|
J Biol Chem, Vol. 273, Issue 28, 17780-17786, July 10, 1998
Expression and Characterization of a 70-kDa Fragment of the
Insulin Receptor That Binds Insulin
MINIMIZING LIGAND BINDING DOMAIN OF THE INSULIN
RECEPTOR*
Claus
Kristensen §,
Finn C.
Wiberg¶,
Lauge
Schäffer , and
Asser S.
Andersen
From the Departments of Insulin Research and
¶ Cell Technology, Health Care Discovery, Novo Nordisk,
2880 Bagsværd, Denmark
 |
ABSTRACT |
In order to characterize regions of the insulin
receptor that are essential for ligand binding and possibly identify a
smaller insulin-binding fragment of the receptor, we have used
site-directed mutagenesis to construct a series of insulin receptor
deletion mutants. From 112 to 246 amino acids were deleted from the
-subunit region comprising amino acids 469-729. The receptor
constructs were expressed as soluble insulin receptor IgG fusion
proteins in baby hamster kidney cells and were characterized in binding assays by immunoblotting and chemical cross-linking with radiolabeled insulin. The shortest receptor fragment identified was a free monomeric
-subunit deleted of amino acids 469-703 and 718-729 (exon 11); the
mass of this receptor fragment was found by mass spectrometry to be 70 kDa. This small insulin receptor fragment bound insulin with an
affinity (Kd) of 4.4 nM, which is
similar to what was found for the full-length ectodomain of the insulin
receptor (5.0 nM). Cross-linking experiments confirmed that
the 70-kDa receptor fragment specifically bound insulin.
In summary we have minimized the insulin binding domain of the insulin
receptor by identifying a 70-kDa fragment of the ectodomain that
retains insulin binding affinity making this an interesting candidate
for detailed structural analysis.
 |
INTRODUCTION |
Insulin mediates its effects by binding to specific tyrosine
kinase receptors in the plasma membrane of target cells. The structure
of the insulin receptor has been investigated extensively and recently
reviewed (1, 2); also a number of naturally occurring mutations in the
insulin receptor gene that affects receptor function have been
identified and reviewed by Taylor et al. (3, 4).
The insulin receptor is a glycoprotein of a relative molecular mass of
350-400 kDa, which is synthesized as a single chain polypeptide and
proteolytically cleaved yielding a disulfide-linked - monomer
insulin receptor. Two - monomers are linked by disulfide bonds
between the -subunits, resulting in the - - - receptor subunit configuration. The exact disulfide pattern responsible for this
receptor configuration was elusive for a long time until first an
- contact was shown to connect Cys-524 of the two monomers (5),
and more recently Sparrow et al. (6) described the disulfide
pattern in the C terminus of the ectodomain. Along with the mutational
data available (7-9), these reports suggest the IR1 ectodomain is connected
by the disulfide bonds shown in Fig. 1.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 1.
Major structural features of the insulin
receptor -subunit. Shown is the insulin receptor ectodomain.
The diagram illustrates major domains based on sequence homology and
theoretical considerations. These domains are L1 and
L2 (see Bajaj et al. (11)), the cysteine-rich
domain (Cys), and the alternative spliced region encoded by
exon 11 (Exon11) (34). The disulfide pattern shown is
supported by present data and recently published data (6). The 469-703
region deleted in the present study is indicated to the
right.
|
|
The intracellular part of the -subunit includes the tyrosine kinase
domain that acquire kinase activity upon binding of insulin to epitopes
in the ectodomain. The x-ray crystal structure of the tyrosine kinase
domain has been solved (10), whereas detailed three-dimensional
structure of the insulin-binding site is not available, so only
indirect information can be used to identify important structural
features necessary for insulin binding. Predictions of the tertiary
structure of the IR ectodomain have been based on alignment with
epidermal growth factor receptor sequences (11, 12). The consensus from
these alignments is that the insulin receptor -subunits have two
large homologous domains, L1 and L2, separated by a cysteine-rich
region. The L1 and L2 domains are comprised of four repeats of
-helices followed by -strand, turn, and -strand. The best
conserved feature in these repeats is a central glycine residue
responsible for the turn (11). The L1 region spans amino acids 1-155
(nomenclature of Ebina et al. (13)), and the cysteine-rich
region comprises residues 155-312, and L2 comprises residues 313-468
(12). Thus, the first 468 amino acids of the -subunit are predicted
to be well defined domains with extensive homologies to the epidermal
growth factor receptor. The corresponding domain of the IGFI receptor
(1-486) was expressed in C6 rat glioblastoma cells resulting in
inhibited IGFI receptor signaling and inhibition of growth (14), and
recently McKern et al. (15) have reported crystallization of
these first three domains of the IGFI receptor (residues 1-462).
The major ligand binding determinants of the IR appear to reside in the
-subunit. Studies with chimeric receptors (16, 17), alanine scanning
mutagenesis (18), and cross-linking studies (19) have suggested a
binding epitope within the N-terminal 120 amino acids. Other
cross-linking studies have identified hormone-receptor contact sites in
the cysteine-rich region (20, 21) and just to the carboxyl side of the
cysteine-rich domain around residue 390 (22). Finally in the C terminus
of the -subunit, cross-linking with photoreactive insulin
derivatives (23) and alanine scanning mutagenesis (24) indicate that an
important binding domain is found between amino acids 704 and 716. The
insulin contact sites are apparently located exclusively in the
-subunit which was further verified by investigating expression of
free -subunit in COS cells (25). The -subunit was secreted as a
monomer that bound insulin with near wild-type affinity, but the
expression level of free -subunit was low allowing only limited
characterization (25).
