![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 30, 18959-18965, July 24, 1998
§,
,
,
,
From the
Endocrine Research Group, Departments of
Medicine and Medical Biochemistry, the Faculty of Medicine, University
of Calgary, Calgary, Alberta T2N 4N1, Canada and the ¶ St. Louis
Veterans Affairs Medical Center and Division of Endocrinology,
Department of Internal Medicine, St. Louis University,
St. Louis, Missouri, 63104
| |
ABSTRACT |
|---|
|
|
|---|
We have examined the regulation of apolipoprotein
A-I (apoA-I) gene expression in response to glucose and insulin. In Hep G2 cells, endogenous apoA-I mRNA was suppressed by one-half or induced 2-fold following 48 h of exposure to high concentrations of glucose (22.4 mM) or insulin (100 microunits/ml),
respectively, compared with control. Transcriptional activity of the
rat apoA-I promoter (
474 to
7) in Hep G2 cells paralleled
endogenous mRNA expression, and this activity was dependent on the
dose of glucose or insulin. Deletional analysis showed that a 50-base
pair fragment spanning
425 to
376 of the promoter mediated the
effects of both insulin and glucose. Within this DNA fragment there is
a motif (
411 to
404) that is homologous to a previously identified insulin response core element (IRCE). Mutation of this motif abolished not only the induction of the promoter by insulin but also abrogated its suppression by glucose. Electrophoretic mobility shift assay analysis of nuclear extracts from Hep G2 cells revealed IRCE binding activity that formed a duplex with radiolabeled probe. The IRCE binding
activity correlated with insulin induction of apoA-I expression. In
summary, our data show that glucose decreases and insulin increases apoA-I promoter activity. This effect appears to be mediated by a
single cis-acting element.
| |
INTRODUCTION |
|---|
|
|
|---|
The serum protein, apolipoprotein A-I (apoA-I),1 has intrinsic antiatherogenic properties and is the major apoprotein component of the high density lipoprotein particles (1, 2). Increased abundance of apoA-I correlates inversely with the incidence of coronary arterial disease (3, 4). This beneficial feature of the protein arises from its pivotal role in a normal physiologic process called reverse cholesterol transport (5). ApoA-I mediates the transfer of cholesterol from extra-hepatic tissues to high density lipoprotein particles which in turn shuttle cholesterol to the liver for excretion from the body in the form of bile salts or free cholesterol (6). Enhanced reverse cholesterol transport lowers total body cholesterol.
Previous epidemiologic studies have shown a clear inverse correlation between levels of apoA-I and the incidence of coronary artery disease in both normal and diabetic individuals (7, 8). This protective feature of apoA-I is of primary importance in the clinical setting of diabetes mellitus (DM) because these patients have a 2-3-fold higher risk of developing premature arterial atherosclerosis compared with the general population (8). The increased risk of atherosclerosis often leads to premature death when the disease results in occlusion of the coronary or cerebral vessels.
One potential explanation for the higher risk of atherosclerosis in diabetics may be attributed to lower levels of apoA-I protein in these patients (9). Since hyperglycemia and deficient insulin action are pathognemonic features of DM, we wondered how these abnormalities affected expression of apoA-I. Regardless of whether the patient has insulin-dependent or non-insulin-dependent DM arising from hypo- or hyperinsulinemia, respectively, both diseases are associated with the enhanced risk of arteriosclerosis (10, 11).
To further understand the mechanisms by which glucose and insulin regulate levels of apoA-I, we have used both a cell culture and animal model to examine apoA-I expression in response to changes of these metabolic factors. The results of our studies show that glucose and insulin have opposite effects on activity of the apoA-I gene in vitro and in vivo. Furthermore, the repressive and stimulatory actions of glucose and insulin on apoA-I gene transcription appears to be mediated through a 50-bp fragment present in the apoA-I promoter.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids--
Construction of the pA1.474.CAT plasmid used in
the transient transfection studies was described previously (12). Two
constructs, pA1.425.CAT and pA1.375.CAT containing promoter segments
425 and
375 to
7, respectively, were synthesized using the parent pAI.474.CAT as a template in separate polymerase chain reactions. These
reactions were primed with a unique 5' oligonucleotide spanning
425
to
413 or
375 to
363, respectively, plus a common 3' oligomer from
19 to
7. The mutant template was created in a similar fashion with the 5' primer containing transverse mutations of all eight nucleotides in the putative insulin responsive core element (IRCE). Human apoA-I cDNA used in the Northern blots was a generous gift from J. L. Breslow, Columbia University, New York (13).
Cell Culture and Measurement of CAT Activity--
The Hep G2,
human hepatoma cells chosen for the studies express both a glucose
transporter and the insulin receptor (14). These cells were maintained
in RPMI-ISE supplemented with 1% fetal calf serum, as described
previously (15). Cells were transfected with the plasmid of interest
using the calcium phosphate precipitation method (16). Two µg of Rous
sarcoma virus-
-galactosidase was added to all tranfections to
monitor the efficiency of DNA uptake by Hep G2 cells. Transfected cells
were maintained in control media containing 5.5 mM for
24 h before treatment with concentrations of glucose up to 40 mM, 2-deoxyglucose (Sigma) up to 22.4 mM, or
insulin (Humulin R, Eli Lily) ranging from 0 to 1000 microunits/ml for
24 or 48 h. The only exception being the glucose dose response studies in which one set of cells was treated without glucose. Harvested cells were lysed by several cycles of freeze-thawing in a dry
ice/alcohol slurry, and cellular debris was collected at 13,000 rpm for
5 min. An aliquot of the supernatant was taken for the measurement of
-galactosidase activity (17). The cytoplasmic fraction was heated at
60 °C for 10 min to destroy endogenous deacetylases, and the
chloramphenicol acetyltransferase (CAT) activity was measured as
described previously (18).
Animals-- Male Sprague-Dawley rats weighing between 150-175 grams were purchased from Harlan Laboratories, Indianapolis, IN. In the fructose studies, the rats were fed a standard chow (caloric content was 62% complex carbohydrates, 23% protein, and 14.9% fat) or a high fructose diet (caloric content was 65.7% fructose, 21.9% protein, and 12.3% fat purchased from Teklad Laboratories, Madison, WI) as described previously (19). Serum for apoA-I protein determinations by Western analysis was collected by cardiac puncture prior to the induction of DM or inferior vena cava puncture at the time they were killed. Blood glucose and serum insulin levels were measured as described previously (21). The livers were excised and snap-frozen in liquid nitrogen for RNA extraction.
Northern Blot Analysis-- Total RNA was isolated from Hep G2 cells or rat liver using a single step acid guanidinium phenol:chloroform extraction procedure (22). Aliquots of total RNA (10 µg) were separated electrophoretically on a denaturing 1% agarose gel containing 0.4 M formaldehyde (23). The separated RNA was transferred to a nylon membrane (Zeta Bind, Cuno AMF) and probed with a 32P-labeled human apoA-I cDNA for 18-24 h at 62 °C as described previously (24). The 18 and 28 S ribosomal RNA bands were visualized by ethidium bromide staining to ensure that equal amounts of total RNA were applied to each lane.
Western Blot Analysis-- Serum from experimental animals was separated by polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride membrane (Millipore, Waters Corp.). The blot was probed with a polyclonal antibody the characteristics of which were described previously (25).
Electrophoretic Shift Mobility Assay--
Nuclear extracts from
Hep G2 cells were prepared using a technique described previously (26).
Synthetic DNA duplexes spanning
419 to
388
(AATGCAACGAAACTTTGAGGCGGGGATGTGAG, synthesized by Life Technologies,
Inc.) from the apoA-I gene and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) IRCE (AACTTTCCCGCCTCTCAGCCTTTGAAAG) used in these
studies were radiolabeled at the 5'-ends by incubating each strand
separately with [
32P]ATP and polynucleotide kinase
prior to annealing. Each binding reaction of 20 µl contained 25 mM Hepes, 50 mM KCl, 1 mM EDTA, 0.5 mM spermidine, 0.6 mM dithiothreitol, 12%
glycerol, 5 µg of poly(dI-dC), 1 fmol of radiolabeled probe, and 20 µg of nuclear extract. In competition analysis, 50- or 300-fold molar
excess of unlabeled homologous or non-homologous competitor DNA was
added to the reaction prior to the addition of nuclear extracts. A
sequence homologous to the IRCE from the glucagon
(TAGTTTTTCACGCCTGACTGAGATTGAAGGGT) gene served as a competitor. All
reactions were incubated at room temperature for 20 min and then
separated on a 6% polyacrylamide nondenaturing gel (27).
Electrophoresis was performed at 10 volts/cm2 for 3 h
at 4 °C. The gel was then dried and exposed to Kodak XAR-5 film at
80 °C in the presence of intensifying screens.
| |
RESULTS |
|---|
|
|
|---|
Glucose and/or Insulin Effects on ApoA-I mRNA in Hep G2 Cells-- To analyze the effects of glucose and insulin on apoA-I expression, we measured the levels of endogenous apoA-I mRNA in the human hepatoma cell line, Hep G2. Exposure of these cells to 22.4 mM glucose for 24 or 48 h decreased the abundance of endogenous apoA-I mRNA to one-half as compared with that in cells maintained in control media (Fig. 1). Cells exposed to 100 microunits/ml of insulin for 48 h showed a 2-fold increase in apoA-I mRNA (Fig. 1). Treatment of the cells for 48 h with both factors at the concentrations quoted elicited an induction (1.3-fold) that was intermediate between that of glucose and insulin. Ethidium bromide staining of the 18 and 28 S rRNA bands showed no significant differences in the quantity of total RNA loaded into each of the lanes (data not shown). These results show clearly that glucose and insulin have opposite effects on the expression of apoA-I mRNA in Hep G2 cells.
|
Glucose and/or Insulin Effects on Rat Apo A1 Promoter in Hep G2-- The preceding observations prompted us to measure transcriptional activity of the apoA-I promoter in the Hep G2 cells. For these studies, we have used the rat apoA-I promoter because it has been studied extensively and its similarity to the human counterpart (28, 29). The response of pAI.474.CAT to both 22.4 mM of glucose and/or 100 microunits/ml of insulin in the Hep G2 cells is shown in Fig. 2A. Consistent with the observed changes in the level of endogenous apoA-I mRNA, 22.4 mM glucose inhibited promoter activity. Conversely, 100 microunits/ml insulin stimulated CAT activity. In the presence of both factors, there was a small but not significant increase in CAT activity. The inhibitory actions of glucose were not due to an osmotic effect because exposure of the cells to 2-deoxyglucose (22.4 mM) did not inhibit activity of the promoter (results not shown). These findings indicate that activity of the rat apoA-I promoter in Hep G2 cells following exposure to glucose and insulin matched endogenous expression of apoA-I mRNA.
|
DNA Motif That Mediated Effects of Glucose and Insulin-- To locate cis-acting site(s) in the apoA-I promoter that mediated the effects of glucose and/or insulin, deletional templates were constructed by removing segments of the promoter contained in pAI.474.CAT. Constructs arising from the removal of 47 and 97 base pairs from pAI.474.CAT yielded templates, pA1.425.CAT and pA1.375.CAT, respectively, as shown schematically in Fig. 3A.
|
325 to
7 fragment of the promoter was no longer responsive to either glucose or insulin. Together these observations show that glucose and insulin, respectively, represses and stimulates transcription of the apoA-I gene, and these effects require the
425
to
376 segment of the promoter.
Insulin Response Element in Rat Apo A1 Promoter--
To further
define cis-acting motif(s) in the rat apoA-I promoter that mediated the
effects of glucose and insulin, we searched the promoter for known
glucose or insulin response elements within the
425 to
376
fragment. Our search revealed an octanucleotide motif (CCCGCCTC,
411
to
404, Fig. 4) that is identical to
the insulin core response element (IRCE) of the GAPDH gene (30) and
shares an 88% homology with a similar IRCE found in domain A of the
glucagon gene (31). No similarities to previously described carbohydrate response elements found in the L-pyruvate
kinase and S14 genes were identified in the
425 to
376 fragment
(32).
|
411 to
404 motif mediated the effects of insulin,
we created a construct, pmAI.425.CAT (Fig. 4A) that
contained a mutated putative IRCE. The wild-type pAI.425.CAT construct
produced CAT activities similar to pAI.474.CAT in HepG2 cells following exposure to 22.4 mM glucose, 100 microunits/ml insulin or
both factors (Fig. 4B, open bars). In contrast,
the activity of the pmAI.425.CAT construct was no longer induced by 100 microunits/ml insulin (Fig. 4B, shaded bars). These data
suggest that the CCCGCCTC motif in the wild-type promoter mediates the
stimulatory effect of insulin. Unexpectedly, activity of the mutant
template was not inhibited by glucose. These observations suggest the
IRCE in apoA-I DNA mediates the stimulatory actions of insulin and the
same site may also mediate the inhibitory effects of glucose.
Effects of Glucose and/or Insulin on IRCE Binding Activity-- Next we examined whether the actions of insulin or glucose affected the binding activity of nuclear proteins that interacted with the rat apoA-I IRCE. Nuclear proteins extracted from HepG2 cells treated with glucose or insulin were tested using an electrophoretic mobility shift assay (Fig. 5). IRCE binding activity in control Hep G2 cells bound to the radiolabeled probe to form complexes that migrated as a doublet (Fig. 5A). The intensity of the lower band in the doublet was not affected by treatment with glucose or insulin (Fig. 5A). In contrast, intensity of the upper complex was increased in cells treated either with insulin alone or in combination with glucose (Fig. 5A).
|
Effect of Hyperglycemia and Hyperinsulinemia on ApoA-I Expression in Vivo-- Although in vitro experiments in cultured cells above have helped to elucidate the actions of glucose and insulin, whether the same effects of these factors extend to an in vivo model remains unanswered. The lack of animal models with features of either hyperglycemia or hyperinsulinemia alone makes it difficult to study these parameters in isolation. However, a model characterized by both hyperglycemia and hyperinsulinemia may be obtained by feeding fructose to rats (19). To ensure that fructose-fed rats did indeed have elevated levels of both insulin and glucose, the levels of these parameters were measured in the treated animals. In fructose-fed rats, blood glucose increased 30% from 7.4 ± 0.7 mM to 9.6 ± 0.8 mM, and insulin was elevated by 42% from 2.4 ± 0.5 to 3.4 ± 0.5 microunits/ml (Fig. 6, right panel).
|
| |
DISCUSSION |
|---|
|
|
|---|
In this report, we have examined the regulation of apoA-I gene expression in response to glucose and insulin. Interest in this topic stems from the clinical observation showing that hyperglycemia arising from hypo-/hyperinsulinemic states such as diabetes mellitus decreases the levels of apoA-I (33). Reduced abundance of this protein is believed to underlie the higher rates of coronary arterial disease (7, 8). Although previous clinical observations clearly document that hyperglycemia is associated with lower levels of apoA-I in diabetics, a suitable in vitro model for studying the mechanism(s) responsible for this effect is not available. Therefore, Hep G2 cells were chosen for the studies because they express apoA-I, insulin receptor, and glucose transporter (14).
When Hep G2 cells were exposed to high (22.4 mM) glucose
concentrations, it reduced endogenous human apoA-I mRNA to one-half that in cells maintained in control media (5.5 mM). The
importance of this finding is that the apoA-I lowering effect of
hyperglycemia in vivo is also observed in the in
vitro cell culture model. Additionally, the inhibitory effects of
hyperglycemia on apoA-I is significant because eukaryotic genes
repressed by glucose, excluding those found in yeast, are rare and
include the Drosophila
-amylase, rat albumin, and the
glucose transporter, GLUT-4 (20, 21, 34-36).
Insulin has the opposite effect to that of glucose and stimulates apoA-I expression in Hep G2 cells. Cells treated with insulin had 2-fold higher levels of the mRNA compared with controls. To our knowledge this is the first report showing that insulin increases apoA-I mRNA in liver-derived cells. Insulin has previously been shown to enhance the activity of several genes, such as (37), GAPDH (38), growth hormone (39), prolactin (40), and pancreatic amylase (41). Since response of endogenous apoA-I in Hep G2 cells to glucose and insulin parallels the behavior of this gene in vivo, these features make the cultured cells a useful model for dissecting the mechanisms of glucose and insulin action.
Both insulin and to a lesser extent, glucose are known to have direct
effects on the transcription of many genes (42-45), but the nuclear
mechanisms involved are incompletely understood. This study shows that
the repression and induction by insulin and glucose, respectively occur
at the transcriptional level. The CAT-activity of transfected Hep G2
cells decreased to 50% or increased by 2-fold relative to that in
control cells following exposure to 22.4 mM glucose or 100 microunits/ml of insulin, respectively. Furthermore, the magnitude of
the opposing effects of the two metabolic parameters was
dose-dependent (Figs. 2 and 3). Deletional analysis of the promoter allowed the identification of a 50-bp DNA fragment in the
promoter-spanning nucleotides
425 to
376 that is required for the
effects of both glucose and insulin.
A motif identical to the IRCE found in the GAPDH promoter (30), and
differs by 1 bp from that in the glucagon gene (31), is present in the
425 to
376 fragment of the rat apoA-I promoter. Site-directed
mutagenesis of this motif abolished the response of the promoter to
hormone and thus, confirmed that it mediated the actions of insulin
(Fig. 4). Both the rat apoA-I and the GAPDH genes are induced by
insulin, whereas the glucagon gene is repressed by insulin (30, 31, 46,
47). Whether the difference between the apoA-I and glucagon IRCE can
switch it from an inducible to an inhibitory element is uncertain.
Despite insulin-mediating properties and sequence similarities among
the IRCE from the rat apoA-I, GAPDH and glucagon genes, one marked
difference is that the apoA-I promoter is inhibited by glucose.
Additionally, although the apoA-I and GAPDH IRCEs are identical,
insulin induction of GAPDH appears to be more complex requiring the
cumulative actions of at least three cis-acting elements: g/TRE, IRE-A,
and IRE-B (48). In contrast, the rat apoA-I IRCE alone appears to be
the critical region that mediates the actions of the hormone.
In the preceding section, examples of IRCE with marked similarities were mentioned. However, the IRCE is not the only motif that mediates the actions of insulin because insulin responsive cis-acting elements that differ from the IRCE have been identified in several genes. For example, insulin stimulation of the promoters that regulate prolactin, thymidine kinase, and somatostatin expression appear to be mediated by one or more CGGA motifs (49). The transcription factor(s) that bind to the CGGA motif in these genes are related to the Ets family of nuclear proteins, such as Sap and Elk-1 (49). The observed nucleotide differences between the apoA-I IRCE and insulin responsive element from other genes suggests that there exists more than one class of cis-acting elements which mediate the effects of insulin. Additional support for this idea arises from the lack of homology between the IRCE and the negative insulin response element from the PEPCK gene (50). The existence of more than one type of insulin-regulated motif shows the complexities of gene control similar to the glucocorticoid response element and units found for example in the tyrosine aminotransferase and PEPCK genes (51, 52).
The rat apoA-I IRCE also appears to mediate the inhibitory effects of
glucose. This possibility is supported by the absence of a recognizable
carbohydrate response element within the
425 to
376 fragment and
the unexpected finding that mutation of the IRCE abolishes the
inhibitory effects of glucose. A similar but not identical scenario
applies to L-pyruvate kinase (L-PK) gene. Previous studies suggest that the stimulatory actions of both glucose
and insulin co-localize to a single motif (
168 to
144) present in
the L-PK promoter (53, 54). More recent data are in keeping
with the idea of a response unit comprised of several cis-acting
elements that cooperate to mediate the actions of glucose and insulin
(55). Although L-PK promoter response requires the presence
of insulin, it does not appear to be the primary signal (56). Glucose
seems to be more important, and its action is dependent on the binding
of two transcription factors, LF-A1 and a c-myc related
protein, to the carbohydrate response element located between
171 to
124 (57). An additional hepatic enriched factor, HNF-4, is also
required as an accessory factor that functions with the carbohydrate
response element (58).
Although it is tempting to speculate based on our data that a single motif mediates the actions of both glucose and insulin, this conclusion is likely premature. If so, then what are the potential explanations for our observation? Perhaps, the IRCE has a permissive effect on an adjacent carbohydrate responsive element. This means that the IRCE must be present to unmask the inhibitory actions of the adjacent element. Another possibility is that the IRCE may overlap with an element that mediates the effects of glucose. This possibility may explain why mutation of the IRCE also abolishes the activities of both glucose and insulin.
Gel-retardation analysis of nuclear extract from Hep G2 cells treated with high glucose or insulin revealed IRCE binding activity that formed a doublet following electrophoretic separation. Nucleoproteins binding to the IRCE from hyperglycemic cells were no different from those in control cells, suggesting that glucose has no effect on this activity. However, insulin alone or in combination with hyperglycemia increased the abundance of the upper band in the doublet. These findings suggest that insulin alone increases IRCE binding activity. The observation that glucose does not modulate IRCE binding activity supports the idea that the IRCE may serve in a permissive role for the inhibitory effects of glucose or the possibility of overlapping elements.
That insulin alone increases the activity of nucleoproteins which bind to the apoA-I IRCE is not unexpected. Previous studies of insulin-treated NIH-3T3 cells or an animal model of raised insulin levels produced by fasting followed by re-feeding showed increased binding activity to the GADPH IRCE (30). The rise in binding activity correlated with expression of GAPDH. The nuclear factor, IRE-ABP, believed to bind the IRCE from GAPDH has been cloned and is known to be related to mouse SRY (59, 60). The possibility that the apoA-I IRCE binding activity may be related to SRY is further supported by the finding that the GAPDH IRCE motif inhibits complex formation (Fig. 5C) and that the pattern of binding to both radiolabeled apoA-I and GAPDH IRCE are identical (Fig. 5C).
Although in vitro experiments in cultured cells above allow us to study the actions of glucose and insulin, whether the same effects of these metabolic factors extend to an in vivo model is difficult to test. The reason being that in animal models of DM, some insulin must be present or the animal will die from ketoacidosis. Conversely, hyperinsulinemic animals must have some glucose or they will die from hypoglycemia. Thus an animal model of either hyperglycemia or hyperinsulinemia alone is not available. However, an opportunity to extend the Hep G2 cell culture conditions to an in vivo model of both hyperglycemia and hyperinsulinemia, is possible. The fructose fed rat reflects a model of combined hyperglycemia and hyperinsulinemia. Increased levels of hepatic apoA-I protein and mRNA in these animals parallel closely the observed effects of glucose and insulin in vitro on Hep G2 cells. These results demonstrate clearly that the combined effects of glucose and insulin in both in vivo and in vitro are the same.
In summary, the results in this study show that glucose inhibits and insulin stimulates the expression of the endogenous apoA-I mRNA in human Hep G2 cells. The opposite effects of these metabolic parameters on mRNA levels arises from their actions on transcriptional activity of the apoA-I promoter in these cells. Although the actions of glucose and insulin are mediated by the same DNA fragment, we only identified one motif that matches a previously described IRCE and none that resembles any of the known carbohydrate response elements. The nuclear proteins from Hep G2 cells that bind to the cis-acting site which mediate the effects of glucose and insulin increased following exposure to insulin but not glucose. The ability of insulin to enhance apoA-I gene expression reinforces the recommendation for tight glycemic control to reduce the risk of atherosclerotic disease in diabetic patients.
| |
FOOTNOTES |
|---|
* Funding for this project was provided by the Medical Research Council of Canada (MRC) and the Heart and Stroke Foundation of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Present address: First Department of Internal Medicine, Kagawa Medical School, Kita-Gun, Miki-Cho, Kagawa, 1750-1, Japan.
Recipient of Scientist awards from the Alberta Heritage
Foundation for Medical Research and the MRC. To whom correspondence and
requests for reprints should be addressed: Endocrine Research Group,
Depts. of Medicine and Medical Biochemistry, Faculty of Medicine,
University of Calgary, Health Sciences Center, 3330 Hospital Dr.,
N. W., Calgary, Alberta T2N 4N1, Canada. Tel.: 403-220-5212; Fax:
403-270-0979; E-mail: ncwwong{at}acs.ucalgary.ca.
1 The abbreviations used are: apoA-I, apolipoprotein A-I; IRCE, insulin response core element; DM, diabetes mellitus; bp base pair; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K Murao, H Imachi, X Yu, W M Cao, T Nishiuchi, K Chen, J Li, R A M Ahmed, N C W Wong, and T Ishida Interferon {alpha} decreases expression of human scavenger receptor class BI, a possible HCV receptor in hepatocytes Gut, May 1, 2008; 57(5): 664 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Murao, X. Yu, H. Imachi, W. M. Cao, K. Chen, K. Matsumoto, T. Nishiuchi, N. C. W. Wong, and T. Ishida Hyperglycemia suppresses hepatic scavenger receptor class B type I expression Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E78 - E87. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Grenier, F. S. Maupas, J.-F. Beaulieu, E. Seidman, E. Delvin, A. Sane, E. Tremblay, C. Garofalo, and E. Levy Effect of retinoic acid on cell proliferation and differentiation as well as on lipid synthesis, lipoprotein secretion, and apolipoprotein biogenesis Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1178 - G1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yoshida, K. Murao, H. Imachi, W. M. Cao, X. Yu, J. Li, R. A. M. Ahmed, N. Kitanaka, N. C. W. Wong, T. G. Unterman, et al. Pancreatic Glucokinase Is Activated by Insulin-Like Growth Factor-I Endocrinology, June 1, 2007; 148(6): 2904 - 2913. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-L. Zheng and N. C W Wong Cyclosporin A inhibits apolipoprotein AI gene expression. J. Mol. Endocrinol., October 1, 2006; 37(2): 367 - 373. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Mooradian, M. J. Haas, and N. C. W. Wong The Effect of Select Nutrients on Serum High-Density Lipoprotein Cholesterol and Apolipoprotein A-I Levels Endocr. Rev., February 1, 2006; 27(1): 2 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nowak, A. Helleboid-Chapman, H. Jakel, G. Martin, D. Duran-Sandoval, B. Staels, E. M. Rubin, L. A. Pennacchio, M.-R. Taskinen, J. Fruchart-Najib, et al. Insulin-Mediated Down-Regulation of Apolipoprotein A5 Gene Expression through the Phosphatidylinositol 3-Kinase Pathway: Role of Upstream Stimulatory Factor Mol. Cell. Biol., February 15, 2005; 25(4): 1537 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Abe, K. Murao, H. Imachi, W. M. Cao, X. Yu, K. Yoshida, N. C. W. Wong, M. A. Shupnik, J.-A. Haefliger, G. Waeber, et al. Thyrotropin-Releasing Hormone-Stimulated Thyrotropin Expression Involves Islet-Brain-1/c-Jun N-Terminal Kinase Interacting Protein-1 Endocrinology, December 1, 2004; 145(12): 5623 - 5628. [Abstract] [Full Text] [PDF] |
||||