![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 29, 18019-18022, July 17, 1998
From the Cardeza Foundation for Hematologic Research, Department of
Medicine, Jefferson Medical College of Thomas Jefferson University,
Philadelphia, Pennsylvania 19107-5099
The hypoxia-inducible factor 1 complex (HIF-1) is
involved in the transcriptional activation of several genes, like
erythropoietin and vascular endothelial growth factor, that are
responsive to the lack of oxygen. The HIF-1 complex is composed of two
b-HLH proteins: HIF-1 The adaptive responses to hypoxia features the activation of
genes, like erythropoietin
(Epo),1 vascular endothelial
growth factor, endothelin, glucose transporters, and glycolytic
enzymes, that are specifically stimulated by the lack of oxygen (1, 2).
These genes share a common mechanism for oxygen sensing and
transcriptional activation. The key step in gene activation by hypoxia
is the formation of the HIF-1 (hypoxia-inducible factor-1) protein
complex in the corresponding hypoxia-responsive enhancer sequences
(HIF-1 sites) (3, 4). The HIF-1 complex is a heterodimeric complex of
two helix-loop-helix PAS proteins (5); HIF-1 Cell Lines and Culture Conditions--
Hep 3B and B-1 cells were
grown in nucleoside-free Luciferase Assay--
Luciferase expression was assayed using a
commercially available kit (Luciferase Assay System, Promega, Madison,
WI). Briefly, cells were washed three times with cold
phosphate-buffered saline prior to lysis with a 1 × concentration
of the supplied lysis buffer. Samples were collected, and 5-µl
aliquots were assayed using the luciferase assay reagent in a TD 20/20
luminometer (Promega). The results are expressed as relative light
units per µg of total protein. Protein concentrations were measured
by the method of Bradford using a Bio-Rad kit (Bio-Rad, Hercules, CA),
with bovine serum albumin (Sigma) as the standard.
Expression Vectors and Protein Production--
All the HIF-1
expression plasmids were generated using the glutathione
S-transferase fusion system (pGEX-4T-1 expression vector) from Amersham Pharmacia Biotech. The HIF-1 Quantitation of Complexed Iron--
Iron content was determined
initially by the colorimetric method of Fish (12) with ferrous
ethylenediammonium sulfate as the standard. About 500 µg of protein
was subjected to acid-permanganate (Sigma) treatment at 60 °C for
2 h to facilitate iron release. Subsequently a solution containing
Ferrozine (disodium
3-(2-pyridyl-5,6-bis(4-phenylsulfonate)-1,2,4-triazine, Sigma),
neocuproine (2,9-dimethyl-1,10-bathophenanthroline, Sigma), ascorbic
acid and buffered by ammonium acetate was added to detect the presence
of iron by a magenta color formation. Iron was quantitated spectrophotometrically at 562 nm. The presence of complexed iron was
further determined independently by atomic absorption spectrometry performed at Galbraith Laboratories Inc. (Knoxville, TN), using a
graphite microfurnace assay (Perkin-Elmer model 4110 ZL AA spectrometer (13). Proteins were measured by the Bradford method (Bio-Rad kit) and
independently by a micro-Kjeldahl method (14) at the Galbraith
Laboratories Inc.
Effect of Heme Synthesis Inhibitors on Hypoxia Response--
The
effect of the heme synthesis inhibitor 4,6-dioxoheptanoic acid (DHA)
(15) on the hypoxia, cobalt, and desferrioxamine responses was studied
in B-1 cells. These cells were derived from Hep 3B cells by stable
transfection with a luciferase reporter under the control of a minimal
Epo promoter and the hypoxia-responsive enhancer. As described
previously (6), B-1 cells respond to hypoxia, cobalt chloride, and iron
chelators, in a time- and concentration-dependent way, by
increasing luciferase expression. B-1 cells were incubated with 2 mM AHA for various periods, from 6 to 48 h, and then
exposed to hypoxia, cobalt chloride, or Dfx, for another 8 h. The
results are expressed as the ratios between DHA-treated and untreated cells with or without stimulation. As shown in Fig.
1, although DHA was mildly inhibitory to
control cells, it had no significant effect on the stimulation of
luciferase expression by any of the three agents. That DHA was indeed
inhibitory to heme synthesis was confirmed by measuring
59Fe incorporation into heme, which showed 90-95%
inhibition.