Insulin receptor deletion mutants have previously been expressed by two
groups; Kadowaki et al. (26) described an insulin receptor
deleted of amino acids 486-569, and Sung et al. (27) expressed a receptor with deletion of amino acids 485-599. Both groups
found that the mutated receptors bound insulin with high affinity.
In the present study we have used site-directed mutagenesis to
construct a series of insulin receptors with deletions of 112-246 amino acids in the IR region 469-729 (exons 7-11). The receptors were
stably expressed in BHK cells as soluble receptor IgG fusion protein,
and secreted protein was characterized in binding assays, by
immunoblotting, and chemical cross-linking, and molecular weight was
determined by mass spectrometry. By using this approach we succeeded in
identifying and characterizing a 70-kDa fragment of the insulin
receptor. This receptor fragment is a free monomeric -subunit
deleted of amino acids 469-703 and 718-729 that binds insulin with an
affinity comparable to the intact ectodomain.
 |
MATERIALS AND METHODS |
Miscellaneous--
Insulin, insulin analogue X92 (A8H, B10D,
B25Y-amide, and des-B26-30 insulin), and A14-125I-insulin
and A14-125I-X92 were from Novo Nordisk. cDNA encoding
IR-IgG fusion protein was a gift of Dr. Joseph Bass, University of
Chicago. DNA restriction enzymes, T4 ligase,
endo- -N-acetylglucosaminidase H, and PNGaseF were from
New England Biolabs; Pwo polymerase was from Boehringer Mannheim. Neuraminidase was from Sigma. Preparation of plasmid DNA and
agarose and polyacrylamide gel electrophoresis were performed according
to standard methods (28). For DNA minipreps QIAprep 8 kit was used
(Qiagen). BHK cells were grown in Dulbecco's modified Eagle's medium
(Life Technologies Inc.) supplemented with 10 or 2% fetal calf serum.
Staphylococcus aureus protein A was from Amersham Pharmacia
Biotech, and DSS (disuccinimidyl suberate) was from Pierce.
Construction of cDNA Expression Plasmids Encoding Receptor
Deletion Constructs--
An overview of the deletion constructs and
the abbreviations used are shown in Table
I. The deletion mutants were expressed as
soluble insulin receptor (IR) IgG fusion protein, consisting of the IR
ectodomain fused to the Fc region of the IgG heavy chain (29). The
IR-IgG fusion constructs were stably expressed in BHK cells by
inserting the 3532-base pair NotI/XbaI fragment
from the pBluescriptII-HIRs-Fc vector (29) into the ZEM expression vector and transfecting this into BHK cells as described previously (16, 30).
View this table:
[in this window]
[in a new window]
|
Table I
Insulin affinity of receptor deletion constructs
Affinities (Kd) of the receptor deletion constructs
for insulin are shown. Each affinity is the average ± S.D. for at
least three independent experiments. The data were determined from
binding curves similar to those shown in Fig. 2, as described under
"Materials and Methods."
|
|
The deletion mutant IR 599 was made by PCR amplification using the
sense primer
5'-CCTCTAAGATCTTGGATCCAATCTCAGTG-3'
(BglII and BamHI sites underlined) and an
antisense primer downstream from EagI site (amino acid
678-680). This fragment was digested with BglII and
EagI and ligated into the corresponding site of the plasmid
encoding IRwt, resulting in a cDNA sequence where amino acids
485-599 are deleted. IR 613 and IR 629 were made using same
strategy (BglII/EagI site), and the sense primers
5'-TGACAAGATCTTGAAGTGGAAACCACCCTCCG-3' and
5'-TGACAAGATCTTGGTTTTCTGGGAGAGGCAGG-3', respectively
(BglII sites underlined). In the construct IR 649, exons
7-9 were deleted by PCR amplification using a sense primer located
upstream from Bsu36I site (amino acids 417-419) and the
antisense primer
5'-AGGTCCTCGAGGGCAGCTTCAGCCCACAGGATGCCTTGTCCCC-3' (XhoI site underlined). This fragment was digested with
Bsu36I and XhoI and ligated into corresponding
site of the plasmid encoding IRwt, resulting in a cDNA sequence in
which amino acids 469-649 are deleted. IR 673 was constructed by
overlap extension of fragments I and II. Fragment I was amplified using
a sense primer upstream from Bsu36I site and the antisense
primer 5'-CTCACAGCTAGCCTTGTCCCCATTGGTC-3' (NheI
site underlined). Fragment II was amplified using sense primer
5'-GGGGACAAGGCTAGCTGTGAGTATGAGGATTCGGCCGGCG-3'
(NheI site underlined) and an antisense primer downstream
from the AvrII site (amino acids 728-729 in exon 11). The
overlap fragment was digested with Bsu36I and
AvrII and ligated into corresponding site of the plasmid
encoding IRwt, resulting in a cDNA sequence deleted of amino acids
469-673, and a new silent NheI site is introduced (amino
acids 466-467). IR 685 was made using the sense primer
5'-GACAAGGCTAGCTGTCCAAAGACAGACTCTCAGATCC-3' (NheI site is
underlined) and an antisense primer downstream from the
AvrII site (amino acids 728-729). This fragment was
digested with NheI and AvrII and ligated into
corresponding site of the plasmid encoding IR 673, resulting in a
cDNA sequence deleted of amino acids 469-685.
Finally IR 685* and IR 703 were made by PCR amplification using a
sense primer upstream from the NarI site (amino acids
450-452) and the antisense primers
5'-TTTTCCTAGGGACGAAAACCACG-3' and
5'-TTTTCCTAGGGACGAAAACCACGTTGTGCAGGTAATCCTCAAACGTACAGCTAGCCTTGTCCCC (AvrII site underlined). The fragments were digested
with NarI and AvrII and ligated into the
corresponding site of the plasmid encoding IRwt, resulting in cDNA
sequences deleted of amino acids 469-685 + 718-729 and 469-703 + 718-729, respectively. In these two constructs a new silent
AvrII site was introduced (amino acids 716-717).
