by
preincubation of M-14 with the peptide antigen sc-261P
(n = 3). These results are consistent with the idea,
obtained from the electrophysiological experiments, that the P/Q-type
Ca2+ channel, like N-type, is under the regulation of G
and G
directly interacting with the C terminus and the loop 1 of
the channel, respectively.
 |
DISCUSSION |
In the present study, we found that distinct sets of G
co-expressed in oocytes mediated receptor agonist-induced inhibitions of N-type
1B and P/Q-type
1A channels;
agonist-induced inhibition of the
1B channel was
potentiated by co-expression of Gi3
, Go1
, Gz
, and Gs
, whereas that of the
1A channel was intensified by co-expression of
Gi1
, Gi2
, Gi3
, or
Go1
. Single channel recordings indicated that the
molecular species Gi3
is a PTX-sensitive G-protein in
native tissues and elicits channel inhibition through a
membrane-delimited pathway (33, 3