COMMUNICATION
Hypoxia-inducible Factor 1
(HIF-1
) Is a Non-heme
Iron Protein
IMPLICATIONS FOR OXYGEN SENSING*
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, that is constitutively expressed, and
HIF-1
, that is present only in hypoxic cells. The HIF-1
subunit
is continuously synthesized and degraded by the ubiquitin-proteasome
under oxic conditions. Hypoxia, transition metals, iron
chelators, and several antioxidants stabilize the HIF-1
protein,
allowing the formation of the transcriptionally active HIF-1 complex.
The mechanisms of oxygen sensing and the pathways leading to HIF-1
stabilization are unclear. Because the involvement of a heme protein
oxygen sensor has been postulated, we tested the heme sensor hypothesis by using a luciferase-expressing cell line (B-1), that is highly responsive to hypoxia. Exposure of B-1 cells to carbon monoxide and
heme synthesis inhibitors failed to show any effect on the hypoxia
responsiveness of these cells, suggesting that heme proteins are not
involved in hypoxia sensing. Measurement of iron in recombinantly expressed HIF-1
protein revealed that this protein binds iron in vivo. Iron binding was localized to a 129-amino acid
peptide between sequences 529 and 658 of the HIF-1
protein. Although the exact structure of the iron center has not been yet defined, a 2:1
metal/protein molar ratio suggests a di-iron center, probably similar
to the one found in hemerythrin. This finding is compatible with a
model where redox reaction may occur directly in the iron center of the HIF-1
subunit, affecting its survival in
oxic conditions.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
or ARNT (aryl
hydrocarbon nuclear receptor translocator), that is constitutively
expressed, and HIF-1
, that is rapidly degraded under normoxic
conditions by the ubiquitin-proteasome system (6). Hypoxia induces the
stabilization of the HIF-1
subunit, thus allowing the formation of
the transcriptionally active complex. Stabilization of HIF-1
is also
induced by transition metals such as cobalt, nickel, and manganese, by
iron chelators and by antioxidants such as the thiol reducing agent
N-(2-mercaptopropionyl)glycine and the oxygen radical
scavenger 2-acetamidoacrylic acid (ADA-1) (6). The mechanisms by which
cells sense oxygen tension and regulate the survival of the HIF-1
protein are currently unknown. Early work by Goldberg et al.
(7) hypothesized the involvement of a heme protein as an oxygen sensor
for hypoxic gene activation. Their model was based on the finding that
carbon monoxide (CO), heme synthesis inhibitors, and iron chelators
inhibited the response to hypoxia. They suggested that transition
metals would substitute for iron in the heme porphyrin ring, and
because they have low affinity for oxygen, they would lock the sensor
in the deoxy conformation. To date, however, no such molecule has been
identified in mammalian cells. Furthermore, desferrioxamine (iron
chelator), rather than being an inhibitor, was later found to be a
potent stimulator of HIF-1 activation. Similarly, the inhibitory effect
of heme synthesis inhibitors and CO has not been found in all cells.
Alternative models for oxygen sensing involving redox
reactions have been proposed (8). These models are based on the
observation that addition of H2O2 blocks HIF-1
complex formation and from the recent finding that some antioxidants
can stimulate HIF-1 in normoxic conditions (6, 9, 10). In this paper we
report that CO and heme synthesis inhibitors have little effect on the
hypoxia response on cells expressing a reporter gene under the control of the hypoxia-responsive enhancer. Furthermore, we report the finding
that HIF-1
is itself a non-heme iron-binding protein and propose
that oxygen sensing occurs by direct interaction of O2 with
this iron center.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
minimal essential medium (Life
Technologies, Inc.) supplemented with 10% heat-inactivated fetal calf
serum (HyClone, Logan, VT), 2.5 mg/ml fungizone (Life Technologies,
Inc.), 100 units/ml penicillin (Life Technologies, Inc.), 100 µg/ml
streptomycin (Life Technologies, Inc.). Cell lines were maintained in a
well humidified incubator at 37 °C in 5% CO2, 95% air.