Insulin Receptor Binding Assay--
Two binding assays were
used, a microtiter plate assay and a polyethylene glycol precipitation
assay. For the plate assay receptor, IgG fusions were immobilized on
protein A-coated microtiter plates, as described in detail (31).
Briefly wells were coated with protein A, washed 3 times with binding
buffer (100 mM Hepes, pH 8.0, 100 mM NaCl, 10 mM MgCl2, 0.05% (w/v) bovine serum albumin, 0.025% (w/v) Triton X-100) before a dilution of receptor fusion construct in binding buffer was added to each well. After incubation for 3 h at room temperature, the plates were washed 3 times with binding buffer. Binding experiments were performed by adding a total
volume of 150 µl of binding buffer with A14-125I-insulin
(5-10 pM) and varying concentrations of insulin. After 16 h at 4 °C unbound ligand was removed by aspirating the
buffer and washing once with cold binding buffer, and the
A14-125I-insulin bound in each well was counted in a
-counter.
The precipitation assay was performed by incubating a suitable dilution
of BHK medium containing receptor in a total volume of 200 µl with
A14-125I-insulin (5-10 pM) and varying
concentrations of unlabeled ligand in binding buffer for 16 h at
4 °C. Subsequently bound counts were recovered by precipitation with
0.2% -globulin and 500 µl of 25% (w/v) polyethylene glycol 8000. Bound A14-125I-insulin was counted in a -counter.
In both assays the concentration of receptor was adjusted to yield
10-15% binding of tracer when no competing ligand was added in the
competition assay. The binding data were fitted using nonlinear regression algorithm in GraphPad Prism 2.01 (GraphPad Software Inc.,
San Diego, CA).
Immunoblotting--
The expressed receptors were detected by
immunoblotting using the monoclonal antibody mAb-F26. This antibody was
raised against a peptide corresponding to amino acids 39-75, mapping
at the N terminus of the insulin receptor -subunit. The antibody was
kindly donated by Jes Thorn Clausen, Novo Nordisk. For blotting, medium from BHK cells expressing receptor constructs was mixed with 0.33 volume of SDS-PAGE loading buffer (40% w/v sucrose, 563 mM
Tris base, 423 mM Tris-HCl, 278 mM SDS, 2 mM EDTA, 0.88 mM Serva Blue G250, 0.7 mM phenol red), and 20 µl was run on a 6%
SDS-polyacrylamide gel. Reduced samples were mixed with loading buffer
containing 0.1 M dithiothreitol (DTT) and incubated at
70 °C for 10 min before loading 20 µl on SDS-polyacrylamide gel.
After electrophoresis proteins were blotted onto Immobilon-P membrane
(Millipore). The membrane was blocked by incubating with blocking
buffer (5% defatted skim milk, 2% bovine serum albumin in TBS (150 mM NaCl, 10 mM Tris-HCl, pH 7.5)) for 16 h
at 4 °C. The receptor antibody mAb-F26 was diluted in blocking
buffer, and after incubating with receptor antibody the membrane was
washed with TBS before incubating with peroxidase-conjugated rabbit
anti-mouse immunoglobins antibody (P260 from DAKO, Denmark). Finally
the blot was washed with TBS and immunoreactive protein was detected
using ECL reagent from Amersham Pharmacia Biotech.
Cross-linking of 125I-X92 to Receptors--
For
chemical cross-linking the high affinity analogue X92 (A8H, B10D,
B25Y-amide, des-B26-30 insulin) was used because the high affinity of
this analogue allowed detection of receptors directly in BHK medium,
and cross-linking was performed essentially as described (16, 32).
Medium from BHK cells expressing receptor constructs was incubated for
60 min at room temperature with A14-125I-X92 (0.14 nM) in the presence or absence of unlabeled X92 (1 µM). DSS in dimethyl sulfoxide was added from a 10 mM stock solution to a final concentration of 0.1 mM. After 15 min on ice the reaction was stopped by adding
0.33 volume of SDS-PAGE loading buffer or 0.33 volume SDS-PAGE loading
buffer with 0.1 M DTT. Reduced samples were incubated at
70 °C for 10 min before running on a 6% SDS-polyacrylamide gel. The
gel was fixed in 10% acetic acid, 20% ethanol, and a PhosphorImager
screen was exposed with the dried gel.
Deglycosylation and Mass Spectrometry--
The smallest receptor
fragment, IR 703 was purified by affinity chromatography using
immobilized insulin as described previously (33). IR 703 in Hepes, pH
8.0, 0.5% n-octyl glucopyranoside, was treated with a
deglycosylation mixture containing neuraminidase, endo- -N-acetylglucosaminidase H, and PNGaseF, either in
the presence or absence of 0.1% SDS, for 18 h at 37 °C.
MALDI-TOF mass spectra were recorded on a Voyager DE (Perseptive
Biosystems) in sinapinic acid matrix. Calibration was performed on the
MH+ and MH22+[/eq] ions of human
serum albumin.
 |
RESULTS |
Cloning and Expression of Receptor Deletion Constructs--
We
initially introduced the deletion described by Sung et al.
(27) into our soluble IR-IgG fusion construct; this is the IR 599,
deleted of amino acids 487-599. The constructs IR 613 and IR 629
were also deleted from amino acid 487, whereas the remaining five
constructs were deleted from amino acid 469. The rationale for this is
that amino acid Cys-468 is the last amino acid in exon 6 and also the
last amino acid in the L2 domain; thus IR residues 1-468 are predicted
to be a large domain with homology to the N-terminal domain of the
epidermal growth factor receptor (11).
Receptor Deletion Constructs: Binding of Insulin--
Insulin
receptor secreted into BHK medium was analyzed in two binding assays.
The receptor used here is fused to the Fc region of IgG, and therefore
intact receptors could be immobilized using protein A. In this way
binding curves for IRwt, IR 599, IR 613, and IR 629 receptors
could be generated; the affinities of these receptors were 2-3
nM (Kd) (Table I). In contrast no binding was detectable in the protein A assay for all receptor constructs deleted of amino acids 630-649. The polyethylene glycol precipitation assay yielded binding curves for all the constructs expressed (Fig. 2 and Table I). In Fig. 2
are shown binding curves obtained when using insulin to displace
A14-125I-insulin from IRwt, IR 599, IR 649, and
IR 703. The IRwt receptor displacement curve is biphasic fitting to a
two-site binding model with binding affinities in the picomolar range
(31) for the high affinity site and a Kd of 3.1 ± 0.9 nM for the low affinity site in the protein A assay.
The binding curves for all deleted receptors were clearly one-sited
(Fig. 2) with affinities ranging from 1 to 7 nM in the
binding assays. The lowest Kd of 1.1 nM
was observed for IR 673, and the shortest construct IR 703 gave a
Kd of 4.4 ± 0.8 nM. For the
full-length ectodomain the affinity for insulin was 5.0 ± 0.2 nM.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Competition binding of recombinant receptors.
125I-Insulin (5 pM) was incubated with a
suitable dilution of medium from transfected BHK cells and increasing
concentrations of unlabeled insulin. Bound counts were recovered by
precipitation with polyethylene glycol/ -globulin. Cells were
transfected with either IRwt ( ), IR 599 ( ), IR 649 ( ), or
IR 703 ( ). Competition binding curves for IRwt were fitted to a
two-site binding model using nonlinear regression, and the other curves
were fitted to a one-site model.
|
|
Two of the deletion constructs IR 685 and IR 685* only differ by
the exon 11 region (amino acids 718-729); the affinity of IR 685 for
insulin was 6.4 ± 2.4 nM, and when exon 11 is deleted in IR 685* the affinity was 7.3 ± 1.6 nM, so in
these deletion receptors the exon 11 region does not influence binding
of insulin significantly, in contrast to what has been reported for the
IR holoreceptor (34) or the insulin proreceptor (35).
Detecting Receptor Fragments by Immunoblotting--
The antibody
used for immunoblotting was raised against an N-terminal epitope of the
insulin receptor, and thus it would be expected to recognize the
-subunit of all receptors deletion constructs expressed.
Immunoblotting was performed on non-reduced as well as reduced samples
of medium from transfected BHK cells. The immunoblots are shown in Fig.
3. On the reduced gel (Fig. 3A) the antibody detects the full-length -subunit of 130 kDa in the IRwt sample, whereas the deletion constructs show a gradual decrease in size of the -subunit from apparent mass of 130 kDa to
approximately 80 kDa for the smallest receptor construct IR 703. This
receptor is also shown in its deglycosylated form after PNGaseF treatment, where it acquires an apparent mass of approximately 55 kDa
comparable to what was predicted from the amino acid sequence. For
immunoblotting similar volumes of BHK medium were loaded, so in
addition to smaller size there seems to be better expression yields
when expressing the smaller receptor fragments. Immunoblotting of the
unreduced samples reveals three groups of immunoreactive bands (Fig.
3). The full-length receptor fusion IRwt has been reported to migrate
as 380-kDa protein on SDS-PAGE (29) consistent with the high molecular
mass band of more than 200 kDa observed on the blot (Fig.
3A). The blot shows bands that have not entered the
separation gel indicating aggregation to very high molecular weight
complexes, which is also consistent with the previous report on this
receptor (29). IR 599, IR 613, and IR 629 have mobility corresponding to intact receptor IgG fusion so apparently deletion of
Cys-524 is well tolerated in terms of disulfide linkage of the receptor
subunits, indicating that Cys-524 is not the only - disulfide
linkage. A marked decrease in molecular weight is seen with IR 649 in
which residues 630-649 are deleted. The decreased size is consistent
with a loss of contact between - and -subunits suggesting that
Cys-647 is responsible for the only disulfide linkage between - and
-subunits. There seems to be small amounts of monomeric -subunit
even in the IR 649 construct and more pronounced in the
IR 673 construct probably because the - dimer is not very
stable when one of the - disulfides (Cys-524) has been removed.
Possibly interactions between the Fc regions fused to the ectodomain
also stabilize the disulfide between the two -subunits. Finally the
constructs IR 685, IR 685*, and IR 703 all represent free
monomeric -subunit fragments only. This supports that Cys-682, Cys-683, or Cys-685 is involved in the second - disulfide
bond.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
Immunoblotting of receptor constructs
secreted from BHK cells. Medium from BHK cells transfected with
receptor deletion constructs was collected, and 15 µl of medium was
mixed with 5 µl of SDS loading buffer, and proteins were separated on
6% SDS-polyacrylamide gel and blotted onto polyvinylidene difluoride
membrane. IR -subunit was detected using a monoclonal antibody
specific for epitope near the N-terminal -subunit as described under
"Materials and Methods." The following samples were
analyzed: IRwt (lane 1), IR 599 (lane 2),
IR 613 (lane 3), IR 629 (lane 4), IR 649
(lane 5), IR 673 (lane 6), IR 685 (lane
7), IR 685* (lane 8), IR 703 (lane 9),
and IR 703 treated with PNGaseF (lane 10 in A
only). Samples in A were unreduced, and in B
samples were reduced by adding DTT and boiling before loading onto gel.
Molecular mass markers (Rainbow from Amersham Pharmacia Biotech) are
indicated to the left.
|
|
Cross-linking of 125I-X92 to Receptors--
Chemical
cross-linking of A14-125I-X92 insulin analogue was
performed using BHK medium directly. After cross-linking, samples were
run under reduced as well as non-reduced conditions (Fig. 4). Both reduced and non-reduced gels
show a cross-linking pattern similar to the immunoblotting pattern,
demonstrating that all receptor fragments that are recognized by the
antibody specific for IR -subunit bind insulin. On the reduced gel
(Fig. 4B) faint bands are visible, with apparent molecular
mass of more than 200 kDa, and they appear in the first four
constructs; this is probably due to intrareceptor cross-linking
artifacts. For these cross-linking experiments similar volumes of
medium were applied, and thus the intensity of the bands reflects
affinity as well as amount of receptor so quantitative conclusions
cannot be drawn directly. Nevertheless, considering the similar
affinities found in the binding assay (Fig. 2 and Table I), the
IR 703 receptor fragment appears to be very efficiently expressed in
the BHK cells. The non-reduced gel (Fig. 4A) shows that in
several of the deletion constructs a mixture of - - - ,
- dimers, and free -subunits appear, but the binding data
clearly suggest that there is a homogenous population of
insulin-binding sites in all constructs (nM affinity). The
structure of this nanomolar binding site appears very stable, as it is
not influenced by the large deletions in the 469-703 region, nor does
insulin binding depend on - or - -subunit contacts.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4.
Covalent cross-linking of
125I-X92 insulin analogue to receptor deletion
constructs. Autoradiograph of 6% SDS-polyacrylamide gel showing
the receptors covalently cross-linked with DSS to iodinated insulin
analogue. Receptors secreted from BHK cells were cross-linked to
125I-X92 using 0.2 mM DSS in the absence ( )
or presence (+) of 1 µM unlabeled X92. The following
samples were analyzed: IRwt (lane 1), IR 599 (lane
2), IR 613 (lane 3), IR 629 (lane 4),
IR 649 (lane 5), IR 673 (lane 6), IR 685
(lane 7), IR 685* (lane 8), and IR 703
(lane 9). Samples in A were unreduced, and in
B samples were reduced by adding DTT and boiling before
loading onto gel. Molecular mass markers (14C-Rainbow from
Amersham Pharmacia Biotech) are indicated to the left.
|
|
Deglycosylation and Mass Spectrometry--
The mass of IR 703
was found by mass spectrometry to be 70.5 kDa (Fig.
5A) which is somewhat lower
than the apparent molecular mass observed by SDS-PAGE (Fig. 3). The
band was fairly broad, presumably due to glycosylation heterogeneity.
Complete deglycosylation in the presence of 0.1% SDS gave a sharper
peak at 54.5 kDa (Fig. 5C) which is in good agreement with
the calculated value of 55.2 kDa. Partial deglycosylation gave a series
of peaks with a spacing of 1.5-2.0 kDa corresponding to the core
protein with 0-5 remaining carbohydrate chains (Fig. 5B).
The difference in molecular weights between the native and the
completely deglycosylated forms is consistent with extensive use of the
10 potential N-glycosylation sites.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5.
MALDI-TOF mass spectra of IR 703. Mass
spectra of native IR 703 protein (A) or IR 703 treated
with a deglycosylation mixture containing neuraminidase,
endo- -N-acetylglucosaminidase H, and PNGaseF. Complete
deglycosylation was obtained in the presence of 0.1% SDS
(C), and in the absence of SDS only partial deglycosylation
was obtained (B).
|
|
 |
DISCUSSION |
We wanted to characterize the domains of the IR that are essential
for ligand binding. Characterizing the binding domains was approached
indirectly by investigating which domains could be deleted from the IR
without compromising insulin binding. The deletion constructs were
expressed as fusion protein of IR ectodomain and Fc, the constant
region of IgG heavy chain, which allows immobilization for binding
assay. This construct (IRwt) has been described in detail by Bass
et al. (29), and we have previously reported that this
receptor fusion construct binds insulin with biphasic binding curves
(31), and the high affinity component of this receptor has affinity
that is similar to what is found for the holoreceptor. The high
affinity of the holoreceptor has been ascribed to the presence of two
binding epitopes on the insulin molecule which are required to bridge
the two receptor -subunits to attain picomolar affinity binding (36,
37). In contrast to the biphasic binding curves obtained with the
intact IRwt receptor, all deletion constructs yielded one-site binding
curves with nanomolar affinity (Fig. 2 and Table I), similar to what is
found for the intact IR ectodomain secreted from BHK cells. The loss of
high affinity binding in the IR ectodomain has been suggested to be due
to loss of contact between the two -subunits so that insulin cannot
bridge the two -subunits (36, 37), and certainly in several of our constructs the - contact is lost resulting in monomeric
-subunit fragments.
In contrast to previous attempts to express free IR -subunits (25),
we have achieved good expression levels allowing characterization of
deleted -subunit fragments without purification. Two groups have
previously expressed deletion mutants of the insulin holoreceptor. Kadowaki et al. (26) described an insulin receptor deleted
of amino acids 486-569, and Sung et al. (27) expressed a
receptor deleted of amino acids 485-599. Kadowaki et al.
(26) found a 3-fold decrease in insulin affinity when deleting amino
acids 486-569; furthermore, the Scatchard plots were nearly linear
indicating that the deletion caused loss of high affinity binding also
in the holoreceptor. Sung et al. (27) reported unchanged
ligand binding with the deleted IR but a blunted tyrosine
autophosphorylation response and concluded that the deleted region was
a regulatory domain for insulin regulation of -subunit functions.
The two reports on deleted holoreceptors demonstrated that domains of the IR -subunit can be deleted without compromising insulin binding, and we pursued this concept by deleting up to 246 amino acids and
succeeded in identifying an insulin-binding receptor fragment of only
70 kDa (Fig. 6).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
The IR 703 protein. The 70-kDa protein
secreted from BHK cells expressing IR 703 consists of the first three
domains of the IR (L1, cysteine-rich domain
(CYS), and L2) and 16 amino acids from the C
terminus of the -subunit.
|
|
The receptor region investigated here (amino acids 469-685) has been
suggested to contain cysteines that are responsible for - and
- disulfides in the - - - -subunit composition (Fig. 1)
(5, 8, 9). The importance of this region for subunit interactions is
clearly evident from the stepwise decomposition of the receptor that we
observe using the deletion strategy. The first deletion constructs
IR 599, IR 613, and IR 629 have intact - - - structure,
whereas IR 649 and IR 673 primarily are secreted as - dimers,
and IR 685, IR 685*, and IR 703 are monomeric -subunits. The
five cysteines found within residues 469-703 are at positions 524, 647, 682, 683, and 685. The data on the present deletion constructs
including insulin binding, immunoblotting, and cross-linking show that
the - contact is lost in all constructs where Cys-647 is deleted,
but intact in all other constructs indicating that Cys-647 is involved
in the only disulfide contact between - and -subunits. This is in
accordance with Cheatham and Kahn (9), who found that mutating Cys-647
to Ser resulted in - dimeric receptor fragments when expressed in
Chinese hamster ovary cells.
Cysteine 524 has been reported to be involved in - contact (class
one disulfide bond) (5) but is apparently not the only residue involved
in the disulfide-bonded IR dimer (7, 26). In the present constructs
- contact seems to be completely lost when residues 637-685 are
deleted, resulting in secretion of monomeric -subunits only. This
strongly suggests that one of the cysteines 682, 683, or 685 is also
involved in - contact, in accordance with reports by Lu and
Guidotti (8) and more recently by Sparrow et al. (6). At
least two groups have suggested - disulfide contact in the
N-terminal 200 amino acids (12, 38), but the present data do not
support this.
In summary we suggest that there are two disulfides connecting the two
-subunits, one involving Cys-524 and one involving one of cysteines
682, 683, or 685. The - disulfide connection we suggest involves
only residue Cys-647. The resulting disulfide pattern shown in Fig. 1
is in accordance with mutational data (8, 9), and the recent
identification of the disulfide bonds in the C terminus of the
ectodomain by Sparrow et al. (6), who suggested that Cys-647
in the -subunit is connected to Cys-872 in the -subunit and that
-chain residues 798 and 807 are connected leaving Cys-884 as a
buried thiol in the soluble ectodomain (6).
In the present study we have deleted 234 amino acids in the central
part of the IR -subunit without compromising ligand binding. The
fact that this large domain can be deleted indicates that the N and C
termini that are known to be important for binding of insulin (16-18,
23, 24) must remain in close contact in the IR structure. The deleted
region (469-703) is apparently not essential for the insulin binding
region, and what actually keeps the C-terminal 16 amino acids of the
70-kDa receptor fragment (Fig. 6) in close contact to the N-terminal
468 amino acids is not clear. By using alanine scanning mutagenesis
Mynarcik et al. (24) found that 7 alanine mutations in the
704-716 region were deleterious to insulin binding (loss of more than
100-fold on Kd). Clearly all of these effects cannot
be direct effects on ligand-receptor interaction, and it may be that
some of these residues are essential for docking the C terminus of the
-subunit in close contact to regions N-terminal to amino acid 468, i.e. maintaining the insulin-binding pocket intact.
In the region deleted it has been suggested that residues 485-599
contain a regulatory domain for insulin regulation of -subunit functions (27); this was based on observations of a blunted tyrosine
autophosphorylation response in a holoreceptor deleted of residues
485-599. We only expressed soluble receptors so we cannot argue for
regulatory functions, but deleting a region including one of the
cysteines (Cys-524) involved in subunit interaction and in close
proximity to other important cysteines could likely modify the
conformational changes needed for tyrosine kinase activation.
The deleted region has also been implied in some cases of insulin
resistance because it contains a major immunogenic region (amino acids
450-601) that includes an epitope recognized by anti-receptor antibodies (40). Zhang and Roth (40) found that several monoclonal antibodies and anti-receptor autoantibodies from all 15 patients with
type B insulin resistance recognized epitopes within amino acids
450-601.
Another approach that has given valuable information on IR function is
the naturally occurring IR mutants observed in patients (3, 4). Of the
approximately 30 mutations described in the insulin receptor
ectodomain, most are found in the first 412 residues. There are three
mutations in the extracellular part of the -subunit, and one in the
proteolytic cleavage site ( - junction), but only one mutation is
recognized within residues 469-703, and this is a premature stop
codon. This again indicates that this region is not of major importance
for receptor function.
The best characterized ligand receptor interaction is that of growth
hormone binding to its receptor. For this receptor system a naturally
occurring receptor fragment has been identified in serum (41); this
receptor fragment comprises the 246 amino acids ectodomain of the GH
receptor. Upon binding of GH the receptor fragment dimerize like the
full-length receptor, and also the binding affinity of the full-length
receptor is intact. By using a recombinant version of this receptor
fragment (residues 1-238) expressed in Escherichia coli the
crystal structure of GH in complex with GH receptor fragment was solved
(42). In the insulin receptor system the ectodomain is much larger
(almost 1900 amino acids, 350-400 kDa); it is dimeric also in the
absence of ligand, and no naturally occurring ligand binding fragment
has been identified. Attempts to obtain smaller IR fragments that bind
insulin have not been met with much success; only the full-length
ectodomain has been expressed and purified in substantial quantities
(16, 33). Given the size and complexity of the ectodomain protein, the
identification of a minimal ligand-receptor complex is expected to
facilitate generation of crystals suitable for detailed structural analysis by x-ray crystallography. In the present study we tried to
minimize the ligand binding domain of the insulin receptor by deleting
regions of the IR -subunit. We succeeded in obtaining a 70-kDa
monomeric receptor fragment that binds insulin with an affinity similar
to what is found for the soluble ectodomain of the insulin
receptor.
 |
ACKNOWLEDGEMENTS |
We thank Durita Simonsen, Ulla M. Jørgensen,
Jytte Topp-Radzikowska, and Lene Drube for excellent technical
assistance and Dr. Joseph Bass (University of Chicago) for providing
IR-IgG cDNA.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Insulin Research, Novo
Nordisk, Novo Allé, 6B1.90, 2880 Bagsværd, Denmark. Tel.: 45 4442 3572; Fax: 45 4444 4250; E-mail clak{at}novo.dk.
1
The abbreviations used are: IR, insulin
receptor; BHK, baby hamster kidney; DSS, disuccinimidyl suberate; GH,
growth hormone; IGFI, insulin-like growth factor I; MALDI-TOF, matrix
associated laser desorption ionization-time of flight; PCR, polymerase
chain reaction; PAGE, polyacrylamide gel electrophoresis; DTT,
dithiothreitol; TBS, Tris-buffered saline; PNGase, peptide
N-glycosidase.
 |
REFERENCES |
-
Lee, J.,
and Pilch, P. F.
(1994)
Am. J. Physiol.
266,
C319-C334[Abstract/Free Full Text]
-
Tavaré, J. M.,
and Siddle, K.
(1993)
Biochim. Biophys. Acta
1178,
21-39[Medline]
[Order article via Infotrieve]
-
Taylor, S.,
Cama, A.,
Accili, D.,
Barbetti, F.,
Quon, M. J.,
Sierra, M. L.,
Suzuki, Y.,
Koller, E.,
Levy-Toledano, R.,
Wertheimer, E.,
Moncada, V. Y.,
Kadowaki, H.,
and Kadowaki, T.
(1992)
Endocr. Rev.
13,
566-595[CrossRef][Medline]
[Order article via Infotrieve]
-
Taylor, S. I.,
Wertheimer, E.,
Accili, D.,
Cama, A.,
Hone, J.,
Roach, P.,
Quon, M. J.,
Suzuki, Y.,
Levy-Toledano, R.,
Taouis, M.,
Sierra, M. L.,
Barbetti, F.,
and Gorden, P.
(1994)
Endocr. Rev.
2,
58-65
-
Schäffer, L.,
and Ljungqvist, L.
(1992)
Biochem. Biophys. Res. Commun.
189,
650-653[CrossRef][Medline]
[Order article via Infotrieve]
-
Sparrow, L. G.,
McKern, N. M.,
Gorman, J. J.,
Strike, P. M.,
Robinson, C. P.,
Bentley, J. D.,
and Ward, C. W.
(1997)
J. Biol. Chem.
272,
29460-29467[Abstract/Free Full Text]
-
Macauley, S. L.,
Polites, M.,
Hewish, D. R.,
and Ward, C. W.
(1994)
Biochem. J.
303,
575-581
-
Lu, K.,
and Guidotti, G.
(1996)
Mol. Biol. Cell
7,
679-691[Abstract]
-
Cheatham, B.,
and Kahn, C. R.
(1992)
J. Biol. Chem.
267,
7108-7115[Abstract/Free Full Text]
-
Hubbard, S. R.,
Wei, L.,
Ellis, L.,
and Hendrickson, W. A.
(1994)
Nature
372,
746-754[CrossRef][Medline]
[Order article via Infotrieve]
-
Bajaj, M.,
Waterfield, M. D.,
Schlessinger, J.,
Taylor, W. R.,
and Blundell, T.
(1987)
Biochim. Biophys. Acta
916,
220-226[CrossRef][Medline]
[Order article via Infotrieve]
-
Ward, C. W.,
Hoyne, P. A.,
and Flegg, R. H.
(1995)
Proteins Struct. Funct. Genet.
22,
141-153[CrossRef][Medline]
[Order article via Infotrieve]
-
Ebina, Y.,
Ellis, L.,
Jarnagin, K.,
Edery, M.,
Graf, L.,
Clauser, E.,
Ou, J.-H.,
Masiarz, F.,
Kan, Y. W.,
Goldfine, I. D.,
Roth, R. A.,
and Rutter, W. J.
(1985)
Cell
40,
747-758[CrossRef][Medline]
[Order article via Infotrieve]
-
D'Ambrosio, C.,
Ferber, A.,
Resnicoff, M.,
and Baserga, R.
(1996)
Cancer Res.
56,
4013-4020[Abstract/Free Full Text]
-
McKern, N. M.,
Lou, M.,
Frenkel, M. J.,
Verkuylen, A.,
Bentley, J. D.,
Lovrecz, G. O.,
Ivancic, N.,
Elleman, T. C.,
Garrett, T. P. J.,
Cosgrove, L. J.,
and Ward, C. W.
(1997)
Protein Sci.
