![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 29, 18547-18555, July 17, 1998
From the Four nonmuscle tropomyosin isoforms have been
reported to be produced from the rat Tm5 gene by
alternative splicing (Beisel, K. W., and Kennedy, J. E. (1994) Gene (Amst.) 145, 251-256). In order to
detect additional isoforms that might be expressed from that gene, we
used reverse transcriptase-polymerase chain reaction assays and
evaluated the presence of all product combinations of two alternative
internal exons (6a and 6b) and four carboxyl-terminal exons (9a, 9b,
9c, and 9d) in developing and adult rat brain. We identified five
different combinations for exon 9 (9a + 9b, 9a + 9c, 9a + 9d, 9c, and
9d), and the exon combinations 9a + 9c and 9a + 9d were previously
unreported. Each of these combinations existed with both exon 6a and
exon 6b. Thus, the rat brain generates at least 10 different isoforms
from the Tm5 gene. Northern blot hybridization with
alternative exon-specific probes revealed that these isoforms were also
expressed in a number of different adult rat tissues, although some
exons are preferentially expressed in particular tissues. Studies of
regulation of the 10 different Tm5 isoform mRNAs during
rat brain development indicated that no two isoforms are coordinately
accumulated. Furthermore, there is a developmental switch in the use of
exon 6a to exon 6b from embryonic to adult isoforms. TM5 protein
isoforms show a differential localization in the adult cerebellum.
Tropomyosins are rod-like proteins that are associated with actin
filament in muscle and nonmuscle cells. Multiple isoforms of
tropomyosins exist in both muscle and nonmuscle cells (1). In muscle
cells, tropomyosins play a pivotal role in regulating the interaction
between the actin and myosin filaments. The role of tropomyosins in
nonmuscle cells is beginning to be more defined. They are thought to
differentially affect the stability of actin filaments (2) and have
been shown to be implicated in various cellular functions including the
regulation of cell transformation (3-5), cytokinesis (6), motility
(7, 8), and morphogenesis (9-13).
Alternative splicing accounts for the majority of tropomyosin isoform
diversity. In mammals, four tropomyosin genes have been identified,
In the case of the rat Tm5 gene, one muscle isoform and four
nonmuscle isoforms have been reported to date. The muscle product of
this gene is known as In order to detect additional isoforms that might be expressed from the
Tm5 gene, we used systematic
RT-PCR1 assays to evaluate
the presence of all product combinations of two alternative internal
exons (6a and 6b) and four carboxyl-terminal exons (9a, 9b, 9c, and 9d)
of the Tm5 gene in the developing and adult rat brain. We
have identified novel splice combinations, and at least 10 nonmuscle
isoforms are produced from that gene in the rat brain. These isoforms
are independently regulated during rat brain development. Furthermore,
a switch occurs in the use of exon 6a to exon 6b from embryonic to the
adult isoforms. In the case of two isoforms, Tm5 NM1 and
NM2, isoform switching coincides with a shift in sorting to different
neuronal compartments.
Tissue Sampling and RNA Isolation
Embryonic and adult rat tissues were collected from
Sprague-Dawley rats, immediately frozen in liquid nitrogen, and stored at Tm5 Probes
Southern Blot Probes
Two oligonucleotide probes were synthesized from the rat
Tm5 cDNA sequence (published in Ref. 23) as follows: the
H92 probe (position 552-680), specific for exons 7 and 8 (a.a.
179-221 from nonmuscle Tm5), and the H169 probe (position
683-761), specific for exon 9a (a.a. 222-248 from nonmuscle
Tm5). 100 ng of oligonucleotides were 3'-end-labeled using a
Gigaprime labeling kit (Bresatec, Australia) by incubation with 50 µCi of [ Northern Blot Probes
Exons 7 + 8--
A human Tm5 cDNA probe,
pHM 9d 3'-UTR--
A 1,500-bp probe corresponding to the entire 9d
3'-UTR, pMMTm5-3'UT, and generated from a mouse Tm5
nonmuscle cDNA by PCR amplification has been characterized
previously (28). Two other probes, 3'UT244, corresponding to the 5' end
of the 9d 3'-UTR (bp 760 to 1190), and 3'UT110, corresponding to the
central region of the 9d 3'-UTR (bp 1200 to 1800), were generated by
PCR amplification using the following pairs of primers: 5'
GAGATGTAGACCTTCCCCATC 3'/5' GTATCCATTAGGCTAAGATGTGC 3' and 5'
ATGGAGGAGAAACACAGGAATG 3'/5' GAAGATTTCGCCAGCACTGAC 3'. Amplification
was carried out using rat fibroblast cDNA.
9c 3'-UTR--
Two oligonucleotide probes, H135 (position
774-909) and H136 (position 910-1056) corresponding to the entire 9c
3'-UTR, were synthesized from the rat Tm5 cDNA sequence
and used simultaneously for hybridization.
Exon 9a--
To obtain a probe that could recognize specifically
exon 9a, the human Tm5 cDNA previously described (25),
pHM Exon 6a and Exon 6b--
Oligonucleotide probes specific for
exon 6a (H182) and exon 6b (H184) were synthesized from the rat
Tm5 cDNA sequence (23). These probes are identical in
sequence to the four last a.a. encoded by exon 5 (a.a 149-152) plus
the entire exon 6a or exon 6b (a.a 153-178) plus the four first a.a.
encoded by exon 7 (a.a. 179-182) from nonmuscle Tm5 or the
corresponding a.a 185-218 from Tm5.
RT-PCR, Southern Blot, and Sequence Analysis of RT-PCR
Products
Rat Tm5-specific oligonucleotides were chosen from
the rat Tm5 cDNA (23) as follows: exon 1b,
GCAAGATCCAGGTTCTGCAG (position 53-72); exon 6a, CGTTGCCGAGAGATGGATGAG
(position 475-495); exon 6b, GTGTTCTGAGCTGGAGGAGG (position 477-496);
exon 9b, CAGAGCAGAAACGGTGTCAG (position 767-786); exon 9c,
CTTGCTTAGGGCGAACAGTGAC (position 840-861); and exon 9d,
GCCCTCAGTTTCAAGGCCAGC (position 843-863). First strand cDNA was
synthesized from 1 µg of total RNA in a final volume of 50 µl
containing 20 units of RNase H reverse transcriptase (Superscript II,
Life Technologies, Inc.), 750 ng of random hexamers (Promega), 0.4 mM each dNTPs, 5 units of RNasin, and 100 mM
dithiothreitol. Reaction was performed for 75 min at 37 °C. PCR
reactions were then conducted for 35 cycles in a total volume of 20 µl using 6-µl aliquots of a 5-fold dilution of the RT reaction and
Tm5-specific primers, 80 ng each, in the presence of 1 unit
of Taq polymerase (Boehringer Mannheim), and 0.2 mM each dNTPs. RT-PCR products were resolved in agarose
gels and visualized by staining with ethidium bromide. For Southern
blot analysis, RT-PCR products were transferred onto Hybond
N+ nylon membranes (Amersham Pharmacia Biotech) according
to Ref. 29. Oligonucleotide probes specific for rat Tm5
exons 7 and 8 (H92) or exon 9a (H169) were labeled using specific 3'
antisense primers and hybridized to DNA blots at 106 cpm/ml
in a solution of 4× SSC, 5× Denhardt's solution, 50 mM NaH2PO4 (pH 7.0), and 10% dextran sulfate at
60 °C for 16 h. The blots were then washed once with 1× SSC,
0.1% SDS at 60 °C for 30 min and twice with 0.5× SSC, 0.1% SDS at
60 °C for 30 min each. Filters were exposed to Kodak Biomax film for
a few hours. For sequencing, amplified Tm5 cDNA
fragments were excised from agarose gel, isolated by glass-wool
extraction, and purified by ethanol precipitation. DNA sequence was
determined with a DNA sequencer (373A Applied Biosystems) using dye
fluorescent labels. Sequence data were determined in the sense and
antisense orientations.