For hypoxic stimulation, the culture plates were incubated in a modular
incubator chamber (Billups-Rothenburg, Del Mar, CA) and flushed with a
gas mixture containing 1% O2, 5% CO2, and
nitrogen balanced. For CO treatment, the cells were flushed with a gas
mixture containing either 20% (normoxia) or 1% (hypoxia)
O2, 6% CO, 5% CO2 and balanced with
N2. Cells were stimulated with cobalt chloride or
desferrioxamine (Dfx) (Sigma) at a final concentration of 100 or 130 µM, respectively. The B-1 cells are a Hep 3B derived cell
line that was stably transfected with an expression vector containing a
luciferase cDNA under the control of a minimal Epo promoter
(330-base pair SfaNI-XbaIII fragment) and the
hypoxia-responsive enhancer from the human Epo gene (150-base pair
ApaI-Pst fragment). The response of this cell line to
hypoxia, cobalt, desferrioxamine, and antioxidants has been reported
(6). Inhibition of heme synthesis was studied by incubating B-1 cells
with 2 mM 4,6-dioxoheptanoic acid (DHA, Sigma) for 8-32 h
before exposure to 8 h of hypoxia. Inhibition of heme synthesis
was evaluated by measurements of 59Fe incorporation into
heme as described by Beru et al. (11).
inserts were generated using polymerase chain reactions (PCR) and a human HIF-1
cDNA as
template. The following PCR primers were synthesized at the Jefferson
Nucleic Acid Facility: 529GGATCCGAATTCAAGTTG,
589GTCGACTCGAGTCATCAGCTTGCGGA,
658CTCGAGTCGACTTATGGTGATGATGT, and
826GTCGACGGATCCGTTAACTTGATC. PCR reactions were
carried out in a Perkin-Elmer (DNA-thermal cycler 2.1) PCR machine for
30 cycles. The reaction products were digested with EcoRI
and SalI and ligated, in frame, downstream of the 26-kDa GST
protein cDNA, into EcoRI-SalI-digested pGEX-4T-1 vector. All the expression vectors were verified by DNA
sequencing. The GST-B-filamin control plasmid was a gift of Dr. Toshiro
Takafuta (Cardeza Foundation). Plasmids were utilized to transform
Escherichia coli host strains (BL21) using standard procedures. Fusion proteins were generated by treating mid log phase
cultures with 1 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) to induce fusion
protein expression. Cells were harvested by centrifugation and
subsequently lysed by sonication. Solubilized extracts were applied to
glutathione-Sepharose beads (Amersham Pharmacia Biotech) for 2 h,
and the beads were subsequently washed four times with phosphate-buffered saline. Aliquots of beads were electrophoresed on
SDS-polyacrylamide gels to verify protein production and recovery (Fig.
3). For studies using transition metals, either CoCl2,
NiCl2, or MnCl2 were added to the cultures at a
final concentration of 500 µM 1 h prior to IPTG
induction.
![]()
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (34K):
[in a new window]
Fig. 1.
Effect of heme synthesis inhibitors on the
luciferase response of B-1 cells. Cells were preincubated for 8, 24, or 32 h with 2 mM DHA (dioxoheptanoic acid) and
then exposed to hypoxia (Hx), cobalt (Co), or
desferrioxamine (Dfx) for another 8 h. Bars
represent mean ± S.D. of three independent experiments. Results
are expressed as ratios of luciferase response between DHA-treated over
untreated cells.
Effect of CO on Luciferase Expression by B-1 Cells-- The effect of CO was studied in B-1 cells exposed to normoxia, hypoxia, cobalt chloride, and Dfx in the presence of 6% CO. As shown in Fig. 2, although exposure to 6% CO was mildly inhibitory, this inhibition was the same for all experimental groups, suggesting a nonspecific effect. Similar results were observed when 10% CO was utilized (not shown).
|
HIF-1
as an Iron-binding Protein--
The above results
indicated that the oxygen sensor is unlikely a heme-containing protein.
An alternative possibility to explain the stimulatory effect of iron
chelators and antioxidants on HIF-1
stability would be the presence
of a non-heme iron center in the HIF-1
protein itself. To evaluate
the presence of iron in HIF-1
we expressed the protein as a GST
fusion protein. HIF-1
cDNAs corresponding to amino acid
sequences 529-826, 529-658, and 529-589 were cloned, in frame,
downstream of the 26-kDa GST domain of Schistosoma japonicum
in the pGEX expression vector. The recombinant proteins were expressed
in E. coli and purified by GST affinity chromatography using
glutathione-Sepharose beads followed by glutathione elution. Iron was
measured by utilizing the acid-permanganate Ferrozine method. Iron was
released from the protein by treatment with an acid/permanganate
mixture and the iron chelated by Ferrozine, which forms a
water-soluble, highly stable, colored ferrous complex. This method
provides reproducible sensitivity down to about 0.1-0.2 µg of iron.
For a hypothetical iron-containing protein that binds 1 iron per
Mr 50,000, 100 µg of protein would provide
sufficient material for precise determinations. Interestingly, initial
studies using proteins purified by glutathione elution failed to show the presence of iron in any of the peptide fragments. However, subsequent experiments utilizing uneluted proteins (still attached to
the Sepharose beads) showed distinctively the presence of iron in
fragments 529-829 and 529-658. Control glutathione-Sepharose beads,
the 27-kDa GST-peptide, and a 99-kDa GST-B-filamin fusion protein,
expressed in identical conditions as the HIF-1
peptides, showed
almost complete absence of iron, as shown in Table
I. The presence of iron in the HIF-1
fragments was confirmed by graphite furnace atomic absorption
spectroscopy, as measured by an independent laboratory (Galbraith
Laboratories Inc.). No heme was detected in the recombinant proteins
(Drabkin's reagent, Fisher) Protein was measured by the Bradford
method and by a micro-Kjeldahl nitrogen assay at Galbraith Laboratories
Inc. The iron/protein molar ratio appears to be between 1:1 to 2:1.
These estimates are based on six independent protein preparations.
|
Effect of Transition Metals and Iron Chelators on the Iron Content
of HIF-1
Fragments--
To evaluate the effect of transition metals
and iron chelators on the iron content of the peptide fragments,
E. coli cells expressing the 529-658 fragment were
incubated with Dfx (100 µM) and the transition metals
cobalt, manganese, nickel (500 µM) 30 min before
induction with IPTG. The recombinant peptides were purified by
glutathione-Sepharose and the iron content analyzed by atomic
absorption spectroscopy. As shown in Fig.
3, Dfx and manganese did not
significantly affect protein expression. However, the iron content in
those samples was significantly reduced, as shown in Table I.
Furthermore, there was an increase manganese content in the
manganese-treated samples, suggesting a replacement of iron by
manganese. No effect on iron content was observed in the samples
treated with cobalt or nickel.
|
Removal of Iron by Chelating Agents in Vitro--
To determine the
oxidation state of the iron in HIF-1
and the ability of chelators to
interact with it, we incubated the recombinant 529-568 fragment with
the Fe2+ chelator 1,10-bathophenanthroline or the
Fe3+ chelators desferrioxamine and tiron. Both
Fe3+ chelators completely removed the iron from the
peptide, whereas the Fe2+ chelator had little effect. The
finding that chelators remove iron from the proteins explains the
absence of detectable iron in the glutathione-treated peptides, because
glutathione is a potent iron chelator (29).
| |
DISCUSSION |
|---|
|
|
|---|
The hypoxic activation of several genes is mediated by the
hypoxia-responsive enhancer, first described in the 3' end of the Epo
gene (16-18). A hypoxia-inducible protein complex, termed HIF-1, binds
to the enhancer and stimulates transcription. Of the two proteins that
form the complex, HIF-1
(ARNT) is constitutively expressed, whereas
HIF-1
is only present in hypoxic cells (5). Recent evidence has
shown that HIF-1
protein is continually synthesized, but rapidly
degraded in normoxia. Normoxic degradation of HIF-1
appears to be
mediated by the ubiquitin-proteasome system by still yet undetermined
signals (6). Similarly to hypoxia, HIF-1
degradation is inhibited by
iron chelators, transition metals such as cobalt, nickel, and manganese
and several antioxidants. Based on the findings that Epo gene
expression by hypoxia could be inhibited by CO and heme synthesis
inhibitors, Goldberg et al. (7) postulated the presence of a
rapidly turning over heme protein as an oxygen sensor. In their model,
transition metals would be incorporated into the heme molecule, and
because they bind oxygen with low affinity, they would lock the sensor
in the deoxy conformation. So far, however, there has been no
identification of such sensor, and furthermore, there are several
experimental observations that cannot be accounted by the heme sensor
model (reviewed in Ref. 19). Our failure to show any effect of heme synthesis inhibitors or CO in the response to hypoxia, using the sensitive and specific response of B-1 cells, is very suggestive that
heme proteins are not involved in oxygen sensing. These results are in
line with similar findings reported by Eckardt et al. (20) in freshly isolated hepatocytes and by a recent report by Graven et al. (21) on the lack of effect of CO and AHA in the
response to hypoxia by pulmonary endothelial cells.
Molecular interactions of oxygen are essentially of two kinds;
reversible liganding, as in hemoglobin, and redox-based,
were oxygen acts as an electron acceptor. Oxygen-sensing mechanisms implying redox reactions have been already proposed (8).
Treatment of cells with H2O2 will inhibit the
activation of HIF-1 and the hypoxic expression of Epo and vascular
endothelial growth factor genes (9). Conversely, antioxidants such as
the thiol donor N-(2-mercaptopropionyl)glycine or oxygen
radical scavengers like ADA-1 or mannitol would induce HIF-1
and
gene expression in normoxic cells (6). Acker and Xue (8) proposed that
H2O2, generated by a NADPH oxidase in an
O2-dependent manner, may be the intermediate in
oxygen sensing. The mechanism by which H2O2
would affect HIF-1
survival is unclear. Although hydrogen peroxide
can react with Fe2+, by way of the Fenton reaction
generating hydroxyl radicals (OH·), these radicals are so
reactive that it is difficult to conceive their role as specific signal
transducers. Furthermore, studies using iodonium compounds, potent
inhibitors of NADPH oxidases (22), have failed to show a stimulatory
effect on HIF-1
expression (23).2 The finding that
HIF-1
is an iron-containing protein provides an alternative
mechanism for oxygen sensing; localized Fenton reactions could occur in
the core of the protein itself, leading to oxidative in situ
modification of critical amino acid residues or changing the
conformation of the protein, thus targeting it for proteasomal
degradation. In this model, iron chelators would act by either
decreasing the availability of a labile iron pool or by directly
removing iron from HIF-1
. Transition metals may compete for iron for
the metal binding site in the protein, as was shown for the case of
manganese in our bacterial studies, and antioxidants may inhibit the
localized redox reactions.
Although the exact sequences involved in the normoxic degradation of
HIF-1
have not been completely defined, early work by Jiang et
al. (24) indicated that the C-terminal end of HIF-1
contained
the putative degradation domain. Further work by Pugh et al.
(25) provided evidence suggesting that fragment amino acids 530-634
and within that fragment, amino acids 549-582, were involved in the
oxygen-regulated degradation of the protein. Our finding of an iron
binding site in fragment 529-658 provides a plausible mechanism for
this oxygen-regulated degradation. As mentioned, iron can react with
H2O2 to generate OH radicals. These highly
reactive molecules can react with certain amino acids in their vicinity
to produce oxidized adducts, which could then become the target for
ubiquitination. A rather similar situation has been found in the case
of IRP-2 (iron regulatory protein-2), where iron binding generates
carbonyls and induces the proteasomal degradation of the protein (26).
The sources of H2O2 remain unclear. Because mitochondria, one of the main sources of H2O2
in cells, appear not to be involved in oxygen sensing, one possible
source is cytoplasmic oxidase. Indeed, Acker and colleagues (10) have
postulated the involvement of a NADPH-linked oxidase, similar to the
one present in neutrophils, as a possible oxygen sensor. However,
inhibitors of NADPH-dependent oxidases do not activate
HIF-1, suggesting that they are not the sources of peroxides.
Alternatively, H2O2 could be produced in
situ by autoxidation of Fe2+ in the presence of
oxygen. This phenomenon has been described in the case of ferritin and
more recently by Biaglow and Kachur (27) in the reaction of molecular
oxygen with polyphosphate complexes of ferrous ions. The structure and
ligands of the iron pocket in HIF-1
are, to this time, undetermined.
Our initial data suggest 1-2 mol of iron/mol of protein. The iron
center seems very labile, because iron could be easily removed by
chelators, both in vitro and in vivo.
Furthermore, treatment with manganese markedly reduced iron
incorporation into the protein. Because there are no cysteine residues
in the 529-658 fragment, an iron-sulfur cluster is unlikely. A
possible structure may be a di-iron center, similar to the ones found
in the oxygen carrying protein hemerythrin and in the enzymes
diribonucleotide reductase and methane mono-oxygenase (28). These
proteins have the common property of binding oxygen, by way of
oxidizing the Fe2+ to Fe3+. Preliminary studies
using electron paramagnetic resonance spectroscopy (EPR) analysis at
low temperature (10 K), conducted in Dr. P. L. Dutton's
laboratory (University of Pennsylvania), showed no paramagnetic signal.
However, this is not unusual in di-iron centers, which usually have
both irons antiparamagnetically coupled (28). In summary, we provide
evidence that suggests that oxygen sensing is mediated by an iron
binding site(s) in the HIF-1
protein. The interaction of the iron
center, either with H2O2 or directly with
oxygen, may provide a signal for the ubiquitin-proteasomal degradation
of the protein, thus controlling the transcriptional activation of
hypoxia-responsive genes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. P. L. Dutton and his laboratory personnel for the EPR analysis. We appreciate the assistance of D. Likens in the artwork and R. Silvano in the typing of this manuscript
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grant DK-34642 and Juvenile Diabetes Foundation Grant 195009.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Cardeza Foundation for
Hematologic Research, 1015 Walnut St., Philadelphia, PA 19107-5099. Tel.: 215-955-7775; Fax: 215-923-3836; E-mail: carol{at}jeflin.tju.edu.
1
The abbreviations used are: Epo, erythropoietin;
HIF-1, hypoxia-inducible factor 1 complex; ARNT, aryl hydrocarbon
nuclear receptor translocator; Dfx, desferrioxamine; PCR, polymerase
chain reaction; GST, glutathione S-transferase; DHA,
dioxoheptanoic acid; IPTG,
isopropyl-
-D-thiogalactopyranoside.
2 V. Srinivas, X. Zhu, S. Salceda, R. Nakamura, and J. Caro, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Albini, D. M. Noonan, and N. Ferrari Molecular Pathways for Cancer Angioprevention Clin. Cancer Res., August 1, 2007; 13(15): 4320 - 4325. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Brune and J. Zhou Nitric oxide and superoxide: Interference with hypoxic signaling Cardiovasc Res, July 15, 2007; 75(2): 275 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hoeben, B. Landuyt, M. S. Highley, H. Wildiers, A. T. Van Oosterom, and E. A. De Bruijn Vascular Endothelial Growth Factor and Angiogenesis Pharmacol. Rev., December 1, 2004; 56(4): 549 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tezel and M. B. Wax Hypoxia-Inducible Factor 1{alpha} in the Glaucomatous Retina and Optic Nerve Head Arch Ophthalmol, September 1, 2004; 122(9): 1348 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Powis and L. Kirkpatrick Hypoxia inducible factor-1{alpha} as a cancer drug target Mol. Cancer Ther., May 1, 2004; 3(5): 647 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Chandel and P. T. Schumacker Cellular oxygen sensing by mitochondria: old questions, new insight J Appl Physiol, May 1, 2000; 88(5): 1880 - 1889. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Halterman, C. C. Miller, and H. J. Federoff Hypoxia-Inducible Factor-1alpha Mediates Hypoxia-Induced Delayed Neuronal Death That Involves p53 J. Neurosci., August 15, 1999; 19(16): 6818 - 6824. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Taylor and I. B. Zhulin PAS Domains: Internal Sensors of Oxygen, Redox Potential, and Light Microbiol. Mol. Biol. Rev., June 1, 1999; 63(2): 479 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Huang, W. G. Willmore, J. Gu, M. A. Goldberg, and H. F. Bunn Inhibition of Hypoxia-inducible Factor 1 Activation by Carbon Monoxide and Nitric Oxide. IMPLICATIONS FOR OXYGEN SENSING AND SIGNALING J. Biol. Chem., March 26, 1999; 274(13): 9038 - 9044. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Neumcke, B. Schneider, J. Fandrey, and H. Pagel Effects of Pro- and Antioxidative Compounds on Renal Production of Erythropoietin Endocrinology, February 1, 1999; 140(2): 641 - 645. [Abstract] [Full Text] |
||||
![]() |
V. Srinivas, I. Leshchinsky, N. Sang, M. P. King, A. Minchenko, and J. Caro Oxygen Sensing and HIF-1 Activation Does Not Require an Active Mitochondrial Respiratory Chain Electron-transfer Pathway J. Biol. Chem., June 15, 2001; 276(25): 21995 - 21998. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |