![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 30, 19260-19268, July 24, 1998
§ and
¶
From the The mammalian transcription factor LSF
(also known as CP2 and LBP-1c) binds as a homo-oligomer to directly
repeated elements in viral and cellular promoters. LSF and the
Drosophila transcription factor NTF-1 (also known as Elf-1
and Grainyhead) share a similar DNA binding region, which is unlike any
established DNA binding motifs. However, we demonstrate that dimeric
NTF-1 can bind an LSF half-site, whereas LSF cannot. To characterize
further the DNA binding and oligomerization characteristics of LSF,
truncation mutants were used to demonstrate that between 234 and 320 amino acids of LSF are required for high affinity DNA binding. Mixing of a truncation mutant with full-length LSF in a DNA binding assay established that the form of LSF that binds DNA is larger than a dimer.
Unexpectedly, one C-terminal deletion derivative, partially defective
in oligomerization properties, could occupy odd numbers of adjacent,
tandem LSF half-sites, unlike full-length LSF. The numbers of
DNA-protein complexes formed on multiple half-sites with this mutant
indicated that LSF binds DNA as a tetramer, although cross-linking
experiments confirmed a previous report concluding that LSF is
primarily dimeric in solution. The DNA binding and oligomerization
properties of LSF support models depicting novel mechanisms to prevent
continual, adjacent binding by a protein that recognizes directly
repeated DNA sequences.
One target for modulating transcription in eukaryotic cells is the
specific DNA binding activity of transcription factors. DNA binding
activity of a protein can be regulated by post-translational modification, such as phosphorylation, or by formation of
heteromeric complexes. Mapping DNA binding regions and
identifying oligomerization states can establish the basis for defining
biological regulatory pathways. Proteins displaying previously
unestablished strategies for formation of oligomeric protein-DNA
complexes may also elucidate novel regulatory mechanisms.
The known structures of complexes between specific DNA sequences and
the DNA binding motifs of several transcription factors have provided
general models for how proteins specifically interact with DNA. Many
DNA-binding proteins employ an Oligomerization of sequence-specific transcription factors often
contributes to the stability of protein-DNA interactions and is
therefore required to obtain protein-DNA complexes. Dimerization is
critical for many transcription factors, often mediated by Despite the variety of known DNA recognition strategies, the mammalian
transcription factor LSF presents novel DNA binding characteristics.
LSF DNA binding activity is cell growth-regulated and can be modulated
by phosphorylation (22). LSF, also known as CP2 (23), UBP-1 (24), and
LBP-1c (25), binds to a pair of directly repeated sequences (25-27)
whose intervening spacing is restricted such that LSF binds on a single
face of the DNA helix (26). LSF recognizes many viral and cellular
promoter sequences as a homo-oligomeric protein: simian virus 40 late
promoter (26), murine Plasmid Construction--
Plasmids are derivatives of the
expression clone pET-LSF (35), which contains the entire LSF coding
sequence in a modified pET-11c (Novagen) vector. Except as described
below, constructs encoding N-terminal and C-terminal deletion mutants
resulted from exonuclease digestion of pET-LSF beginning at appropriate
restriction sites. Oligonucleotides were ligated to the 5' deletions,
as necessary, to maintain the proper reading frame for translation.
pET-LSF Oligonucleotides--
The following oligonucleotides were
used in the electrophoretic mobility shift assays
(EMSA).3 LSF-280 (26), 5'
GATCCAGCTGGTTCTTTCCGCCTCA 3' and 3' GTCGACCAAGAAAGGCGGAGTCTAG 5';
consensus, 5' CTAGCCATATGGCTGGTTATGGCTGGTCAGA 3'
and 3' GGTATACCGACCAATACCGACCAGTCTCTAG 5'; mutant consensus 5'
CTAGCCATATGTATGTTTATGTATGTTCAGA
3' and 3'
GGTATACATACAAATACATACAAGTCTCTAG 5'; 1/2 consensus 5'
CTAGCCATATGGCTGGTTATGTATGTTCAGA 3'; and 3' GGTATACCGACCAATACATACAAGTCTCTAG 5'
underlined nucleotides represent base changes from the consensus
oligonucleotide); UBX (31), 5' GATCAAACAATCTGGTTTTGAGCGTTA
3' and 3' TTTGTTAGACCAAAACTCGCAATCTAG 5'; 3×, 5'
GATCGTACTGGGTCTCTCTGGTTAGAGCTGGTTAG 3'
and 3' CATGACCCAGAGAGACCAATCTCGACCAATCCTAG 5'; 4×, 5'
GATCGTACTGGGTCTCTCTGGTTAGAGCTGGGTCTCTCTGGTTAG 3' and 3' CATGACCCAGAGAGACCAATCTCGACCCAGAGAGACCAATCCTAG 5'. (3× and 4× are modified from the HIV-1 promoter In Vitro Transcription-Translation Reactions--
Proteins were
synthesized in reticulocyte lysate with the coupled
transcription-translation system from Promega according to
manufacturer's instructions, using [35S]methionine. This
system produces LSF at approximately 0.2 to 0.5 ng/µl; LSF
derivatives are produced at similar levels.
Electrophoretic Mobility Shift Assays--
2 µl of protein
from the in vitro transcription-translation reactions was
added to a buffer that contained 10 mM Tris-HCl (pH 8.0),
10% glycerol, 2% polyvinyl alcohol, 0.1 mM EDTA, 100 mM KCl, 1 mM dithiothreitol, and 5 µg/ml
poly[d(I-C)·d(I-C)] in the final reaction volume of 20 µl. The
protein was incubated without the labeled DNA for 15 min, when
reactions were performed at room temperature, or 30 min, when reactions
were performed at 4 °C, to permit nonspecific DNA-binding proteins
to be absorbed to the poly[d(I-C)·d(I-C)]. 15 fmol of labeled DNA
was added, and the mixture was incubated for an additional 15 min (at
room temperature) or 30 min (at 4 °C) prior to electrophoresis
through a 5% polyacrylamide gel containing 44.5 mM Tris
base, 44.5 mM boric acid, and 1 mM EDTA. Dried
gels were analyzed with a Molecular Dynamics model 400E PhosphorImager
and ImageQuant software.
Protein Cross-linking--
1 µl of in vitro
translated protein was incubated with the water-soluble
homo-bifunctional cross-linker bis(sulfosuccinimidyl) suberate
(BS3), which has a spacer arm length of 11.4 Å and
primarily reacts with the GST-LSF Oligomerization Assays--
Assays were performed as
described (35). Briefly, glutathione-Sepharose beads containing
approximately 1 µg of glutathione S-transferase (GST)-LSF were
incubated with 2 µl of in vitro translated proteins for
1 h at room temperature. The beads were washed four times in a
buffer containing 500 mM NaCl. An equal volume of 2× SDS
sample buffer was added, and samples were incubated at 100 °C to
release the bound proteins. Bound proteins were then separated by
SDS-polyacrylamide gel electrophoresis. Radiolabeled proteins were
visualized and quantitated using the PhosphorImager as described above.
Dimeric NTF-1 Stably Interacts with an LSF DNA-binding
Half-site--
LSF (CP2; LBP-1c) and its closely related mammalian
family member LBP-1a/b (25) are similar to only one other protein in the data base, the Drosophila transcription factor NTF-1
(Elf-1; product of the Grainyhead gene). Fig. 2D
illustrates the regions of similarity, with the shaded box
reflecting the 25% identity in sequence across 427 amino acids
(residues 65-502 of LSF and residues 631-1058 of NTF-1) and the
solid boxes reflecting short regions of 66-79% identity.
The Drosophila protein is dimeric both in solution, as shown
by cross-linking analysis, and when bound to DNA, as shown by EMSA of
DNA-protein complexes formed from mixtures of differently sized NTF-1
derivatives (33, 34). To determine whether the primary amino acid
similarity between LSF and NTF-1 reflected identical modes of binding
DNA, we tested whether NTF-1 would bind an LSF site and, vice versa,
whether LSF would bind an NTF-1 site. The high affinity LSF sites
tested included LSF-280 DNA, containing a site from the late SV40
promoter region (26), and a consensus LSF DNA-binding site, consisting of direct repeats of the half-site (G/A)CTGG separated by five base
pairs (25, 27). The NTF-1 site was derived from the UBX promoter (34).
LSF and NTF-1 proteins were translated in vitro, incubated
with oligonucleotides containing wild type or mutated LSF or
NTF-1-binding sites, and analyzed by EMSA (Fig.
1). Although NTF-1 bound to both the
LSF-280 site and the LSF consensus sequence (Fig. 1, lanes 6 and 7), LSF did not form a complex with the NTF-1-binding site (lane 5). The slower mobility of the NTF-1 dimer
complex relative to the LSF-DNA complex partially reflects the greater molecular weight of the 1063-amino acid NTF-1 protein, as well as
potential differences in the shapes of the proteins migrating through a
native polyacrylamide gel.
Department of Microbiology and Molecular
Genetics,
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-helix for specifically contacting
bases in DNA (for review, see Ref. 1). An alternate mode of DNA
recognition, exemplified by three prokaryotic repressors, is
accomplished by a pair of anti-parallel
-sheets (2-4). Finally, NF-
B specifically contacts DNA by a series of peptide loops (5, 6).
Therefore, DNA-binding proteins employ many strategies to specifically
recognize their binding sites.
-helical
structures (7-15) or
-strands (5, 6, 16-18). Trimerization has only been observed for the heat shock transcription factor (19).
Finally, some transcription factors are tetrameric, with a variety of
types of interactions forming the interface (2, 3, 20, 21). Alteration
of oligomerization surfaces, or of DNA recognition surfaces, can lead
to regulation of the activity of a transcription factor in the
cell.
-globin promoter (23), human immunodeficiency virus-1 long terminal repeat (24, 25, 28, 29), rat
-fibrinogen promoter (27), major histocompatibility complex class II Ea and Dra
promoters (30), human
c-FOS,1 and mouse
thymidylate synthase.2 The
primary amino acid sequence of LSF is not similar to any established
DNA binding or oligomerization motifs, although LSF shows a high degree
of similarity to the Drosophila transcription factor NTF-1
(31), also known as Elf-1 (32) or Grainyhead (33), which binds DNA as a
dimer (33, 34). Several groups (25, 33, 35, 36), including our own,
have presented data that LSF also binds DNA as a dimer. However, during
further investigations of the DNA binding and oligomerization
properties of LSF and NTF-1, we have shown that the oligomerization
states of LSF and NTF-1 differ. Our new data are also inconsistent with
the stable DNA-binding moiety of LSF being a dimer. Instead, these data
indicate that LSF binds to DNA as a tetramer, even though in solution
it is primarily a dimer. Because there are no known structures for
tetramers binding to direct repeats and because LSF does not resemble
known DNA binding motifs, LSF may represent a new class of DNA binding transcription factors.
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
24 was described previously (35). pET-LSF
164 was
constructed by digesting pET-LSF with NheI and
AvrII and religating the compatible cohesive ends of the
larger fragment, containing both vector and LSF sequences.
pET-LSF
266, pET-LSF
397, and pET-LSF
266-396
were obtained
by polymerase chain reaction amplification of the relevant LSF
sequences and ligation into a pET-LSF vector that had been
digested with appropriate enzymes (gifts of Q. Zhu). Sequences were
verified by chain-termination sequencing (Sequenase; U. S. Biochemical
Corp). Fig. 2D shows the additional encoded amino acid
sequences in some of the resulting LSF derivatives, at either the N- or
C- terminus. Complete plasmid DNA sequences and maps are available upon
request.
6 to +15, see Ref. 25.) Each pair of oligonucleotides was annealed and labeled with
polynucleotide kinase and [
-32P]ATP for use in EMSA,
as described below.
-amine of lysine (Pierce). Cross-linking
was performed in a 20-µl total reaction volume containing
phosphate-buffered saline (137 mM NaCl, 2.7 mM
KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4). Reactions were stopped
by the addition of 20 µl of 2× SDS sample buffer (37) and incubated
at 100 °C for 5 min before analysis by SDS-polyacrylamide gel
electrophoresis through 7% acrylamide gels.
![]()
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

View larger version (52K):
[in a new window]
Fig. 1.
NTF-1 recognizes an LSF half-site. EMSA
were performed using in vitro translated LSF (lanes
1-5) or NTF-1 (lanes 6-10) and the following
oligonucleotides: LSF-280 (280, lanes 1 and
6), consensus (Cons., lanes 2 and
7), mutant consensus (Mut.Cons., lanes 3 and
8), 1/2 consensus (1/2 Cons., lanes 4 and
9) and UBX (lanes 5 and
10). The sequences of the oligonucleotides are presented
under "Experimental Procedures." FP indicates the
migration of the unbound oligonucleotides; NS indicates a
nonspecific protein-DNA complex formed by a protein endogenous to the
rabbit reticulocyte lysate; LSF indicates the LSF-DNA
complex; and NTF-1 indicates the NTF-1-DNA complex. Note
that in the reactions containing in vitro translated NTF-1
with wild type LSF-binding sites (lanes 6 and 7),
a faint DNA-protein complex comigrating with LSF-DNA complexes is
detected, due to endogenous LSF in the reticulocyte lysate.
A Large Portion of LSF Is Required for Stable, Specific Interaction
with DNA--
LSF and NTF-1 are not structurally similar to any known
DNA binding motifs. The region of NTF-1 required to bind DNA has
previously been mapped to a minimal region from residues 778 to 837, with optimal DNA binding encompassing residues 632 to 948 or greater (33, 34). However, the differences in DNA-binding site recognition between LSF and NTF-1, as well as the unusual requirements for DNA
recognition by LSF, a pair of stringently spaced direct repeats, prompted us to map separately the region of LSF necessary for DNA-protein complex formation. To determine the N- and C-terminal boundaries of the DNA binding region, a series of truncation mutants of
LSF were translated in vitro in rabbit reticulocyte lysates. The proteins, which were all expressed at equivalent levels (data not
shown), were incubated with the LSF-280 site, and protein-DNA complexes
were analyzed by EMSA (Fig. 2). LSF
derivatives lacking 24 or 64 N-terminal amino acids reproducibly
retained DNA binding activity to the LSF-280 site (Fig. 2A, lanes
2 and 3). However, truncations of 144 amino acids or
more from the N terminus consistently abolished binding (lanes
4-9). Furthermore, whereas an LSF-DNA complex was observed with a
C-terminal deletion of LSF lacking 54 amino acids, LSF448
(Fig.
2B, lane 2), deletions of 99 amino acids or more from the C
terminus eliminated DNA binding activity at room temperature
(lanes 3-11). Notably, the amount of DNA-protein complex
formed even by LSF448
was substantially diminished, being 5-10-fold
lower than that formed by LSF. Unexpectedly, one C-terminal deletion
mutant, LSF383
, was capable of binding DNA at 4 °C (Fig. 2C, lane 4) although it was unable to bind DNA at room
temperature (Fig. 2B, lane 4). However, incubation at
4 °C did not uncover DNA binding activity of any other LSF
derivatives that were inactive at room temperature (Fig. 2C,
lanes 3, 5, and 6 and data not shown). Finally, two
internal deletion mutants, LSF-ID (LSF188
240) and RT-LSF
(LSF305
385), also lacked DNA binding activity (25, 33, 35, 36; data
not shown). Results of EMSA, summarized in Fig. 2D, demonstrate that a remarkably large portion of LSF, roughly 64% (encompassing amino acid residues 64-383), is required for even minimal binding of LSF to DNA. This is a somewhat larger region, particularly at the C terminus, than that required for DNA binding of
NTF-1 (33), which maps to amino acid residues 632-865 (homologous to
residues 67 to approximately 291 of LSF). A second major distinction between LSF and NTF-1 in such mapping experiments is that whereas the
minimal DNA binding region of NTF-1 can form both monomeric and dimeric
interactions with DNA (33), no LSF truncation derivatives generated
faster migrating protein-DNA species. We infer that the interactions
between monomeric LSF and DNA are not sufficient to produce a stable
protein-DNA complex. Therefore, oligomerization must be critical for
LSF-DNA complex formation.
|
LSF Binds DNA as a Homotetramer--
From several previous
studies, it was concluded that LSF binds DNA as a dimer (25, 33, 35,
36) (these previous reports are analyzed in more detail under
"Discussion"). However, the different DNA-binding site
specificities of LSF and NTF-1, together with definitive results that
NTF-1 binds DNA as a dimer (33, 34), indicated that a more critical
examination of the oligomerization state of LSF on DNA was warranted.
In particular, because NTF-1 binds a single LSF half-site as a dimer,
it seemed doubtful that the similar DNA binding region of LSF would
bind two half-sites, the normal LSF recognition sequence, also as a
dimer. We first examined the oligomerization state of LSF on DNA by
mixing two DNA binding competent LSF derivatives of different sizes and
analyzing the electrophoretic mobility of the heteromeric protein-DNA
complexes (38). Unfortunately, GST-LSF fusion proteins are
heterogeneous in size when isolated from bacteria (data not shown), and
mixtures of LSF and GST-LSF form too many DNA-protein complexes to
determine accurately the multimeric state of the protein on the DNA
(36). Therefore, this experiment necessitated use of LSF deletion
mutants. Although little of LSF is dispensable for its DNA binding
activity (Fig. 2), this experiment was deemed feasible due to slightly differing mobilities of the complexes of LSF
64 and LSF with DNA. If
LSF did bind DNA as a dimer, mixing LSF and LSF
64, which each form a
single, distinct complex with the LSF-280 DNA (Fig.
3A, lanes 1 and 2),
should generate only one heterodimeric complex with intermediate
mobility in addition to the two homodimers. Instead, at least two
heteromers were revealed (lane 3). The limits of resolution
on the polyacrylamide gel of the closely migrating heteromeric
complexes prevented an unequivocal determination of the oligomerization
state. Nonetheless, this result proved that the LSF oligomer that binds
DNA is larger than a dimer. We note that homo-oligomers of LSF and
LSF
64 were not readily detected in the mixing experiment, which is
expected if the DNA binding moiety contains more than two subunits but
not if it is dimeric. If LSF bound DNA as a trimer or tetramer and both
LSF derivatives bound DNA with the same affinity, each of the
homo-oligomers would be represented by one-eighth or one-sixteenth of
the total number of LSF-DNA complexes, respectively. In contrast, for a
dimer, one-fourth of the protein-DNA complexes would be represented by each homodimer. This is certainly not the case for LSF.
|
(Fig. 2). In studies to determine whether LSF bound in a
head-to-tail fashion to the directly repeated half-site recognition
sequences, we compared the binding of LSF to DNAs containing two,
three, or four adjacent, tandem copies of the LSF half-site. Incubation
of LSF with LSF-280 DNA (two half-sites, with a similar overall binding
affinity as the two-half-site LSF consensus DNA, see Fig. 1) and 3×
DNA (containing three half-sites) produced complexes of similar
mobilities (Fig. 3B, lanes 1 and 2; the complex
to the longer 3× site migrating slightly slower). Incubation with 4×
DNA (containing four tandem half-sites) produced two complexes
(lanes 3, asterisks). The faster migrating of the two
LSF-4× DNA complexes essentially comigrated with the LSF-3× DNA
complex. Similar complexes were obtained upon binding of LSF
24 or
LSF
64 to this set of DNAs (data not shown). These data indicate that
LSF binds a complete recognition site but cannot efficiently add by
contiguous half-site units in a head-to-tail fashion along the DNA.
Unexpectedly, LSF448
bound in a distinct and unusual manner to the
three- and four-half-site DNAs. Although LSF448
bound the
two-half-site DNA as a single complex (compare lanes 1 and 7), it was unlike LSF in its capacity to generate two
additional, detectable complexes of slower mobility on the 3× DNA
(lane 8, see bullets). This indicates that
LSF448
, which is partially defective in LSF-LSF oligomerization (see
Fig. 5), can bind to DNA in a tandem fashion. On 4× DNA, LSF448
formed five distinguishable complexes (Fig. 3B, lane 9, bullets), three of which were efficiently produced. Even the
remaining two complexes were discrete, however, and could therefore not
be due to dissociation of slower complexes during electrophoresis, as
this would generate smears but not specific bands. The largest and
smallest LSF448
complexes migrated just slightly faster than the two
similar complexes containing LSF (lane 3, asterisks), due to
the smaller size of LSF448
. All of the indicated complexes between
LSF448
and 3× or 4× DNA were specifically apparent only in the
presence of the mutant LSF protein, as shown by control reactions
containing unprogrammed reticulocyte lysate, exposed at the same level
of sensitivity of the autoradiogram. The faint bands in this region of
the gel (lanes 4-6) that comigrated with LSF-DNA complexes
are attributable to the endogenous LSF in the lysate. Additionally, the
protein-DNA complexes specific to LSF448
experiments could not be
attributed to contaminating protein species, because the in
vitro translated LSF448
was homogeneous, migrating as a single,
distinct protein upon SDS-polyacrylamide gel electrophoresis (data not
shown). Therefore, the three new LSF448
-4× DNA complexes with
intermediate mobilities can only be interpreted to represent the
addition of one, two, or three monomeric units onto the normal
LSF448
oligomer associated with two half-sites. Only the binding of
a tetramer to a normal LSF-binding site (or a multiple of
tetramers) would be consistent with the electrophoretic mobilities
of these complexes (see schematic, Fig. 3B). By
analogy, the LSF-4× DNA species are tetrameric and octameric
complexes, as well. Significantly, like LSF, LSF448
did not form any
protein-DNA complexes that migrated significantly faster than the
complex of LSF with LSF-280 (Fig. 3B, lane 9; data not
shown), confirming that the minimal protein-DNA interaction required
for a stable complex, even for LSF448
, is a tetramer.
LSF Oligomerization State in Solution-- By sedimentation analyses, LSF (CP2) formed dimers in solution (36). However, because it was unclear in this report whether any LSF was recovered as higher order forms (tetramers or higher) at the bottom of these gradients, we performed in vitro protein-protein cross-linking experiments to assess the higher order oligomerization states of LSF in solution. In vitro translated proteins were incubated with the chemical cross-linker BS3, and the reaction products were analyzed by SDS-polyacrylamide gel electrophoresis (Fig. 4). Multimers of LSF were assigned based on the apparent molecular weights, as compared with protein standards (see legend to Fig. 4), with the expectation that cross-linked species would migrate slower than their actual molecular mass, due to their branched structures. Tetramers of LSF were clearly apparent by this analysis (Fig. 4A, lane 5; Fig. 4B, lane 4; labeled Tet), although primarily dimers were detected at lower cross-linker concentrations (Fig. 4A, lane 2) or shorter time points (Fig. 4B, lane 2). To confirm that these cross-linked products were not solely the result of random collisions, a reaction was performed in a 5-fold higher volume. The same pattern of cross-linked products was obtained, suggesting that the formation of dimers, trimers, and tetramers was not concentration-dependent (data not shown). That the cross-linked products from these crude extracts are homomultimers of LSF was supported by several additional observations. First, cross-linked species of histidine-tagged LSF, purified from bacteria, comigrated with the species obtained with in vitro translated LSF. Second, the cross-linked products of N- and C-terminal deletion mutants of LSF migrated as predicted from their reduced molecular weights. The specificity of the cross-linking reactions was established by the inability of more extensive N- and C-terminal deletion mutants of LSF to form any cross-linked products under identical conditions (see summary in Fig. 2D).
|
Mapping Regions of LSF Involved in Oligomerization-- Due to the higher oligomerization state of LSF on DNA, as compared with NTF-1, we sought to determine whether a new region of oligomerization could be localized for LSF. The boundaries of the region(s) involved in oligomeric protein-protein interactions were determined by two approaches. First, deletion mutants of LSF were incubated with chemical cross-linkers to form homo-oligomeric products (data not shown). These experiments were performed for 30 min at room temperature, in order to maximize the detection of oligomers. As summarized in Fig. 2D, this assay mapped the region of oligomerization in solution to between amino acids 210 and 403. For all mutants that produced cross-linked homo-oligomers, a similar set of multimeric species was obtained; thus we were unable to separate tetramerization and dimerization regions in these experiments.
Second, N- and C-terminal deletion mutants of LSF were tested for their ability to associate with high concentrations of GST-LSF in a heteromeric complex. Immobilized GST-LSF was incubated with in vitro translated proteins, followed by extensive washing of the resin with a high salt buffer. The amounts of bound, labeled LSF derivatives were subsequently quantitated, following SDS-polyacrylamide gel electrophoresis. Results from a representative experiment are shown in Fig. 5. LSF derivatives missing 24 or 64 amino acids from the N terminus reproducibly bound GST-LSF to approximately the same degree as LSF did, with 8-11% of input protein being stable to high salt washes in this experiment. Despite similar oligomerization potentials to that of wild type LSF, these two mutants were defective in their ability to bind DNA (Fig. 2A). The reduction in DNA binding activity in these mutants is probably due to unmasking of an inhibitory region of LSF upon removal of the extreme N-terminal sequences (33). N-terminal deletion mutants lacking between 144 and 266 amino acids also bound measurably to GST-LSF, although at a lower level, with approximately 2-6% of input protein remaining. Finally, a deletion to amino acid 397, LSF
397, no longer bound
GST-LSF (data not shown; see Fig. 2D for summary).
|
144, LSF
156,
and LSF
164 mutants, as contrasted with higher levels of binding for
more substantial N-terminal deletions, suggest that a region of the
protein between amino acids 165 and 210 inhibits normal LSF
oligomerization in the absence of the extreme N terminus. This
interpretation is consistent with DNA binding studies of deletion
mutants of NTF-1, where it was concluded that the homologous region of
NTF-1 inhibited DNA binding activity in the absence of more N-terminal
sequences (33). In summary, these data establish two regions in which
the degree of oligomerization diminishes, when LSF is truncated from
the N terminus, one between amino acids 64 and 210 and a second between
amino acids 266 and 397.
Two C-terminal deletion mutants of LSF, LSF448
and LSF403
,
associated with GST-LSF, but much less so than full-length protein, with only 2-4% of input protein bound in the presence of high salt
(Fig. 5). Little or no protein-protein interaction was detectable at
high salt by LSF derivatives with C-terminal deletions larger than 99 amino acids. However, upon washing at a lower salt concentration (100 mM), a low percentage of LSF383
, but not of larger
C-terminal deletions (e.g. LSF368
), was retained on the
GST-LSF resin (Fig. 2D). Therefore, C-terminal deletions
also mapped two steps at which oligomerization to GST-LSF was
diminished, between amino acids 502 and 403 and between amino acids 403 and 377.
The GST-LSF binding data are in general agreement with the mapping
results from chemical cross-linking experiments (Fig. 2D), with the cross-linking experiments (due to the protocol used) providing
a qualitative view of oligomerization, in establishing the absence or
presence of protein-protein interactions, and the GST-LSF experiments
providing relative efficiencies of oligomerization. Although GST
contains an intrinsic dimerization domain that can affect the ability
of fusion proteins to bind DNA (39), we think it is unlikely that the
GST moiety on the beads alters the oligomerization assays, because the
LSF test proteins that are translated in vitro are not
fusion proteins. The only apparent contradiction between the two types
of mapping experiments was in the ability of LSF
266 to oligomerize
(Fig. 2D). The region between amino acids 210 and 266 includes 10 lysine residues that are potential targets for the
cross-linker BS3. Thus, the apparent discrepancy between
the two types of data can readily be explained by postulating that the
absence of these lysines, rather than the lack of protein-protein
contacts, dramatically reduced the cross-linking potential of
LSF
266.
In summary, the results of the oligomerization experiments indicated
that a core oligomerization region maps between amino acids 266 and 403 of LSF (Fig. 6). Additional contributions
to oligomerization activity derive from sequences between amino acids 403 and 502, at the C terminus, and amino acids 64 and 210, at the N
terminus. The C-terminal region of LSF (amino acids 280-502) has also
been shown to interact with itself in a yeast two-hybrid system
(33).
|
| |
DISCUSSION |
|---|
|
|
|---|
Investigations into the DNA binding region and oligomerization
state of LSF were motivated by previous biochemical and biological findings as follows: 1) the LSF protein sequence cannot readily be
categorized into any of the known DNA binding structures; 2) the
consensus LSF DNA-binding site, consisting of strictly spaced direct
repeats, suggests an unusual mechanism of DNA recognition; 3) LSF DNA
binding activity is regulated both during cell growth stimulation (22)
and during the cell cycle2; and 4) as a heteromeric complex
with other protein(s), LSF can generate new DNA-binding site
specificities (40). Given that LSF is strikingly similar over a large
portion of the protein to the Drosophila NTF-1 and that the
DNA binding region and oligomerization state of NTF-1 were previously
characterized, we initially focused on a comparison of LSF with NTF-1.
Ordinarily, DNA-binding proteins that share a similar DNA recognition
motif bind similar DNA sequences and bind with the same oligomerization
state. However, our studies established that NTF-1 not only binds an
LSF site but also an LSF half-site and that LSF is unable to stably
interact with an NTF-1-binding site. Consistent with the requirement
for a larger DNA-binding site for LSF, mixing experiments established
that LSF, unlike dimeric NTF-1, is larger than a dimer on its site. Finally, serendipitous results with a C-terminal LSF truncation mutant,
LSF448
, indicated that LSF bound its DNA site as a tetramer. However, LSF is predominantly dimeric in solution, as revealed by
chemical cross-linking analysis. These and other data led to models of
novel DNA-protein interactions that would prevent tandem binding by LSF
subunits to adjacent, directly repeated half-sites. These data also are
critical for an understanding of the biological regulation of LSF
activities.
The DNA Binding Region of LSF Consists of Greater Than 230 Amino
Acids--
By analysis of truncation mutants, the N-terminal boundary
of the region of LSF that binds to DNA mapped between amino acids 64 and 144, which is in a similar region to the boundary of the DNA
binding region for NTF-1. However, the C-terminal boundary was more
extended beyond that for the similar protein region in NTF-1. Optimal
binding was only achieved with the entire C terminus. At room
temperature, the core C-terminal boundary mapped between amino acids
403 and 448 of LSF, although at 4 °C, a smaller LSF derivative,
LSF383
, bound DNA as well.
, which did not bind DNA at either temperature but was
apparently unchanged in its ability to oligomerize in solution (Fig.
2D). Therefore, we hypothesize that LSF403
generates an
altered, nonproductive structure that interferes with the DNA recognition motif of LSF; for example, it may form new protein-protein contacts in an individual subunit.
By using GST-LSF fusion proteins, the C-terminal boundary of the DNA
binding region of LSF has previously been mapped between amino acids
239 and 276 (33, 36), although the DNA binding activity of
GST-LSF276
(in our nomenclature) was severely reduced compared with
binding by the full-length protein. Mapping of LSF DNA binding activity
in the context of GST fusion proteins most likely corresponds to
mapping the true boundaries of the DNA interaction region of LSF,
because GST can dimerize (for example, see Refs. 39 and 41), thereby
stabilizing the protein-DNA interaction. In support of this
interpretation, we have observed binding by GST-LSF to DNA sites with
which histidine-tagged LSF will not detectably interact (data not
shown). The core DNA interaction region of LSF would therefore
correspond, as expected, to that of NTF-1, whose C-terminal boundary
maps to an amino acid analogous to LSF residue 273.
LSF Binds DNA as a Tetramer, Not as a Dimer--
By analyzing the
DNA-protein complexes from mixtures of LSF derivatives of different
sizes, and of one C-terminal deletion mutant to DNAs containing three
and four LSF half-sites, we concluded that LSF binds DNA as a tetramer.
As this conflicts with the conclusions of previous reports, we have
carefully reanalyzed those data as follows. 1) Our own previous
interpretation that LSF bound to DNA as a dimer was based on an
epitope-counting method, using an antibody to supershift complexes
examined by EMSA (35). Only two supershifted complexes were resolved
when LSF and LSF
24 mixtures were incubated with an antipeptide
antibody that recognized LSF but not LSF
24. We cautiously noted at
the time that although the simplest interpretation of these data was
that LSF was dimeric, they would also be consistent with a tetrameric
interaction, if the antibody required two epitopes to supershift the
protein-DNA complexes, instead of only one epitope. 2) Yoon et
al. (25) analyzed mixtures of LSF (LBP-1) proteins of different
sizes by EMSA and determined that complexes of intermediate mobility
appeared, again offering the simplest interpretation that LSF was
dimeric. However, the complexes were not sufficiently resolved to
determine the number of heteromers and therefore the exact
oligomerization state. 3) Zhong et al. (36) demonstrated
that a dimer of the bacterially produced LSF (CP2), isolated by
glycerol gradient sedimentation, could bind DNA. However, dimers formed
in solution could clearly form tetramers upon interacting with DNA,
again consistent with our current interpretation. Multimeric complexes of GST-LSF and LSF were also examined by EMSA, with insufficient resolution of the numbers of complexes to be conclusive, especially given that multiple complexes were formed between GST-LSF alone and
DNA. 4) Uv et al. (33) mapped the dimerization domain of NTF-1 (Grainyhead) to its C terminus and suggested that, by homology, this region would be involved in dimerization of LSF (CP2). By using
the yeast two-hybrid system, either LSF or LSF
280 (in our nomenclature), could interact with itself (33). However, this assay
only measures the ability of a protein to oligomerize and does not
directly address the oligomerization state. Therefore, although the
simplest interpretation of all these experiments was that LSF bound DNA
as a dimer, none of them were definitive enough to contradict our
current interpretation that LSF binds a pair of direct repeats as a
tetramer.
LSF and NTF-1 Differ in Their Oligomerization Requirements
for DNA Binding Activity--
Although LSF and NTF-1 share a striking
66% similarity over 445 amino acids (per the FASTA program on the EMBL
server), these two proteins differ in their oligomerization state on
DNA and, in parallel, in the structure of their respective DNA-binding sites. Our results suggest that the similarity between the proteins reflects a similarity in recognition of the consensus sequence CTGG
half-site. In particular, the region of highest similarity between LSF
and NTF-1, amino acids 235-246 of LSF, has been predicted to form an
-helix that recognizes DNA, based on a comparison with
DNA-recognition helices found in crystal structures of several transcription factors (42). In support of this prediction, double amino
acid substitutions at residues conserved between LSF and NTF-1, either
at positions 234 and 236 (LSF234QL/236KE) or at positions 233 and
235, abolished LSF DNA binding activity (35, 43).
The C Terminus of LSF Prevents Tandem Binding-- Based on the data we have obtained, several models can be postulated for how tetrameric LSF binds directly repeated half-sites (Fig. 7). Because of the similarities between LSF and NTF-1, binding to DNA most likely involves recognition of an LSF half-site by a protein dimer. The two dimers of LSF could be situated either symmetrically, as diagrammed in B, or asymmetrically, as diagrammed in C. A critical element in these models is that the binding by a pair of dimers on the same face of DNA to directly repeated half-sites requires that the protein has some mechanism to prevent repetitive oligomerization along the DNA. Repetitive oligomerization would be a potential problem when oligomerization regions are positioned in the same orientation (B and C). Repetitive oligomerization is clearly restricted for LSF, because LSF does not form a stable hexamer on DNA containing three half-sites (Fig. 3B).
|
-helix (44, 45). This model predicts that the protein-protein
interactions between LSF448
dimers, which lack these potential
-helices, would be reduced, allowing at least one monomer to be less
constrained and available to interact with protein subunits on adjacent
half-sites (Fig. 7A).
A second method of preventing continual, tandem binding of LSF monomers
or dimers would be to spatially prevent the exposed oligomerization
regions from further association (Fig. 7B). This model
builds upon the interactions found in the crystal structure of Arc
repressor and is dependent on the protein-mediated bending of DNA (3).
Tetrameric interactions in Arc are mediated by loop structures derived
from one monomer of each of the antiparallel dimers that recognizes the
half-site. A generalized model for LSF is diagrammed in Fig.
7B. LSF-LSF interactions would bend the DNA site to maximize
the energetically favorable protein-DNA interactions. In the
illustrated version of this model, the protein-protein interactions
would produce a conformational change in LSF (as depicted by the
pointed half-oval) but not in LSF448
. Alternatively, the
C terminus of LSF could participate by forming additional, stabilizing
protein-protein interactions, which would be missing in LSF448
. In
either case, binding by LSF448
would not bend the DNA and would no
longer restrict the outward oligomerization regions from forming
contacts with additional LSF448
molecules binding to DNA at adjacent
half-sites. This model is intriguing since LSF apparently bends DNA
when bound to the LSF-280
site,4 although whether
LSF448
bends DNA remains to be determined.
Finally, a third possibility is that the C terminus of LSF promotes
capping, such that formation of a tetramer promotes a conformational
change in the overall protein structure so that the "free"
tetrameric interface is not accessible for further oligomerization.
This capping function would be absent in LSF448
, thereby permitting
further oligomerization.
No structures of tetrameric proteins binding to directly repeated DNA
sequences have yet been solved. LSF therefore represents a novel DNA
binding and oligomerization strategy. The requirement for multiple
protein-protein and protein-DNA interactions explains why the region of
LSF that is necessary to form a stable protein-DNA complex is so
large.
Biological Rationale for Tetrameric DNA Binding Transcription Factors-- The requisite formation of tetramers of LSF for generation of stable protein-DNA complexes opens the door for regulation of DNA binding activity at a variety of steps. For example, phosphorylation, which is known to enhance the DNA binding activity of LSF (22), might modulate DNA recognition, oligomerization, or both. In addition, given that LSF is not stable in solution as a tetramer, but as a dimer, regulation of the interactions between LSF and other partner proteins could prevent tetrameric LSF DNA binding and/or allow recognition of new DNA-binding sites. Examples of complexes containing LSF with other partner proteins are emerging (25, 40, 46, 47), some of which define new DNA site specificities. Whether the tissue-specific complexes between LSF and partner proteins use similar oligomerization and DNA-binding interfaces to those of LSF remains an open question, which can be addressed with the methodologies and reagents we have presented here.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Laura Attardi and Robert Tjian for
the NTF-1 expression vector and UBX oligonucleotides; Quan Zhu for
plasmid constructs pET-
266, pET-
266-396, and pET-
397 and for
design of consensus and mutant consensus oligonucleotides; and
Christina Powell, Elise Drouin, Thomas Ellenberger, Robert
Kingston, and Robert Sauer for critically reading the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by grants from the Public Health Service, National Cancer Institute Grant CA38038, and from the Sandoz/DFCI Drug Discovery Program (to U. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported in part by Training Grant T32 CA09361 from the National Institutes of Health. Present address: Dept. of Biological Sciences, University of Pittsburgh, Pittsburgh, PA 15260.
To whom correspondence should be addressed. Present address:
Dept. of Biology, Boston University, 5 Cummington St., Boston, MA
02215. Tel.: 617-353-8730; Fax: 617-353-8734; E-mail: uhansen{at}bio.bu.edu.
1 R. Misra, H.-C. Huang, M. E. Greenberg, and U. Hansen, unpublished data.
2 C. M. H. Powell, J. L. Volker, L. F. Johnson, and U. Hansen, submitted for publication.
3 The abbreviations used are: EMSA, electrophoretic mobility shift assay; BS3, bis(sulfosuccinimidyl) suberate; GST, glutathione S-transferase.
4 V. Bajaj and U. Hansen, unpublished data.
| |
REFERENCES |
|---|
|
|
|---|