6,
2663-2666[Abstract]
-
Andersen, A. S.,
Kjeldsen, T.,
Wiberg, F. C.,
Christensen, P. M.,
Rasmussen, J. S.,
Norris, K.,
Møller, K. B.,
and Møller, N. P. H.
(1990)
Biochemistry
29,
7363-7366[CrossRef][Medline]
[Order article via Infotrieve]
-
Andersen, A. S.,
Kjeldsen, T.,
Wiberg, F. C.,
Vissing, H.,
Schäffer, L.,
Rasmussen, J. S.,
De Meyts, P.,
and Møller, N. P. H.
(1992)
J. Biol. Chem.
267,
13681-13686[Abstract/Free Full Text]
-
Williams, P. F.,
Mynarcik, D. C.,
Yu, G. Q.,
and Whittaker, J.
(1995)
J. Biol. Chem.
270,
3012-3016[Abstract/Free Full Text]
-
Wedekind, F.,
Baer-Pontzen, K.,
Bala-Mohan, S.,
Choli, D.,
Zahn, H.,
and Brandenburg, D.
(1989)
Biol. Chem. Hoppe-Seyler
370,
251-258[Medline]
[Order article via Infotrieve]
-
Yip, C. C.,
Hsu, H.,
Patel, R. G.,
Hawley, D. M.,
Maddux, B. A.,
and Goldfine, I. D.
(1988)
Biochem. Biophys. Res. Commun.
157,
321-329[CrossRef][Medline]
[Order article via Infotrieve]
-
Waugh, S. M.,
Dibella, E. E.,
and Pilch, P. F.
(1989)
Biochemistry
28,
3448-3455[CrossRef][Medline]
[Order article via Infotrieve]
-
Fabry, M.,
Schaefer, E.,
Ellis, L.,
Kojro, E.,
Fahrenholz, F.,
and Brandenburg, D.
(1995)
J. Biol. Chem.
267,
8950-8956[Abstract/Free Full Text]
-
Kurose, T.,
Pashmforoush, M.,
Yoshimasa, Y.,
Carroll, R.,
Schwartz, G. P.,
Burke, G. T.,
Katsoyannis, P. G.,
and Steiner, D. F.
(1994)
J. Biol. Chem.
269,
29190-29197[Abstract/Free Full Text]
-
Mynarcik, D. C.,
Yu, G. Q.,
and Whittaker, J.
(1996)
J. Biol. Chem.
271,
2439-2442[Abstract/Free Full Text]
-
Schaefer, E. M.,
Siddle, K.,
and Ellis, L.
(1990)
J. Biol. Chem.
265,
13248-13253[Abstract/Free Full Text]
-
Kadowaki, H.,
Kadowaki, T.,
Cama, A.,
Marcus-Samuels, B.,
Rovira, A.,
Bevins, C. L.,
and Taylor, S. I.
(1990)
J. Biol. Chem.
265,
21285-21296[Abstract/Free Full Text]
-
Sung, C. K.,
Wong, K. Y.,
Yip, C. C.,
Hawley, D. M.,
and Goldfine, I. D.
(1994)
Mol. Endocrinol.
8,
315-324[Abstract]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Bass, J.,
Kurose, T.,
Pashmforoush, M.,
and Steiner, D. F.
(1996)
J. Biol. Chem.
271,
19367-19375[Abstract/Free Full Text]
-
Kjeldsen, T.,
Andersen, A. S.,
Wiberg, F. C.,
Rasmussen, J. S.,
Schäffer, L.,
Balschmidt, P.,
Møller, K. B.,
and Møller, N. P. H.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4404-4408[Abstract/Free Full Text]
-
Kristensen, C.,
Kjeldsen, T.,
Wiberg, F. C.,
Schäffer, L.,
Hach, M.,
Havelund, S.,
Bass, J.,
Steiner, D. F.,
and Andersen, A. S.
(1997)
J. Biol. Chem.
272,
12978-12983[Abstract/Free Full Text]
-
Waugh, S. M.,
and Pilch, P. F.
(1989)
Biochemistry
28,
2722-2727[CrossRef][Medline]
[Order article via Infotrieve]
-
Markussen, J.,
Halstrøm, J.,
Wiberg, F. C.,
and Schäffer, L.
(1991)
J. Biol. Chem.
266,
18814-18818[Abstract/Free Full Text]
-
Yamaguchi, Y.,
Flier, J. S.,
Benecke, H.,
Ransil, B. J.,
and Moller, D. E.
(1993)
Endocrinology
132,
1132-1138[Abstract]
-
Pashmforoush, M.,
Yoshimasa, Y.,
and Steiner, D. F.
(1994)
J. Biol. Chem.
269,
32639-32648[Abstract/Free Full Text]
-
De Meyts, P.
(1994)
Diabetologia
37,
S135-S148
-
Schäffer, L.
(1994)
Eur. J. Biochem.
221,
1127-1132[Medline]
[Order article via Infotrieve]
-
Xu, Q. Y.,
Paxton, R. J.,
and Fujita-Yamaguchi, Y.
(1990)
J. Biol. Chem.
265,
18673-18681[Abstract/Free Full Text]
-
Deleted in proof
-
Zhang, B.,
and Roth, R. A.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
9858-9862[Abstract/Free Full Text]
-
Fuh, G.,
Mulkerrin, M. G.,
Bass, S.,
McMarland, N.,
Brochier, M.,
Bourell, J. H.,
Light, D.,
and Wells, J. A.
(1990)
J. Biol. Chem.
265,
3111-3115[Abstract/Free Full Text]
-
De Vos, A. M.,
Ultsch, M.,
and Kossiakoff, A. A.
(1992)
Science
255,
306-312[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea |