![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 29, 18586-18593, July 17, 1998
,
, and
From the The polysaccharide intercellular adhesin (PIA) is
an important factor in the colonization of medical devices by
Staphylococcus epidermidis. The genes encoding PIA
production are organized in the icaADBC
(intercellular adhesion) operon. To
study the function of the individual genes, we have established an
in vitro assay with UDP-N-acetylglucosamine,
the substrate for PIA biosynthesis, and analyzed the products by
thin-layer chromatography and mass spectrometry. IcaA alone exhibited a
low N-acetylglucosaminyltransferase activity and represents
the catalytic enzyme. Coexpression of icaA with
icaD led to a significant increase in activity. The newly
identified icaD gene is located between icaA
and icaB and overlaps both genes.
N-Acetylglucosamine oligomers produced by IcaAD reached a
maximal length of 20 residues. Only when icaA and
icaD were expressed together with icaC were
oligomer chains that react with PIA-specific antiserum synthesized.
IcaA and IcaD are located in the cytoplasmic membrane, and IcaC also
has all the structural features of an integral membrane protein. These results indicate a close interaction between IcaA, IcaD, and IcaC. Tunicamycin and bacitracin did not affect the in vitro
synthesis of PIA intermediates or the complete PIA biosynthesis
in vivo, suggesting that a undecaprenyl phosphate carrier
is not involved. IcaAD represents a novel protein combination among
In recent years, Staphylococcus epidermidis has emerged
as a frequent cause of nosocomial infections in association with
indwelling medical devices such as intravascular catheters,
cerebrospinal fluid shunts, prosthetic heart valves, prosthetic joints,
artificial pacemakers, and chronic ambulatory peritoneal dialysis
catheters (reviewed in Refs. 1 and 2). The virulence of S. epidermidis in these infections is thought to be based on its
ability to colonize medical devices by forming a biofilm composed of
multilayered cell clusters embedded in a slime matrix (3). As shown by
electron microscopy studies, surface colonization takes place in two
steps (4). The first step is primary adhesion of some bacteria, which is followed by proliferation of the cells to multilayered clusters. Factors reported to contribute to primary attachment of S. epidermidis cells to a polymer surface include unspecific
hydrophobic interactions (5, 6), a capsular polysaccharide/adhesin
(PS/A) (7, 8), proteinaceous cell-surface antigens (SSP-1 and SSP-2)
(9, 10), and the autolysin AtlE identified by our group (11).
A characteristic feature of the second phase of biofilm formation is
intercellular adhesion, which results in the formation of large cell
clusters by clinical S. epidermidis strains. This reaction
is associated with the production of the polysaccharide intercellular
adhesin (PIA)1 located at the
cell surface (12). PIA consists of two structurally related
homoglycans, polysaccharides I and II, composed of at least 130 2-deoxy-2-amino-D-glucopyranosyl residues that are mostly (>80%) N-acetylated. The residues are Recently, we cloned and sequenced three S. epidermidis RP62A
genes (icaABC) that are involved in intercellular adhesion
and PIA production (16). Transposon insertion mutants in the
ica operon of S. epidermidis O-47 (class B
mutants) (17, 18) are unable to form a biofilm on various surfaces. It
has also been shown that the majority of S. epidermidis
strains isolated from septicemic patients were biofilm-positive,
whereas skin and mucosal isolates were not, even though the genome of
the biofilm-forming strains contained the ica genes
(19).
Here, we report the identification of a fourth gene (icaD)
that is located within the ica operon and that is necessary
for PIA synthesis. Furthermore, we demonstrate that IcaA and IcaD are
located in the membrane and together exhibit
N-acetylglucosaminyltransferase activity, in which IcaA
represents the catalytic enzyme that requires IcaD for full activity.
Finally, we show that in addition to icaA and
icaD, icaC is essential for long-chain PIA
synthesis.
Bacterial Strains and Growth Conditions--
DNA containing
ica was isolated from PIA-producing and biofilm-positive
S. epidermidis RP62A (ATCC 35984). The Staphylococcus carnosus wild-type strain TM300 (20) was used as cloning host for
all staphylococcal plasmids and for heterologous expression of
ica genes. Cloning in Escherichia coli and the
production of maltose-binding protein fusions were performed in
E. coli strain TB1 (ara DNA Techniques and Transformation--
DNA manipulations,
plasmid DNA isolation, and transformation of E. coli were
performed using standard procedures (21). To isolate DNA from
staphylococci, cells were lysed by adding 0.1 mg/ml lysostaphin (Sigma,
Deisenhofen, Germany), and the alkaline lysis method was subsequently
applied. Chromosomal staphylococcal DNA was prepared according to the
procedure of Marmur (22). S. carnosus was transformed with
plasmid DNA by protoplast transformation (23). Polymerase chain
reaction experiments were performed with Vent DNA polymerase
(New England Biolabs) as recommended by the manufacturer. DNA sequences
were determined using the Sequenase protocol (Version 2.0, Amersham,
Braunschweig, Germany) or a LI-COR DNA sequencer (MWG-Biotech,
Ebersberg, Germany). The primers for polymerase chain reaction were as
follows: primer 4, ATGCATGTATTTAACTTTTTACTTTTC; primer 5, TCGACGCGTGATATAGTAATAAATAAGCTCTCCC; primer 18, CGGGATCCAGGAGGTGAAAAAATGCATGTATTT; primer 23, TCGACGCGTTTGAAAGGTTTCATATGTCACG; primer 25, CGGGATCCAAGAAAGAAAGGTGGCTATGC; primer 33, GAAGATCTCATGGTCAAGCCCAGA; primer 34, GAAGATCTCATCAATGCGCTAATAAAG; primer S1,
AAAAAGGCGCCGGGACTTTTTTTATTAATTCCAGTTAGGC; primer S2, TTTTTAGATCTCGCGTTTCAAAAATATAAGAAAGGTCGTG; primer S8,
AATAAGGGACGCGTTTTATTAATTCCAG; primer S12,
GCTTTAGATCTTAACTAACGAAAGGTAGG; and primer S15,
CGATGATTATGACACAAATAAACACGCGTAAATACAC. Restriction sites
are underlined.
Vectors and Plasmid Constructions--
In this study, the
ica genes were amplified by polymerase chain reaction from
chromosomal DNA of S. epidermidis RP62A and cloned
independently or in various combinations in the inducible staphylococcal expression vectors pTX15 (24) and pCX19, a derivative of
pCX15 (25). Gene expression was induced by adding 0.5% xylose (final
concentration) to the growth medium (LB medium) at
A578 nm = 0.4 and further incubation of the
strains for 6 h. The restriction sites used for the construction
of the following plasmids are indicated in parentheses:
pTXicaA carries icaA amplified using primers 18 and 5 (BamHI-MluI); pCXicaD contains
icaD amplified using primers 25 and 23 (BamHI-SmaI); pTXicaAD harbors
icaA and icaD amplified using primers 18 and 23 (BamHI-MluI); pTXicaADBC contains the
entire ica operon amplified using primers S12 and S8
(BglII-MluI); pTXicaADB carries
icaA, icaD, and icaB amplified using
primers S12 and S15 (BglII-MluI); and
pTXicaBC contains icaB and icaC
amplified using primers S2 and S1 (BglII-NarI). pTXicaADC was obtained by generating a frameshift deletion
mutation of icaB in pTXicaADBC as described
for the inactivation of icaB in pCN27 (16). The plasmid
pTX16 (24) was used as a negative control.
Mikrobielle Genetik,
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-glycosyltransferases.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-1,6-linked (13),
a type of linkage for N-acetylglucosamine polymers that has
not been previously described. In addition, a 140-kDa extracellular
protein that is missing in an accumulation-negative mutant of S. epidermidis RP62A is thought to contribute to intercellular
adhesion (14, 15).
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(lac proAB)
rpsL (f80 lacZ
M15) hsdR) obtained
from New England Biolabs (Schwalbach, Germany). Staphylococci were grown in tryptic soy broth (Difco, Augsburg, Germany) or in LB medium
(1% Tryptone (Difco), 0.5% yeast extract (Difco), and 0.5% NaCl),
which was also used to cultivate E. coli. When appropriate, the media were supplemented with tetracycline (10 µg/ml),
chloramphenicol (10 µg/ml), or ampicillin (100 µg/ml).
Preparation of Cell Extracts and
Membranes--
Staphylococcus and E. coli
cultures were harvested by centrifugation, and the cell pellets were
resuspended in buffer A (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, and 4 mM dithiothreitol;
2 µl/mg of cell wet weight). The cells were disrupted by 3 × 1-min vortexing in Corex tubes with glass beads (diameter of 0.15-0.30
mm; 4.5 times the weight of the cell pellet). DNase I (20 µg/ml;
Boehringer Mannheim, Mannheim, Germany) was added before breaking the
cells. Unbroken cells and glass beads were sedimented (10 min,
2000 × g), and the supernatant was saved. The
procedure was repeated one to three times; all supernatants were
combined. Membranes were sedimented from the crude extract by
ultracentrifugation (20 min, 200,000 × g) and
resuspended in buffer A at a protein concentration of 5 mg/ml (5-fold
concentration of the membrane proteins over the crude extract). The
collected membranes were called "crude membranes." For further
purification, the crude membranes were extracted with 2% (w/v) Triton
X-100 (in buffer A) for 2 h with gentle shaking, sedimented again,
washed once with buffer A, and resuspended in the same volume of buffer
A as the crude membranes. These preparations were designated
"Triton-extracted membranes." The membranes were stored at
70 °C. Protein concentrations were determined by the method of
Bradford (47).
Preparation of Anti-Ica and Anti-IcaD Antisera -- E. coli TB1 carrying pIHicaA300 or pIHicaD was used to express the malE gene fusions. The soluble maltose-binding protein (MBP) fusion protein MBP-IcaA300 was purified according to Ref. 45. The very poorly produced fusion protein MBP-IcaD was located in the membrane fraction, from where it was solubilized as described above using 2% (w/v) Triton X-100 and 500 mM NaCl. The MBP-IcaD-containing fraction was diluted to a final Triton X-100 concentration of 0.5% and incubated for 12 h with amylose resin equilibrated with column buffer (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, and 10 mM EDTA) containing 0.5% Triton X-100. The amylose material was collected by centrifugation (10 min, 2000 × g) and washed. MBP-IcaD was eluted with 10 mM maltose in column buffer. Rabbits were immunized with the purified MBP fusion proteins at Eurogentech (Seraing, Belgium) according to their standard immunization program. The antiserum obtained against MBP-IcaA300 was designated anti-IcaA; the antiserum obtained against MBP-IcaD was designated anti-IcaD.
Immunoblot Analyses of Proteins and PIA Production-- To block unspecific binding of the antisera and secondary conjugates used in immunoblot analyses, these were diluted 1:250 in Tris-buffered saline, 0.1% bovine serum albumin, and 1 mM sodium azide and incubated with a crude extract from S. carnosus pTX16 (final protein concentration of 0.5 mg/ml). After 12 h of gentle shaking, precipitated material was sedimented by centrifugation (30 min, 30,000 × g).
Proteins were separated by SDS-polyacrylamide gel electrophoresis according to Laemmli (46) and either stained with Coomassie Brilliant Blue R-250 (Sigma) or electrophoretically transferred to a nitrocellulose membrane (BA83, Schleicher & Schuell, Dassel, Germany) using a semidry apparatus. IcaA was detected by the anti-IcaA antiserum and IcaD by the anti-IcaD antiserum (1:1000). Subsequently, the nitrocellulose membranes were incubated with anti-rabbit immunglobulin G-biotin conjugate (1:5000; Sigma) and with streptavidin-horseradish peroxidase complex (1:5000; Amersham). Immunoreactive proteins were visualized by enhanced chemiluminescence (ECL, Amersham) with Fuji HR-E30 films. Reprobing of a blot with another primary antiserum was performed according to the ECL Western blotting protocol. PIA production in vivo was analyzed in crude extracts and in cell-surface extracts obtained by incubating the cells in 0.5 M EDTA, pH 8.0, for 5 min at 100 °C. For production experiments in the presence of antibiotics, tunicamycin (5-20 µg/ml) and bacitracin (50-400 µg/ml) were added to cultures of S. carnosus pTXicaADBC at the time of induction. PIA production in vitro was determined in the enzymatic assays. Extracts (1 µl each) were applied to a nitrocellulose membrane (BA83) using the Bio-Dot Microfiltration apparatus (Bio-Rad, München, Germany). PIA was detected with the PIA-specific antiserum (1:5000) (16). Bound PIA antibodies were visualized by anti-rabbit immunglobulin G-alkaline phosphatase conjugate (1:5000; Sigma) and color reaction.In Vitro Enzymatic Assay (N-Acetylglucosaminyltransferase Assay) -- In vitro reactions to analyze glycosyltransferase activity were performed by incubating crude extracts (see above) with 0.4 mM UDP-N-acetylglucosamine or crude membranes or Triton-extracted membranes (see above) with 2 mM UDP-N-acetylglucosamine. In vitro synthesis of peptidoglycan was repressed by adding 50 µg/ml D-cycloserine (26). For radiolabeling, 10 µM UDP-N-acetyl-D-[U-14C]glucosamine (final radioactive concentration of 84 Bq (2.3 nCi)/µl of reaction volume; Amersham) was added. Analytical reactions were carried out in a total volume of 10-50 µl. Reaction mixtures were incubated for 12 h at 20 °C. To test other substrates, UDP-glucose, UDP-galactose, and UDP-glucuronic acid (14C-labeled substrates from Amersham) were used in equimolar amounts. For experiments in the presence of tunicamycin and bacitracin, the antibiotics were added in the above-mentioned concentrations.
Analytical Methods-- For thin-layer chromatography, in each case, 1 µl of in vitro reaction assays containing 14C-labeled UDP-N-acetylglucosamine was applied to NH2-HPTLC plates (Merck, Darmstadt, Germany). The chromatogram was developed twice using acetonitrile/water (60:40 or 65:35, v/v). Radioactive spots were detected by phosphoimaging with a Fuji BAS 1500 (Raytest, Straubenhardt, Germany) or by autoradiography. Fuji HR-E30 films were exposed for 6-10 weeks. As a reference compound, N-acetyl-D-[1-14C]glucosamine (25 Bq) or unlabeled N-acetylglucosamine (10 µg) was used. If appropriate, 0.005% Triton X-100 was added. The unlabeled standard was visualized by spraying with 0.2% orcinol in H2SO4 and subsequent heating at 100 °C for 15 min.
For HPLC analysis of the in vitro synthesized products, the pH of the reaction assays was lowered to 4.5 with phosphoric acid; the samples were heated for 5 min at 100 °C; and the precipitated material was sedimented by centrifugation (10 min, 13,000 × g). Acetonitrile was added to the supernatant to a final concentration of 75%. The products were separated on a Nucleosil 120-7-NH2-HPLC column (4.6 × 250 mm; Bischoff, Leonberg, Germany) and eluted with an acetonitrile gradient in pure water from 75 to 50% acetonitrile over 45 min at a flow rate of 1 ml/min. Subsequently, the column was washed for 10 min with pure water. Elution was monitored by determining A205 nm. Radiolabeled products were detected by measuring 14C using a flow counter (Packard Instrument Co.). Electrospray mass spectra were recorded on a triple-quadrupole mass spectrometer Model API III (mass range of m/z 10-2400) equipped with a pneumatic supplied electrospray ("ion spray") interface (Sciex, Thornhill, Ontario, Canada). The mass spectrometer was operated in positive ion mode under unit mass resolution conditions for all determinations. The potential of the spray needle was kept at 4.8 kV; the orifice voltage was +80 V. For mass calibration, a solution of polypropylene glycol was used. Unlabeled IcaAD-dependent products synthesized in vitro were applied to the mass spectrometer by HPLC/MS coupling injecting 100 µl/min into the mass spectrometer.| |
RESULTS |
|---|
|
|
|---|
Identification and Characterization of icaD-- To analyze the biosynthesis of the N-acetylglucosamine polymer PIA, the ica genes were expressed under the control of the xylose-inducible promoter of the pTX15 expression vector (24) independently and in various combinations in S. carnosus. Glycosyltransferase activity was studied by incubating crude extracts or cell fractions of these clones with UDP-N-acetylglucosamine, the putative substrate for N-acetylglucosamine oligomer synthesis. In these experiments, evident transferase activity was detected when icaA and the intergenic region between icaA and icaB were expressed in S. carnosus. This region harbors a small open reading frame whose relevance was, until then, unclear. The gene was designated icaD (Fig. 1).
|
Localization of IcaA and IcaD-- To determine the localization of IcaA and IcaD, antisera against maltose-binding protein fusions of IcaA and IcaD were raised in rabbits. By Western blot analyses, the presence of IcaA and IcaD was analyzed in various cell fractions from induced S. carnosus pTXicaAD cells. For detailed studies, the membrane fraction was divided into crude membranes (membranes derived from the crude extract by ultracentrifugation) and Triton-extracted membranes (crude membranes purified by Triton X-100 extraction). The anti-IcaA antiserum reacted with a 38-kDa protein present in the crude extract, the crude membranes, and the Triton-extracted membranes, but not with any protein in the cytosolic fraction or the soluble fraction obtained from Triton X-100 extraction (Fig. 2A). No reaction of the antiserum was observed with Triton-extracted membranes from uninduced S. carnosus pTXicaAD or from S. carnosus pTX16 (24) carrying the vector alone, indicating that the reaction of the antiserum was IcaA-specific. The IcaD-specific antiserum reacted with a 34-kDa protein that was present in the same fractions as IcaA (Fig. 2B). Thus, both IcaA and IcaD are membrane-bound. IcaA and IcaD exhibited very similar apparent molecular masses in the SDS-polyacrylamide gel electrophoresis analyses. We therefore reprobed the blot that was analyzed with the IcaD-specific antiserum with the anti-IcaA antiserum to confirm that IcaA and IcaD are independent proteins. The result (Fig. 2C) clearly showed that the two antisera recognize different proteins.
|
In Vitro Synthesis and Characterization of PIA Oligomers-- The glycosyltransferase activity of IcaAD was analyzed in crude extracts and membranes from S. carnosus pTXicaAD. As a negative control, extracts from S. carnosus pTX16 were used. Products synthesized in vitro from UDP-N-acetylglucosamine (5-25% of the applied substrate was 14C-labeled) were analyzed by HPTLC on NH2-HPTLC plates (Fig. 3). With crude extract, crude membranes, and Triton-extracted membranes from induced S. carnosus pTXicaAD, but not with the cytosolic fraction or the soluble fraction obtained from Triton X-100 extraction, radiolabeled products were formed that were separated in a ladder-like series. This ladder strongly suggested that the products represent oligomers with an increasing number of residues. No such products were synthesized with extracts from S. carnosus pTX16 cells (Fig. 3) or extracts from uninduced S. carnosus pTXicaAD cells (data not shown), indicating that the observed transferase activity was due to icaA and icaD. When UDP-glucose, UDP-galactose, and UDP-glucuronic acid, which often function as substrates for the biosynthesis of exopolymers, were tested, we obtained no ladder of products (data not shown).
|
|
Analysis of the Individual Functions of icaA and icaD-- To dissect the individual functions of IcaA and IcaD in N-acetylglucosaminyltransferase activity, the corresponding genes were inducibly expressed in S. carnosus using two compatible plasmids. icaA was expressed from pTXicaA, and icaD from pCXicaD. N-Acetylglucosaminyltransferase assays performed with Triton-extracted membranes of induced cells (Fig. 5) showed that IcaD alone has no transferase activity, whereas IcaA alone has very low activity. A similar low activity was obtained when the membrane preparations from S. carnosus pTXicaA and S. carnosus pCXicaD were combined. However, when icaA and icaD were expressed in trans in S. carnosus pTXicaA + pCXicaD, transferase activity was increased, although to a lower extent than by cis-expressed icaA and icaD in S. carnosus pTXicaAD.
|
In Vitro Analysis of the Effect of icaB and icaC on the Synthesis of the PIA Sugar Chain-- The oligosaccharides synthesized by IcaAD have a maximal chain length of 20 residues as determined by TLC analysis. Full-length PIA, however, consists of at least 130 residues (13). To determine whether the additional Ica proteins IcaB and IcaC have an effect on the polymerization degree of the synthesized oligomers, extracts of S. carnosus expressing icaC and/or icaB in addition to icaAD from xylose-inducible vectors were analyzed for transferase activity. In these assays (Fig. 6), the expression of icaADC resulted in the synthesis of new radiolabeled products that did not migrate on TLC plates and that were formed in addition to the oligomers from IcaAD, which are less concentrated in the presence of IcaC. In the absence of IcaAD, IcaC had no transferase activity. IcaB produced no detectable effect in any combination with other Ica proteins. The nonmigrating IcaADC-dependent products reacted with the PIA-specific antiserum, in contrast to the products of IcaAD. We therefore surmise that the IcaADC-dependent products represent sugar chains with a higher degree of polymerization than those produced by IcaAD alone. These products were not synthesized when membrane preparations of different S. carnosus clones expressing either icaAD or icaC were mixed.
|
| |
DISCUSSION |
|---|
|
|
|---|
In previous work (16), we showed that the ica operon is
responsible for the production of PIA. Since PIA consists of a
-1,6-linked homoglycan composed of N-acetylglucosamine
(13), we expected activated N-acetylglucosamine to be a
substrate for the glycosyltransferase reaction in PIA biosynthesis.
Indeed, with UDP-N-acetylglucosamine, we obtained oligomer
synthesizing activity in vitro with crude extracts and
membranes of an S. carnosus clone expressing the ica operon. UDP-glucose, UDP-galactose, and UDP-glucuronic
acid each revealed no activity, and nonactivated
N-acetylglucosamine and glucosamine also failed to function
as substrates in the in vitro assay (data not shown).
To allocate the N-acetylglucosaminyltransferase activity, the ica genes were introduced independently or in various combinations into S. carnosus, and cell extracts were tested for glycosyltransferase activity. We could thus demonstrate that IcaA alone revealed a weak N-acetylglucosaminyltransferase activity (Fig. 5, lane A). Although the activity was very weak, there is no doubt that IcaA represents the actual N-acetylglucosaminyltransferase since no transferase activity was obtained with IcaD, IcaB, and/or IcaC in the absence of IcaA. This is in accordance with the sequence similarity of IcaA to processive glycosyltransferases, which add multiple monosaccharides to a growing sugar chain (29). In the N-acetylglucosaminyltransferase NodC of rhizobia (30, 31), the hyaluronan synthase HasA of Streptococcus pyogenes (32), bacterial cellulose synthases (33), chitin synthases of fungi (34), and the DG42 protein of Xenopus laevis, which synthesizes Nod-like oligomers during embryogenesis (35), five amino acids are conserved that are thought to function as catalytic residues (36). These amino acids are also conserved in IcaA (Asp134, Asp227, Gln273, Arg276, and Trp277) as shown in Fig. 7.
|
Full glycosyltransferase activity is only achieved when icaD is cotranscribed with icaA (Fig. 5, lane AD 1pl.). The newly identified icaD gene is located between icaA and icaB and overlaps both of these genes. Since the start of icaD overlaps with the end of icaA by 37 nucleotides (Fig. 1), we were at first uncertain whether this small open reading frame was functional or whether it was expressed as an IcaA-IcaD fusion protein due to -1 translational frameshifting. In the Western blots (Fig. 2), IcaD exhibited a size of 34 kDa, instead of the calculated 12.0 kDa, similar to that of the IcaA protein (38 kDa). However, reprobing of the blot that was analyzed with the IcaD-specific antiserum with the anti-IcaA antiserum clearly showed that IcaA and IcaD represent separate proteins with no cross-reactivity. The deviations in the apparent molecular masses of IcaA and IcaD from their calculated masses (IcaA, 38 instead of 47.8 kDa; IcaD, 34 instead of 12.0 kDa) might result from performing all SDS-polyacrylamide gel electrophoresis analyses without heating the protein samples. When heated, IcaA could be detected only as a high molecular mass smear (Fig. 2A, lane TMh), possibly due to aggregation of the IcaA molecules. Without heating, a complete denaturation of the proteins is not guaranteed, thus possibly causing an unusual migration of both IcaA and IcaD. The 34-kDa IcaD protein could also correspond to a trimer of the 12-kDa monomer. IcaA and IcaD are both membrane-bound (Fig. 2), which correlates with the finding that essentially membrane fractions showed transferase activity (Fig. 3). The membrane location was not unexpected since the hydrophobicity plots suggested the presence of four transmembrane helices in IcaA (one located at the N terminus and three at the C terminus) (16) and two transmembrane domains in IcaD.
To exhibit its function, IcaD probably has to interact with IcaA prior to membrane integration since mixing of extracts from an S. carnosus clone expressing icaA and a clone expressing icaD did not increase the N-acetylglucosaminyltransferase activity over that of IcaA alone (Fig. 5, lane A+D mix), whereas in trans expression of icaA and icaD did (lane AD 2pl.). The lower activity obtained with icaA and icaD expressed in trans compared with icaAD expressed in cis probably resulted from the different copy numbers of the vectors used (high copy pTXicaA and medium copy pCXicaD).
The concrete function of IcaD is not yet known. The interaction of IcaA
and IcaD might be necessary due to the unusual
-1,6-linkage of the
N-acetylglucosamine residues in PIA. Sugar chains composed of
-1,6-linked monomers differ greatly in their three-dimensional structure from the straight
-1,4-sugar chains synthesized by most of
the processive glycosyltransferases. Another possibility is that the
IcaA protein needs IcaD to obtain an active conformation. Since IcaD is
also a membrane-bound protein, it might act as a chaperone that directs
the membrane insertion of IcaA.
The combination of two proteins to achieve optimal activity is new
among the
-glycosyltransferases. No IcaD-like protein appears to be
involved in the transferase activities of homologous enzymes. NodC (424 amino acids) and HasA (395 amino acids), with a length similar to that
of IcaA (412 amino acids), as well as the bacterial cellulose synthase
AcsA (754 amino acids), the eukaryotic chitin synthases (>1000 amino
acids), and the DG42 protein (588 amino acids) do not contain a motif
similar to IcaD.
An undecaprenyl phosphate lipid carrier that is often involved in the biosynthesis of bacterial exopolysaccharides (27) does not appear to participate in the activity of IcaAD. First, we never detected lipid-linked intermediates in vitro or in vivo. And second, the antibiotics tunicamycin and bacitracin had no effect on the synthesis of IcaAD-dependent oligomers or PIA in vitro and in vivo. The homologous enzymes NodC, HasA, the chitin synthases, and the cellulose synthase of Acetobacter xylinum also produced no detectable lipid-linked intermediates, and tunicamycin and bacitracin had no effect on their activities (37-40).
The products synthesized from IcaAD in vitro were analyzed in detail by HPLC separation combined with mass spectrometry. The analysis of the products synthesized with Triton-extracted membranes revealed products that correspond to N-acetylglucosamine oligomers lacking one water residue/chain. The putative anhydrous oligomers were also formed with crude membranes. In addition, two further types of oligomers were obtained with crude membranes that correspond to (i) fully hydrated N-acetylglucosamine oligomers and (ii) N-acetylglucosamine oligomers carrying an as yet unidentified modification that is currently under investigation. The water elimination that produces the anhydrous oligomers might result from an intramolecular reaction that releases the oligosaccharide from the synthesizing enzyme. Since an anhydro bond can be considered to store the energy of a glycosidic bond, it could be important for a further elongation of the oligomers without a new activation. Anhydro bonds, for example, also exist in the peptidoglycan of E. coli, in which the sugar chains do not contain a reducing end, but carry 1,6-anhydromuramic acid (41).
No oligomers containing N-unsubstituted residues, which compose 15-20% of the major polysaccharide I of PIA in vivo (13), were detected by MS analysis. Since the known pathways for the synthesis of amino sugar-containing polysaccharides utilize the nucleotide-linked N-acetylamino sugars as precursors, it seems most likely that the N-unsubstituted amino sugar residues of PIA are produced through enzymatic deacetylation subsequent to the formation of the polymer chain. The MS analyses were only performed with products synthesized with membranes, and therefore, the putative deacetylase activity may have escaped if it is located in another cell fraction. Known deacetylating enzymes are localized in different cell fractions (42-44). However, it is also possible that the percentage of deacetylated IcaAD-dependent oligomers was too low to be detected or that only full-length PIA is a substrate for deacetylation. It was not possible to test whether the N-unsubstituted residues in PIA might be derived from the direct incorporation of glucosamine because UDP-glucosamine is not commercially available.
IcaAD synthesized oligomers of a maximal length of 20 residues as determined by TLC analysis, but did not form polymers comprising full-length PIA, which was shown to be at least 130 residues long (13). By expressing icaADC in S. carnosus, products were synthesized that did not migrate on TLC plates and that reacted with the PIA-specific antiserum. We therefore assume that the nonmigrating products represent longer oligosaccharide chains. We cannot rule out that these products might represent modified or protein-bound oligomers. However, an S. carnosus clone expressing icaADC is capable of forming cell aggregates.2 This speaks against the possibility that the IcaADC-dependent products simply represent PIA precursors and suggests that the genes icaA, icaD, and icaC are sufficient to direct the biosynthesis of PIA. The genes icaA, icaD, and icaC must, however, be coexpressed in one strain to obtain synthesis of the longer oligomers (Fig. 6). Thus, IcaA, IcaD, and IcaC, which is predicted to be an integral membrane protein (16), probably form a complex and assemble in the membrane in a coordinated manner. This would explain why mixing of crude extracts from strains expressing icaAD and icaC, respectively, did not lead to PIA biosynthesis.
The IcaB protein, predicted to be a secreted protein (16), does not seem to be involved in the biosynthesis of the PIA sugar chain; it had no detectable effect in the in vitro assays. Its function in the PIA-mediated cell aggregation is being investigated.
The data presented here show that IcaA, IcaD, and IcaC are involved in the biosynthesis of the sugar backbone of PIA. IcaAD constitutes N-acetylglucosaminyltransferase activity in which IcaA represents the actual transferase that requires IcaD for full activity. This is the first enzymatic activity identified to be involved in intercellular adhesion in S. epidermidis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Elisabeth Knorpp for excellent technical assistance and Sarah E. Cramton and Karen A. Brune for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by Grant BMBF 01KI9451/7 and by a Deutsche Forschungsgemeinschaft Graduiertenkolleg Mikrobiologie fellowship (to C. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
49-7071-74636; Fax: 49-7071-5937; E-mail:
friedrich.goetz{at}uni-tuebingen.de.
1 The abbreviations used are: PIA, polysaccharide intercellular adhesin; MBP, maltose-binding protein; HPTLC, high performance thin-layer chromatography; HPLC, high performance liquid chromatography; MS, mass spectrometry.
2 C. Gerke, O. Schweitzer, and F. Götz, unpublished data.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Itoh, J. D. Rice, C. Goller, A. Pannuri, J. Taylor, J. Meisner, T. J. Beveridge, J. F. Preston III, and T. Romeo Roles of pgaABCD Genes in Synthesis, Modification, and Export of the Escherichia coli Biofilm Adhesin Poly-{beta}-1,6-N-Acetyl-D-Glucosamine J. Bacteriol., May 15, 2008; 190(10): 3670 - 3680. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Jeng, T.-P. Ko, C.-I Liu, R.-T. Guo, C.-L. Liu, H.-L. Shr, and A. H.-J. Wang Crystal structure of IcaR, a repressor of the TetR family implicated in biofilm formation in Staphylococcus epidermidis Nucleic Acids Res., March 1, 2008; 36(5): 1567 - 1577. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Donelli, I. Francolini, D. Romoli, E. Guaglianone, A. Piozzi, C. Ragunath, and J. B. Kaplan Synergistic Activity of Dispersin B and Cefamandole Nafate in Inhibition of Staphylococcal Biofilm Growth on Polyurethanes Antimicrob. Agents Chemother., August 1, 2007; 51(8): 2733 - 2740. [Abstract] [Full Text] [PDF] |
||||