Antibodies and Immunohistochemistry
The CG3 antibody is a monoclonal antibody whose epitope has been
mapped to a.a. 29-44 encoded by exon 1b of the Tm5 gene
(30) and has been kindly provided by Jim J.-C. Lin. The WS 5/9d
polyclonal antibody was directed against a peptide DKLKCT corresponding
to a.a. 222-227 of exon 9d and raised in rabbit, as described
previously (12). The peptide ESLYRQLERNSLLSNELKLTL corresponding to
a.a. 222-241 of exon 9c was used to generate rabbit antiserum and
referred to as WD 5/9c. The secondary antibodies used were goat
anti-mouse and anti-rabbit IgG-alkaline phosphatase conjugated (Jackson
ImmunoResearch). Adult rat cerebellum was fixed and prepared for
sectioning as described previously (11, 12). Primary antibodies were
used at a dilution of 1:100. Secondary antibodies were used at
1:250.
Northern Blot Analysis
Samples of total RNA were electrophoresed on 1% agarose gels
containing 6% formaldehyde and blotted to Hybond N nylon membranes (Amersham Pharmacia Biotech) as described (29). Probes were labeled
using random or specific 3' antisense primers and hybridized to RNA
blots under identical conditions as for Southern blots, but
hybridization and washes were conducted at 65 °C. For probes specific for exon 6a (H182), exon 6b (H184), and exon 9a
(pHM Splicing Patterns of Tm5 mRNA--
To evaluate the extent of
Tm5 isoform diversity, total RNA was isolated from
developing and adult rat brain and analyzed by RT-PCR. Specific
oligonucleotide primers were used to amplify the products resulting
from each possible splicing combination occurring between the two
internal exons 6 (6a and 6b) and the four carboxyl-terminal exons 9 (9a, 9b, 9c, and 9d) (Fig. 1). The
specificity of the RT-PCR products was then confirmed by Southern blot
hybridization to an oligonucleotide probe identical to the region
coding for constitutive exons 7 and 8 (Fig. 1A). For both primer pairs 6a/9d (Fig. 1A, panel 1, upper) and 6b/9d (Fig.
1A, panel 1, lower), two bands were detected. The size of
the smaller (and major) band was consistent with the expected size of
PCR products containing, respectively, the exon combinations 6a + 9d,
and 6b + 9d, based on the published patterns of alternative splicing
for Tm5 NM1 and NM2 isoforms (23). For both primer pairs,
the two bands differed by 80 base pairs. This raised the possibility
that an additional exon may be included in the larger band. The
presence of exon 9a in the larger product was demonstrated by
hybridization to an oligonucleotide probe specific for this exon (Fig.
1B, panel 1). The exon combination 9a + 9d was a previously unreported splice event, and we found it existed with both exon 6a and
6b.
Splicing of Two Internal and Four Carboxyl-terminal Alternative
Exons in Nonmuscle Tropomyosin 5 Pre-mRNA Is Independently
Regulated during Development*
§,
,
§,
, and
§
**
Cell Biology Unit,
Department of Paediatrics and Child Health,
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-Tmf (14),
-Tm (15), Tm4
(16), and Tm5 (17). Except for the Tm4 gene, it
is now clear that the other three rat tropomyosin genes contain two
alternate promoters (exons 1a and 1b), two alternative internal exons
(6a and 6b), and four alternative COOH-terminal exons (9a, 9b, 9c, and
9d). Therefore, the tropomyosin genes can each theoretically generate mRNAs for at least 16 isoforms. However, only 20 isoforms have been
characterized from all four rat tropomyosin genes (14-24). This
suggests that some exon combinations either do not occur or are unique
to cell types that have not yet been studied.
-Tms since it is
preferentially expressed in slow-twitch skeletal muscle (25). The four
nonmuscle isoforms have been termed Tm5 NM1 to NM4 (23), but
Tm5 NM1 was previously referred as the fibroblastic TM30 nm
isoform (22) or Tm5 isoform (26). These four nonmuscle
isoforms have been identified in the rat cochlea and varied in their
usage of alternative exons 6a and 6b, 9a + 9b, 9d and 9c (Fig.
3).
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
70 °C. Frozen tissues were homogenized in phenol/guanidine isothiocyanate, and RNA was extracted as described (27).
-32P]dCTP and the large Klenow fragment of
Escherichia coli DNA polymerase at 37 °C for 15 min. 1 µg of antisense nucleotides specific to the 3'-end of each DNA probe
was used to prime the reactions.
Tms-SA, which is a gene-specific and well conserved
cross-species, has been characterized previously (25). This DNA
fragment encodes a.a. 213-284 plus 48 bp of the 3'-UTR from
Tm5, or the corresponding a.a. 177-248 from nonmuscle Tm5.
Tms-SA, was digested by SacI. This DNA
fragment encodes a.a. 259-284 plus 48 bp of the 3'-UTR from
Tm5 or the corresponding a.a. 223-248 from nonmuscle
Tm5.
Tms-Sac), hybridization was performed at
60 °C and washing at 55 °C. Filters were exposed for 24-48 h to
phosphor screens which were scanned by a Molecular Dynamics Laser
PhosphorImager (Molecular Dynamics). To correct for loading and
transfer errors, Northern blots were hybridized to an 18 S specific
ribosomal RNA oligonucleotide. mRNA levels were quantified using
the Molecular Dynamics Laser PhosphorImager.
![]()
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

View larger version (41K):
[in a new window]
Fig. 1.
RT-PCR scanning of Tm5 splice
variants. Total RNA samples prepared from 12.5, 14.5, and 16.5 embryonic days (ED 12.5 to 16.5) and adult rat
brain were analyzed by RT-PCR using Tm5-specific
oligonucleotide primers. The numbered panels match the primer pairs as
following: (panel 1), primer pairs 6a/9d, 6b/9d
(upper and lower panels, respectively);
(panel 2), primer pairs 6a/9c, 6b/9c, and (panel
3), primer pairs 6a/9b, 6b/9b. A, Southern blot
analysis for sequence encoding constitutive exons 7 and 8. Amplified
fragments were electrophoretically resolved in agarose gels,
transferred to nylon membranes, and hybridized with a
32P-labeled Tm5 exons 7 and 8 oligonucleotide
probe. As all amplified fragments contained exons 7 and 8, 6a-9d and 6b-9d shown in panel 1 symbolize, respectively, the 388-bp PCR product containing exons 6a + 7 + 8 + 9d and the 386-bp PCR product containing exons 6b + 7 + 8 + 9d;
the same symbols are used in panels 2 and 3.
B, Southern blot analysis for sequence encoding alternative
exon 9a. The PCR fragments shown in A and amplified using
primer pairs 6a/9d, 6b/9d (panel 1) and primer pairs 6a/9c,
6b/9c (panel 2) were electrophoretically resolved in
duplicate, transferred to nylon membranes, and hybridized with a
32P-labeled oligonucleotide probe specific for exon 9a. As
all amplified fragments were shown to contain exons 7 and 8, 6a-9a-9d and 6b-9a-9d shown in (panel
1) symbolize, respectively, the 469-bp PCR product containing
exons 6a + 7 + 8 + 9a + 9d and the 467-bp PCR product containing exons
6b + 7 + 8 + 9a + 9d; the same symbols are used in panel
2.
|
|
Tissue Specificity of Tm5 mRNA Splice Variants--
To
determine the pattern of expression of these variants in various adult
rat tissues, total RNA was isolated from adult rat soleus (slow
muscle), skeletal muscle from the leg (slow and fast muscle), testes,
kidney, liver, and brain. These samples were analyzed by Northern blot
hybridization using four Tm5 probes: a probe specific for
exons 7 and 8, full-length 9d 3'-UTR, full-length 9c 3'-UTR, and exon
9a (Fig. 4). Hybridization with the first probe, which is in a constitutive region, confirmed that the
muscle-specific 1.3-kb transcript,
-Tms, is highly
expressed in soleus and skeletal muscle and is the major isoform of the
Tm5 gene. This probe also detected a 2.5-kb transcript
expressed at very similar levels in both muscle and nonmuscle tissues
and a 1.0-kb mRNA in testes. Two minor mRNAs were also detected
in brain with sizes estimated at 2.9 and 1.5 kb. Hybridization with 9d
3'-UTR cDNA recognized the 2.5-kb mRNA whose pattern of
expression is characteristic of a nonmuscle tropomyosin, as expected
(28). According to our RT-PCR results, the 2.5-kb mRNA could
account for four isoforms, corresponding to NM1 (exon combination 6a + 9d), NM2 (6b + 9d), NM5 (6a + 9a + 9d), and NM6 (6b + 9a + 9d), which
were not independently resolved by this Northern blot analysis. The 9d
3'-UTR probe also detected the 1.0-kb mRNA in testes. In skeletal
muscle, two novel transcripts of approximately 1.0 and 1.7 kb were
detected. The 1.7-kb mRNA was not clearly detected in the soleus
muscle by the full-length 9d 3'-UTR probe which gave a strong 1.0-kb
signal. These transcripts will be explained below.
|
-Tms isoform is the major product expressing exon 9a.
Moreover, the 2.9-kb transcript detected in brain with the exon 7 and 8 probe did not show any positive hybridization to the known 3'-UTRs,
suggesting that the 2.9-kb mRNA must contain a novel exon 9 of the
Tm5 gene.
In addition to the nonmuscle 2.5-kb transcript, the full-length 9d
3'-UTR probe recognized the 1.0-kb mRNA in testes and two novel
transcripts of 1.7 and 1.0 kb in muscle. Two probes containing, respectively, the 5' end (position 760-1190) and the central region (position 1190-1800) of the 9d 3'-UTR were produced by PCR
amplification and hybridized to soleus, skeletal muscle, and testes
RNAs (Fig. 5). The 5' probe recognized
the testes-specific 1.0-kb mRNA, suggesting that this transcript
may derive from use of an alternative polyadenylation signal located in
the 5' end of the 9d 3'-UTR. A putative consensus site, ATTA, is
located in this region. The central region probe recognized the 1.7-kb
mRNA in soleus and skeletal muscle, whereas the full-length probe
yielded a strong 1.0-kb signal. These transcripts did not hybridize to
a 9d coding region probe either. We hypothesize that these two
transcripts may be generated through splicing of exon 8 to an
alternative splice acceptor site located in the 3' end of the 9d
3'-UTR.
|
Temporal Relationship between the Expression of Alternative Exons-- We have noted differences in the regulation of Tm5 variants during rat brain development with the RT-PCR assays (Fig. 1). We therefore chose to evaluate the temporal regulation of the mRNA splice variants and to compare expression of alternative exons. Total RNA isolated from developing to adult rat brain was size-fractionated and hybridized initially with the exons 7 + 8, 9d 3'-UTR, 9c 3'-UTR, and exon 9a probes (Fig. 6). Direct quantification of 32P on the hybridization membrane by PhosphorImager analysis indicated that mRNAs with the 9d 3'-UTR undergo a 5-fold decrease in accumulation from embryo to the adult. In contrast, the level of transcripts containing 9c 3'-UTR is constant. Hybridization with the exon 9a probe indicated that exon 9a is expressed in about equal amounts in all splicing combinations producing the 2.5-kb (9a + 9d), 1.5-kb (9a + 9c), and 1.3-kb (9a + 9b) mRNAs and that accumulation of transcripts containing exon 9a slightly increases from embryo to the adult. Thus, transcript accumulation of Tm5 mRNAs is subject to temporal regulation and is different with the use of each alternative carboxyl-terminal exon.
|
|
Tm5 Protein Isoforms Are Localized to Specific Structures within
the Adult Rat Cerebellum--
Antibodies that identify amino acids
encoded by specific exons were used to investigate whether protein
isoforms from the Tm5 gene were expressed in adult
cerebellum. This brain region was chosen because of its well studied
histology and clearly defined polarity orientation of its main neuronal
cell types. The CG3 monoclonal antibody recognizes the amino acids
encoded by exon 1b and therefore potentially identifies all the
nonmuscle isoforms derived from the gene. Fig.
8A shows that CG3 staining is
broadly distributed within the cerebellum. Most prominent staining is present in the Purkinje neuron cell bodies as well as the molecular layer which is densely packed with axons. Within the granule cell layer, staining is seen within the synaptic rich glomeruli but not in
the granule cells themselves. In contrast, WS5/9d a polyclonal serum
shows a very different expression pattern. This antiserum was raised
against a unique sequence within exon 9d and therefore potentially
identifies the isoforms NM1 and NM2, although in the adult brain NM2 is
primarily expressed (see Fig. 7A). This antiserum has been
previously well characterized (11, 12) and gave a localization pattern
that was a specific subset of the pattern seen with CG3. Only the
Purkinje cell soma and dendrites were identified by this antiserum
(Fig. 8C), which is the most prominent cell type identified
by CG3. Another antiserum, WD5/9c, was raised against exon 9c of the
Tm5 gene and therefore potentially identifies the isoforms
NM7 and NM4. In contrast to WS5/9d, the distribution of these isoforms
is broader and very similar to CG3 (Fig. 8B). In primary
cortical neuron/glial mixtures grown in culture this antibody was
neuron-specific2 as was exon
9c expression from the
-Tmf gene (12). In
summary, it appears that multiple protein isoforms from the Tm5 gene are expressed in the adult cerebellum. They are
associated with specific neuronal structures suggesting potentially
different functions of these isoforms in the maintenance of
morphology.
|
| |
DISCUSSION |
|---|
|
|
|---|
Our results indicate that Tm5 isoform diversity is much greater than previously thought and can be generated by alternative splicing of coding and noncoding regions. These results also raise the question of whether the other tropomyosin genes also have the capability to generate such a large number of isoforms.
We have identified novel exon combinations for alternative splicing of
terminal exon 9. The 9a + 9c mRNAs encode potential new variants
carrying six additional residues in their carboxyl-terminal part. In
contrast, the 9a + 9d mRNAs produce the same 9a-encoded COOH-terminal amino acid residue proteins as the 9a + 9b mRNAs, and
the differences between these variants lie in their 3'-UTR regions.
Regions of the 3'-UTRs have been conserved between mammals (26, 23),
indicating that these regions may be functionally important.
Alternative splicing occurring in the 9b 3'-UTR of the
-Tmf gene was previously reported (32). In this case, skeletal muscle and fibroblast produce
-Tmf
tropomyosin isoforms which are identical except for the last COOH amino
acid but are generated from two mRNAs differing by 48 bp in their
9b 3'-UTR sequence. Similarly, the skeletal muscle
-Tm
isoform can also be produced from an unusual mRNA with an elongated
3'-UTR caused by the retention of a 1-kb intron (20). Moreover, the 3'-UTR regions can undergo alternative polyadenylation. The
Tm5 testes-specific transcript may be derived from use of an
alternate polyadenylation signal, as the 9b 3'-UTR and 9c 3'-UTR
regions of the
-Tmf gene contain at least two
different polyadenylation sites each (24). These results
therefore suggest that a functional difference between tropomyosin
isoforms may also exist at the mRNA level. The 3'-UTR regions
may endow the mRNAs with isoform-specific functions, such as
specific intracellular localization or translation efficiency of
mRNAs.
We have also identified in skeletal muscle two mRNAs with deletions of the 5' end of the 9d 3'-UTR, and we hypothesized that these two transcripts may be generated through splicing of exon 8 to an alternative splice acceptor site located in the 3' end of the 9d 3'-UTR. Indeed, a mouse embryonic muscle Tm5 cDNA in which the last nine codons of exon 8, the coding region of exon 9d, and the first 400 bp of the 9d 3'-UTR were missing was reported in the Expressed Sequence Tag (EST) data base of GenBankTM (accession number W82438). This cDNA potentially encodes a 217-amino acid nonmuscle TM5 (or a 253 amino acid muscle TM5) as a termination codon is created after the first five codons in the remaining 9d 3'-UTR sequence. The respective amino acid sequences are conserved only between rodents, but the termination codon is conserved from rat to human. Thus, it is likely that all splicing possibilities occur in the Tm5 gene and give rise to additional isoforms.
Although the two alternative exons are not usually spliced to each
other, we identified an additional splice variant with exons 6a and 6b
spliced together. Several sequences involved in the choice of exons 6a
and 6b of the
-Tm gene have been identified (33, 34), and
the mechanism required for exon 6a inclusion appears to be independent
of the one responsible for exon 6b exclusion. There is no intrinsic
barrier to splicing between exons 6a and 6b in the Tm5 gene
(35), and some previous reports also suggest that the exons 6a and 6b
of the
-Tm gene could splice together in vitro
(33) and in vivo (36). This splice variant potentially produces a truncated tropomyosin of 178-amino acid residues which may
function as a "poison molecule" by incorporation into polymers and
subsequently disrupting the head-to-tail overlaps.
The differential expression of Tm5 isoform mRNAs in various adult rat tissues suggests that, although some exons are preferentially expressed in particular tissues, alternate exons are not used in a strictly tissue-specific manner. Rather, we hypothesize that these isoforms are expressed in any type of cell where they may be used to define specific intracellular compartments. Tropomyosin isoforms are indeed spatially segregated in a variety of cell types where they maintain specific microfilament domains (12, 37). The differential localization of NM1, 2 isoforms (exon 9d), and NM4, 7 (exon 9c) isoforms in rat cerebellum also supports functionally distinct roles. The existence of extensive Tm5 isoform diversity may thus provide a means of creating multiple spatial compartments with distinct functions inside the same cell.
The study of expression of the different Tm5 isoform
mRNAs indicates that no two transcripts are coordinately regulated
during rat brain development. The selection of alternative internal and terminal exons is thus independently controlled. We show that a
developmental switch occurs in the preferential use of internal exon 6a
to 6b from embryonic to adult isoforms. This is not restricted to the
brain but also occurs during skeletal muscle development. A similar
switch was described for
-Tm mRNA processing during myogenesis (21, 38) and for
-Tmf gene isoforms
during neuronal development.3
Thus, the use of internal exons 6a and 6b in a developmental stage-specific manner appears to be a general mechanism of tropomyosin gene regulation.
At the molecular level, alternative splicing of Tm5
pre-mRNA suggests a requirement of specific regulatory factors. In
Drosophila, specific splicing regulators have been
identified (39). In contrast, variations in the levels of constitutive
splicing factors have been shown to alter splicing in mammals (40-43).
Changes in the concentration of at least three constitutive splicing
factors can alter splice site selection of exons 2 and 3 of the
-Tmf gene (44), and splicing of the
-Tm alternative exon 6a depends on the ratio of two SR
proteins (45). Whether the potential combination effects of variations
in the concentrations of different SR proteins and antagonistic factors
are large enough to account for the multiple alternative splicing
choices made in the Tm5 gene or whether other mechanisms are
also involved has yet to be determined.
The extensive alternative splicing of the Tm5 gene suggests
that these isoforms may be functionally distinct. First, TM isoforms may differ in their intrinsic properties. Several TM isoforms differ in
their affinity for F-actin; the carboxyl-terminal exon 9 was found to
be responsible for the difference between smooth and striated muscle
-TMf binding to F-actin (46, 47). Also, the differences in
the binding of Tm-5a and Tm-5b encoded by the
-Tmf gene are due to differences in the use of
exons 6a and 6b (48, 49), and replacing 21 residues of the smooth muscle
-Tmf exon 6b with exon 6a results in a
2-fold increase in actin affinity in vitro (50). Another
intrinsic property conferred by the alternatively spliced exons is to
specify the formation of homodimers versus heterodimers
(51). Nonmuscle isoforms of different genes can form heterodimers, but
pairs of isoforms differing by the use of exons 6a and 6b (Tm-5a,
Tm-5b, and TM2, TM3 from the
-Tmf gene) are
unable to heterodimerize with each other (52).
Alternative splicing may not only produce structurally different isoforms. It may also have implications for TM isoform sorting, both at the mRNA and protein levels. The regulation of mRNA sorting involves specific signals located in the 3'-UTR of mRNAs (53). Although sequences controlling TM mRNA location have not been identified yet, it is tempting to speculate that alternative splicing of the Tm5 gene which gives rise to mRNAs encoding identical proteins but differing in their 3'-UTR provides a means of regulation of mRNA redistribution and sites of synthesis of proteins.
Alternative splicing may also regulate the final protein localization by selection of specific coding exons that may contain information for preferred protein-protein interaction. A shift in localization of two isoforms, Tm5 NM1 and NM2, to different neuronal compartments during development was revealed by staining with an antibody specific for amino acids encoded by exon 9d. These isoforms are located in the growing axon in developing neuron but in the cell body and the dendrites in mature neurons (12). Protein distribution did not correlate exactly with corresponding mRNA localization in the mature neuron (11). Given the switch in the use of exon 6a to exon 6b from the developing to the adult isoforms described in this paper, we expect that the NM1 isoform (6a + 9d) is located exclusively in the growing axon of a developing neuron, whereas the NM2 isoform (6b + 9d) is targeted to the somatodendritic compartment of a mature neuron. Thus, the differential use of exons 6a and 6b may regulate the targeting of isoforms and therefore the development of specific cellular compartments.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Edna Hardeman for providing soleus RNA sample; Germaine Beattie for sequencing work; Jim J.-C. Lin for providing CG3 antibody; and Jennifer Byrne and Phil Robinson for helpful advice. We also thank Professor Peter Rowe for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Health and Medical Research Council of Australia grants (to R. P. W., P. L. J., and P. G.) and by an INSERM fellowship (to C. D).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF053359, AF053360, and AF053361.
** Senior Research Fellow of the National Health and Medical Research Council. To whom correspondence should be addressed: Oncology Research Unit, Clinical Sciences Bldg., New Children's Hospital, P. O. Box 3515, Parramatta, New South Wales 2124, Australia. Tel.: 61-2-984 53045; Fax: 61-2-984 53078; E-mail: peterg3{at}nch.edu.au.
1 The abbreviations used are: RT-PCR, reverse transcriptase-polymerase chain reaction; Tm, tropomyosin; a.a., amino acid; bp, base pair(s); UTR, untranslated region; kb, kilobase pair(s).
2 R. P. Weinberger, unpublished observations.
3 R. Weinberger and G. Schevzov, unpublished data.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Schevzov, T. Fath, B. Vrhovski, N. Vlahovich, S. Rajan, J. Hook, J. E. Joya, F. Lemckert, F. Puttur, J. J.-C. Lin, et al. Divergent Regulation of the Sarcomere and the Cytoskeleton J. Biol. Chem., January 4, 2008; 283(1): 275 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gunning, G. O'neill, and E. Hardeman Tropomyosin-Based Regulation of the Actin Cytoskeleton in Time and Space Physiol Rev, January 1, 2008; 88(1): 1 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schevzov, N. S. Bryce, R. Almonte-Baldonado, J. Joya, J. J.-C. Lin, E. Hardeman, R. Weinberger, and P. Gunning Specific Features of Neuronal Size and Shape Are Regulated by Tropomyosin Isoforms Mol. Biol. Cell, July 1, 2005; 16(7): 3425 - 3437. [Abstract] [Full Text] [PDF] |
||||
![]() |
|