J Biol Chem, Vol. 273, Issue 31, 19729-19739, July 31, 1998
Targeting Holliday Junctions by the RecG Branch Migration Protein
of Escherichia coli*
Matthew C.
Whitby
§ and
Robert G.
Lloyd¶
From the
Microbiology Unit, Department of
Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU,
United Kingdom and the ¶ Department of Genetics, University of
Nottingham, Queens Medical Center,
Nottingham NG7 2UH, United Kingdom
 |
ABSTRACT |
The RecG protein of Escherichia coli
is a junction-specific DNA helicase that drives branch migration of
Holliday intermediates in genetic recombination and DNA repair. The
reaction was investigated using synthetic X-junctions. RecG dissociates
X-junctions to flayed duplex products, although DNA unwinding of the
heterologous arms is limited to
30 base pairs. Junction unwinding
requires Mg2+ and the hydrolysis of ATP. X-junction DNA
stimulates the ATPase activity of RecG. ATPase activity is also
stimulated by linear duplex DNA, although to a lesser extent than by
X-DNA, but not by linear single-stranded DNA. In situ
1,10-phenanthroline-copper footprinting shows that RecG binds to the
strand cross-over point at the center of the X-junction. Substrate
recognition by RecG was investigated using DNAs that represented the
various component parts of an X-junction. The minimal DNA structure
that RecG forms a stable complex with is a flayed duplex, suggesting
that this is the critical feature for junction recognition by RecG.
Junction binding and unwinding also depend critically on the
concentration of free Mg2+, excess free cation dramatically
inhibiting both processes. These inhibitory effects are not mediated
specifically by Mg2+; e.g. both
Ca2+ and hexamminecobalt(III) chloride also inhibit
X-junction binding and unwinding by RecG. The relative abilities of
these cations to inhibit RecG-junction binding is correlated with their
respective abilities to stack X-junction DNA. From this we conclude
that RecG is unable to bind or binds very poorly to fully stacked
X-junctions.
 |
INTRODUCTION |
General genetic recombination is a key process in biology that is
required for promoting genetic diversity, repairing damaged DNA, and
ensuring that chromosomes are correctly segregated at cell division. A
central feature of the reaction is a reciprocal exchange of single
strands between two DNA duplexes. Strand exchange creates a
heteroduplex joint within which Watson-Crick base pairing serves to
register homologous alignment and at the same time links the two
molecules together by a Holliday junction (1). Further unwinding and
rewinding of strands at this four-way symmetrical structure moves the
junction point along the DNA. This branch migration reaction is
isoenergetic (for every bond that is broken a new one is made) and
should occur spontaneously. However, recent studies have shown that the
rate of spontaneous movement is very slow under physiological
conditions (2-4). This is thought to reflect the way the junction
folds into a stacked X configuration in the presence of magnesium ions
(5). It is clear, therefore, that this stage of the recombination
reaction must be catalyzed.
In Escherichia coli, two enzymes, RuvAB and RecG, have been
shown to interact directly with Holliday junctions and to drive their
branch migration (6). The reaction catalyzed by RuvAB is reasonably
well understood. A tetramer of RuvA binds to the junction point and
holds the DNA in an open configuration that allows assembly of a
hexameric ring of RuvB around each of the diametrically opposed
homologous arms flanking the RuvA-junction complex (7, 8). The two
rings face each other across the junction, and in a reaction requiring
hydrolysis of ATP, each ring rotates the bound DNA and draws it through
the hollow core of the RuvB assembly. This novel reaction unwinds a
strand from each of the unbound arms and winds them together to pass
through the RuvB ring. As each arm is rotated, the net effect of this specialized helicase activity is to move the junction point along the
DNA.
How RecG interfaces with Holliday junctions and drives their branch
migration is less clear. The 76-kDa RecG polypeptide is a
DNA-dependent ATPase that binds specifically to model
Holliday intermediates and, in the presence of Mg2+ and
ATP, catalyzes branch migration of the junction point (9-11). RecG has
a number of structural motifs that are well conserved in DNA and RNA
helicases (9). In agreement with this, we have shown that RecG can
unwind partial duplex DNAs, although it does so rather inefficiently
(12). Helicase activity is stimulated on branched DNA structures and
targeted specifically to the junction point (12). From these
observations, it was proposed that RecG drives the branch migration of
Holliday junctions by targeting and unwinding DNA at or near the
junction crossover point. The link between DNA unwinding and branch
migration was further supported by a RecG mutant with an Ala to Val
substitution in helicase motif III that retains the ability to target
junctions but is deficient in DNA unwinding and branch migration (13).
Recently, Mahdi et al. (14) have used various truncated and
mutant forms of RecG to show that the N-terminal region of the protein
is required for junction-specific binding, while the C-terminal region
is critical for DNA unwinding. Since both the junction targeting and
helicase activities are encoded within a single polypeptide, the mode
of action of RecG is likely to differ from that of RuvAB.
To gain more insights into the mechanism of branch migration, we have
analyzed further features of RecG's interaction with X-junctions
in vitro. In particular, we concentrate here on how RecG
targets X-junctions. Data are presented indicating that RecG binds to
the center of the X-junction by recognizing principally the
displacement of two strands of DNA from a common junction arm. We also
show that the unwinding of X-junctions by RecG is remarkably sensitive
to the level of free Mg2+. This sensitivity correlates
directly with an inability of RecG to bind to the fully stacked
X-junction. The possible significance of these observations is
discussed in relation to how RecG might function in
vivo.
 |
MATERIALS AND METHODS |
Enzymes and Reagents--
RecG, RuvA, and RuvB were purified as
described (15, 16). Amounts of protein were estimated by a modified
Bradford assay using a Bio-Rad protein assay kit and bovine serum
albumin (Amersham Pharmacia Biotech) as the standard. Concentrations of
these proteins are expressed in mol of monomers. T4 polynucleotide
kinase was from Boehringer Mannheim, and [
-32P]ATP and
[
-32P]ATP were from Amersham Pharmacia Biotech. All
other reagents were from Sigma, BDH, and NBL Gene Sciences Ltd. and
were of analytical grade.
Oligonucleotides--
Oligonucleotides were synthesized on an
Applied Biosystems 380B DNA synthesizer using cyanoethyl chemistry.
Each oligonucletide was deprotected, precipitated in ethanol, and
purified on a 12% (w/v) polyacrylamide gel containing 7 M
urea. The bands containing full-length oligonucleotides were cut out
and extracted from the gel by soaking in water overnight.
DNA Substrates--
DNA substrates were made by annealing
combinations of oligonucleotides 1 (5'-AAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTG-3'), 2 (5'-GACGCTGCCGAATTCTGGCTTGCTAAAGGATAGGTCGAATTTTCTCATTTT-3'), 3 (5'-CAAAGTAAGAGCTTCTCGAGCTGCGCCTAGCTCGATGAGAACCATGCTAG-3'), 4 (5'-CAAAGTAAGAGCTTCTCGAGCTGCGCTAGCAAGCCAGAATTCGGCAGCGT-3'), 5 (5'-CAAAGTAAGAGCTTCTCGAGCTGCGC-3'), 6 (5'-TAGCAAGCCAGAATTCGGCAGCGT-3'), 7 (5'-GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCC-3'), 8 (5'-TGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT-3'), 9 (5'-CAACGTCATAGACGATTACATTGCTAGGACATGCTGTCTAGAGACTATCGA-3'), 10 (5'-ATCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGT-3'), 11 (5'-GGGTCAACGTGGGCAAAGATGTCCTAGCAAGCCAGAATTCGGCAGCGTC-3'), 12 (5'-GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC-3'), 13 (5'-TGCCGAATTCTACCAGTGCCAGTGATGGACATCTTTGCCCACGTTGACCC-3'), 14 (5'-CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA-3'), 15 (5'-CAAAGTAAGAGCTTCTCTTTAACACTTCCTGCGTATCGAATTTTCTCATTTT-3'), 16 (5'TGGGTGAACCTGCAGGTGGGCAAAGATGTCCTAGCAATGTAAATCGTCAAGCTTTATGCCGTT-3'), 17 (5'-CAACGGCATAAAGCTTGACGATTACATTGCTAGGACATGCTGTCTAGAGGATCCGACTATCGA-3'), 18 (5'-ATCGATAGTCGGATCCTCTAGACAGCATGTCCTAGCAAGGCACTGGTAGAATTCGGCAGCGT-3'), 19 (5'-GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCC-3'), 20 (5'-GACGCTGCCGAATTCTACCAGTGCCAGTGATGGACATCTTTGCCCACCTGCAGGTTCACCC-3'), 21 (5'-CAACGGCATAAAGCTTGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCCAGTATCGA-3'), 22 (5'-ATCGATAGTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGCAGCGT-3'), and 23 (5'-ACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATGCTGTCTAGAGGATCCGACTATCGAT-3') as indicated following the procedures of Parsons et
al. (17). The synthetic Holliday junction (X-12) made from
oligonucleotides 7-10 contains a homologous core of 12 bp,1 within which the
junction point is free to branch-migrate, whereas the static X-junction
(X-0) made from oligonucleotides 8 and 12-14 contains a fixed junction
point. 60-mer X-12 was made from oligonucleotides 16-19, and 60-mer
X-0 was made from oligonucleotides 16 and 20-22. The flayed duplex
substrates E and F each consist of a 26-bp duplex region and a
24-26-nucleotide region of unpaired single-stranded DNA, whereas the
flayed duplex substrates H and I each consist of a 32-bp duplex region
and a 16-20 nucleotide region of unpaired single-stranded DNA. Prior
to annealing, DNA substrates were labeled at the 5'-end of one of their
component oligonucleotides as indicated using
[
-32P]ATP and polynucleotide kinase. Annealed
substrates were purified by nondenaturing electrophoresis on 6%
polyacrylamide gels followed by electroelution. The concentration of
DNA substrates was estimated by relating the specific activity of the
labeled oligonucleotide to the activity of the purified substrate and
is expressed in molar concentrations of DNA substrate.
ATPase Assay--
Reactions (100 µl) contained 66 nM RecG in 20 mM Tris-HCl, pH 7.5, 2 mM DTT, 5 mM MgCl2, 5 mM ATP (of which a fraction was [
-32P]ATP), and 100 µg/ml BSA. 720 ng of 60-mer
X-12, linear duplex (oligonucleotides 18 and 23), or ssDNA
(oligonucleotide 19) was included in the reaction mixture as indicated.
Reactions were incubated at 37 °C, and at specified intervals
10-µl samples were taken and stopped by the addition of 2 µl of 0.5 M EDTA. The release of [
-32P]ADP from
[
-32P]ATP was assayed by thin layer chromatography on
polyethyleneimine-cellulose and measured by detection of the labeled
products using a Molecular Dynamics PhosphorImager (model 425).
ImageQuant software (Molecular Dynamics, Inc.) was used to analyze
phosphor images.
Binding Assays--
Reaction mixtures (20 µl) contained
labeled substrate DNA in buffer 2 (25 mM Tris-HCl, pH 8.0, 1 mM DTT, 100 µg/ml BSA, 6% glycerol) as indicated.
Reactions were started typically by the addition of RecG, held on ice
for 10 min, and then loaded immediately onto a 4% native
polyacrylamide gel in low ionic strength buffer (6.7 mM
Tris-HCl, pH 8.0, 3.3 mM sodium acetate, 2 mM
EDTA) with the voltage already applied at 200 V, unless otherwise
indicated. Competitor DNA (poly(dI·dC)-poly(dI·dC)) (Amersham
Pharmacia Biotech) added during the course of some reactions was mixed
in by four smooth pipetting movements using a P20 Gilson Pipetman.
Samples were run into the gel typically for 20 min at 200 V. Following this, the voltage was reduced to 160 V, and electrophoresis continued for a further 1 h and 20 min with buffer recirculation occurring throughout. Both buffer and gel were precooled at 4 °C, but
electrophoresis was at room temperature. Gels were dried on 3 MM
Whatman paper, quantified using a model SF PhosphorImager and
ImageQuant software (Molecular Dynamics), and autoradiographed.
Junction Unwinding Assays--
Reaction mixtures (20 µl)
contained labeled substrate DNA in either buffer 1 (20 mM
Tris-HCl pH 7.5, 2 mM DTT, 100 µg/ml BSA) or buffer 2 (25 mM Tris-HCl, pH 8.0, 1 mM DTT, 100 µg/ml BSA, 6% glycerol) and MgCl2, ATP, and protein as indicated.
After incubation at 37 °C, typically for 30 min, reactions were
terminated by adding one-fifth volume of stop mix (2.5% SDS, 200 mM EDTA, 10 mg/ml proteinase K) and incubating for a
further 10 min at 37 °C to deproteinize the mixture. Products were
analyzed by electrophoresis through 10% native polyacrylamide gels at
190 V using a standard Tris borate buffer system. Gels were dried on 3 MM Whatman paper, quantified using a model SF PhosphorImager and
ImageQuant software (Molecular Dynamics), and autoradiographed.
In Situ 1,10-Phenanthroline-Copper Footprinting--
Binding
reactions (50 µl) containing 270 ng of RecG and 16 ng of X-0, labeled
in one of its four strands, were set up in buffer 2 containing 2 mM EDTA in parallel with control reactions containing no
RecG as indicated. Following a 10-min incubation at 4 °C, binding reactions were run on a 6% nondenaturing polyacrylamide gel in low
ionic strength buffer (6.7 mM Tris-HCl pH 8.0, 3.3 mM sodium acetate, 2 mM EDTA). Electrophoresis
was at 4 °C for 2 h at 160 V with continuous circulation of
buffer. X-0 and RecG-X-0 complexes were detected by autoradiography at
4 °C, and the appropriate bands were excised from the gel, chopped
into evenly sized small pieces, and immersed in 100 µl of 50 mM Tris-HCl (pH 8.0). 10 µl of OP-Cu mix (2 mM 1,10-phenanthroline and 0.45 mM
CuSO4) and 10 µl of 58 mM mercaptoproprionic
acid were then added, and the mixture was incubated at room temperature
for 10 min. The reaction was stopped by the addition of 20 µl of 28 mM 2,9-dimethyl-1, 10-phenanthroline (18). 270 µl of 0.5 M ammonium acetate, 1 mM EDTA was then added,
and the DNA was eluted from the gel by incubation overnight at 37 °C
with gentle agitation in a thermomixer (Eppendorf). The DNA was then
precipitated with ethanol, washed twice with 70% ethanol, resuspended
in loading dye (98% formamide, 10 mM EDTA, 0.05% xylene
cyanol, 0.05% bromphenol blue) plus 10 mM NaOH, and
electrophoresed on a 15% polyacrylamide sequencing gel containing 7 M urea. Gels were dried and analyzed using a model SF
PhosphorImager and ImageQuant software (Molecular Dynamics) and by
autoradiography.
 |
RESULTS |
The Binding and Unwinding of X-junctions by RecG--
We and
others have used synthetic X-junctions as substrates to study the
in vitro behavior of enzymes that process Holliday junctions
during genetic recombination and DNA repair. For many of the studies on
RecG described below, an X-junction made from four oligonucleotides of
49-51 nucleotides each has been used. This junction contains a
homologous core of 12 bp, within which the junction point is free to
branch-migrate and therefore provides a close mimic of a natural
Holliday intermediate. The heterologous arms flanking the core limit
spontaneous unwinding of the substrate by branch migration of the
junction point to the DNA ends. This junction will be referred to as
X-12. To begin to characterize the mechanism of RecG branch migration,
we have studied some general features of RecG's interaction with X-12
in vitro.
Two basic qualities of a Holliday junction processing enzyme are that
it binds to the junction with a high degree of specificity and, under
appropriate reaction conditions, catalyzes either its branch migration
or resolution by endonucleolytic cleavage. Both binding and branch
migration of X-12 by RecG can be analyzed by simple gel-based assays
(Fig. 1). In Fig. 1A, RecG
junction binding is analyzed by a band shift assay. Two distinct
RecG-X-12 complexes are detected. Complex 1 forms at low concentrations
of RecG (lanes b-i), but as the concentration of RecG
increases and essentially all of the junction DNA has been bound, it is
replaced by the slower migrating complex 2 (lanes j-m).
Based on assays like this, we estimate that complex 1 is formed by the
binding of either a single monomer or a dimer of RecG per junction,
which agrees with previous estimates (10) and is consistent with gel
filtration data indicating that RecG is a monomer in
solution.2 Based on its
relative mobility, complex 2 is unlikely to involve more than either
two dimers or a single tetramer of RecG. RecG's specificity for X-12
under these conditions can be demonstrated by its lack of binding to
any of the individual oligonucleotides used to make X-12 or to a linear
duplex DNA of related nucleotide sequence (data not shown). It is
evident from the lack of complex 2 formation at concentrations of RecG
that are saturating for the formation of complex 1 that RecG's
affinity for binding X-12 to form complex 1 is considerably higher than
it is for binding X-12 to form complex 2.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 1.
Binding and unwinding of X-12 by RecG.
A, band shift assay showing binding of RecG to X-12.
Reaction mixtures (20 µl) contained the indicated amounts of RecG
with 1.6 nM 32P-labeled X-12 in reaction buffer
2 plus 2 mM EDTA. Reactions were incubated on ice for 10 min before loading onto a 4% polyacrylamide binding gel as described
under "Materials and Methods." B, unwinding of X-12 by
RecG. Reactions (20 µl) contained 50 nM RecG and 1.3 nM X-12 in reaction buffer 1 with 5 mM ATP and
5 mM MgCl2 as indicated. Reactions were
incubated at 37 °C for 30 min before being terminated and run on a
10% polyacrylamide gel as described under "Materials and Methods."
C, schematic representation of X-12 and its unwinding by
RecG to flayed duplex products. The homologous core of the junction is
shown by solid lines, and the 5' 32P
label is shown by the asterisk.
|
|
RecG's ability to convert X-12 to flayed duplex products is shown in
Fig. 1B. It dissociates the substrate by branch-migrating the junction point followed by unwinding one pair of heterologous arms
(Fig. 1C). The junction is a symmetrical structure, and as such RecG can unwind two different pairs of arms to catalyze branch migration in either of the two possible directions as evidenced by the
production of two different flayed duplexes (Fig. 1B,
lane d). This reaction is dependent on Mg2+ and
a hydrolyzable form of ATP (lanes b-d).
Hydrolysis of ATP--
RecG is a DNA-dependent ATPase
that needs to hydrolyze ATP to branch-migrate and unwind X-junctions.
X-junction DNA is bound by RecG with higher specificity and affinity
than other DNAs; it should therefore provide a better cofactor for the
hydrolysis of ATP by RecG than other DNAs. To test this possibility, we
analyzed the hydrolysis of ATP in the presence of a range of different but sequence-related DNAs (Fig. 2).
Little or no hydrolysis was observed in the absence of DNA or in the
presence of a ssDNA oligonucleotide. Some hydrolysis was detected in
the presence of linear duplex DNA; however, hydrolysis was most
stimulated in the presence of X-junction DNA, with the rate being
nearly four times greater than with the linear duplex DNA. The same
total quantity of DNA was used in each of these reactions, but similar
results were obtained also when equimolar amounts of DNA were used
(data not shown). The lack of ATP hydrolysis in the presence of ssDNA
appears to contradict the observation of Lloyd and Sharples (10) that
X174 ssDNA can promote ATP hydrolysis by RecG. This apparent anomaly
probably reflects a size difference and the likely ability of
X174
ssDNA to form secondary structures that could mimic junctions.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2.
Hydrolysis of ATP by RecG with different DNA
cofactors. Reactions (100 µl) contained 66 nM RecG
in 20 mM Tris-HCl, pH 7.5, 2 mM DTT, 5 mM MgCl2, 5 mM ATP (of which a
fraction was [ -32P]ATP), and 100 µg/ml BSA. 720 ng
of 60-mer X-12, linear duplex (oligo 18 + 23) or ssDNA
(oligo 19) was included in the reaction mixture as
indicated. Reactions were incubated at 37 °C, and at specified
intervals 10-µl samples were taken and stopped by the addition of 2 µl of 0.5 M EDTA. The release of
[ -32P]ADP from [ -32P]ATP was measured
by thin layer chromatography on polyethyleneimine-cellulose and
quantitated using a PhosphorImager.
|
|
The Limit of Unwinding DNA at Holliday Junctions--
RecG can
unwind partial duplex DNAs of 26 bp but fails to unwind ones of 52 bp
(12). To see if DNA unwinding at Holliday junctions is similarly
restricted, we examined RecG's activity on a number of different
X-junctions that varied the number of base pairs needed to be unwound
before the substrate could be dissociated to flayed duplex products. We
first examined an X-junction with the same homologous core as X-12 but
made with oligonucleotides of approximately 60 nucleotides in length
(60-mer X-12) so as to give heterologous arms of 24-25 bp instead of
the 18-19 bp that X-12 has. RecG readily unwinds this junction (Fig.
3A, lane b), as
does RuvAB (lane c). However, when we used an equivalent sized junction without a homologous core (60-mer X-0) so that 30 bp had
to be unwound, we observed very little unwinding by RecG (lane
e), whereas RuvAB seemed to have no trouble (lane f). To test whether the poor unwinding of 60-mer X-0 by RecG was due to the
increased number of base pairs to be unwound or the absence of a
homologous core, we tested RecG's activity on a smaller static X-junction. This smaller junction, made from oligonucleotides approximately 50 nucleotides in length, is unwound much more readily than the 60-mer X-0 junction (Fig. 3B). The activity is
similar to that seen with the 60-mer X-12 junction, which is perhaps
not too surprising, since the two junctions have heterologous arms of
the same length (24-25 bp). We also examined the 50-mer X-12 junction
in the same series of experiments. This junction, which has
heterologous arms of only 18-19 bp, is unwound with noticeably greater
efficiency than any of the other junctions. These data show that there
is a direct correlation between the ability of RecG to unwind a
junction and the number of base pairs in the heterologous arms flanking
the junction point. RecG's limit for DNA unwinding at X-junctions is
30 bp, which lies within the range estimated for the limit of
unwinding of partial duplex DNA substrates.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Unwinding of mobile and static X-junctions by
RecG. A, gel analysis of RecG and RuvAB unwinding of
60-mer X-12 and 60-mer X-0 junctions. Reaction mixtures (20 µl)
contained 0.6 nM junction DNA in reaction buffer 1 with
either 660 nM RecG or 50 nM RuvA plus 200 nM RuvB as indicated. Reactions with RecG contained 5 mM MgCl2 and 5 mM ATP, whereas with
RuvAB they contained 10 mM MgCl2 and 1 mM ATP. B, quantitated data for the unwinding of
mobile and static X-junctions by RecG. Reaction mixtures (20 µl)
contained RecG and either 0.76 nM 50-mer X-12 or 50-mer X-0
or 0.6 nM 60-mer X-12 or 60-mer X-0 in reaction buffer with
5 mM MgCl2 and 5 mM ATP. Reactions
were incubated at 37 °C for 30 min before termination and analysis
by gel electrophoresis as detailed under "Materials and
Methods."
|
|
RecG Binds to X-junctions at the Point of Strand
Crossover--
The binding specificity of RecG for X-junctions
presumably reflects its ability to recognize some structural feature of
this type of DNA. To gain a better understanding of what this might be,
we sought to locate where RecG was binding on X-junction DNA using
in situ 1,10-phenanthroline-copper footprinting. For these studies, we used an X-junction without a mobile core (X-0) so that the
position of the junction crossover point would be fixed and therefore
known precisely. X-0 shares one common oligonucleotide with X-12 and is
bound by RecG to form complex 1 with similar efficiency as X-12 (data
not shown). RecG-X-0 junction complexes were excised from band shift
gels containing 2 mM EDTA and reacted with the
1,10-phenanthroline-copper reagent as described under "Materials and
Methods." Four reactions were performed in parallel, each containing
X-0 labeled in a different strand. The products of these reactions were
analyzed on a 15% polyacrylamide gel containing 7 M urea
(Fig. 4A). Regions of
protection from attack by the 1,10-phenanthroline-copper reagent were
detected in all four strands of X-0, which was bound by RecG to form
complex 1. These were located at and flanking the point of strand
crossover in X-0 and exhibited approximately 2-fold symmetry (Fig.
4B). Essentially the same results were obtained when complex
2 was footprinted (data not shown). In the absence of metal ions,
X-junctions adopt a structure in which the four arms of the junction
extend toward the corners of a square and as such are regarded to have
4-fold symmetry. However, it is clear from the data in Fig. 4 that RecG
does not bind to X-0 to give a 4-fold symmetrical pattern of protection
from 1,10-phenanthroline-copper. This suggests that X-0, in the absence
of metal ions, may not be wholly 4-fold symmetrical and as such may
present a favored binding interface to RecG. Alternatively, particular
nucleotide sequences at the junction point could influence the binding
preferences of RecG.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4.
In situ 1,10-phenanthroline-copper
footprinting of complex 1 of RecG with X-0 isolated from a 6%
polyacrylamide binding gel. A, 15% sequencing gel of
footprinting reactions (see "Materials and Methods").
Bars alongside +RecG lanes indicate regions of
protection as determined by PhosphorImager analysis. B,
schematic of the central region of X-0 showing regions protected by
RecG (shaded).
|
|
RecG Binds to Flayed Duplex DNA--
Genetic and biochemical data
have provided evidence for an involvement of RecG in processing early
recombination intermediates (D-loops) and R-loops, in addition to its
role in branch-migrating Holliday junctions (15, 19-22). For example,
RecG binds to a range of different branched DNAs in vitro,
including D-loops, three-strand junctions, and Y-junctions. To
determine what the minimal DNA structure is for specific binding by
RecG, we constructed a range of DNA substrates of decreasing complexity
(Fig. 5, A and B,
substrates A-J). Binding was then analyzed by the band shift assay.
Discrete retarded species of similar mobility were observed when RecG
was incubated with X-12 and substrates A-F, H, and I, indicative of
protein-DNA complex formation (Fig. 5, A and B,
complex 1). No complexes were observed with the partial or complete
linear duplex DNA substrates (G and J, respectively (lanes p and
n)). Interestingly, in these gels, the formation of complex 2 was
only observed with X-12. Although the complexes formed between RecG and
the various DNA substrates appear similar, as judged by their mobility
in polyacrylamide, the different amounts of complex that are formed
indicate that their relative stabilities are different. From titration
experiments, the apparent dissociation constant (KD)
for RecG binding to X-12 is approximately 0.5-1.5 nM,
whereas for three-strand junctions and Y-junctions (substrates A and B)
it is approximately 5 nM, and for part Y-junctions (substrates C and D) and flayed duplex DNA (substrate E) it is in the
range of 10-50 nM (data not shown). These data indicate that RecG's affinity for X-junctions is 5-10-fold higher than for
three-strand junctions and Y-junctions, and 10-100-fold higher than
for part Y-junctions and flayed duplex molecules.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 5.
Binding and unwinding DNA substrates that
mimic the component parts of an X-junction. A and
B, band shift assay showing RecG binding to a range of DNA
substrates. Reactions (20 µl) contained 0.7 nM substrate
DNA in reaction buffer 2 containing 2 mM EDTA and RecG as
indicated. Reactions were incubated on ice for 10 min before loading
onto a 4% polyacrylamide binding gel as described under "Materials
and Methods." A schematic diagram of each DNA
substrate is shown at the top. Each substrate is made from
the oligonucleotides indicated by number on each respective schematic.
All substrates are 32P-labeled at the 5'-end of one of
their component oligonucleotides as indicated by the
asterisk. C, same as above except for the
concentrations of X-12 and the loop substrate DNA, which were 1.5 and
0.5 nM, respectively. D, unwinding of substrates
A-G by RecG. Reactions (20 µl) contained 0.7 nM
substrate DNA in 20 mM Tris-HCl, pH 8.0, 2 mM
DTT, 2 mM MgCl2, 5 mM ATP, 100 µg/ml BSA, and 100 nM RecG as indicated.
|
|
From these data, we conclude that the minimal branched DNA structure
bound by RecG to yield a specific complex that is detectable by band
shift analysis is a flayed duplex molecule. Indeed, the flayed duplex
may represent the basic structural element that RecG recognizes in all
of the junctions that it binds to. If this is true, then it also
provides an explanation for why RecG binds readily to X-12 to form
complex 2 but does not readily form a second complex with any of the
other substrates used in this investigation. Basically, X-12 can be
considered to contain two distinct "flayed duplex" components,
whereas each of the other substrates contains only one. To test this
idea, we constructed a further substrate consisting of two 18-bp duplex
regions flanking a heterologous loop region of 19 bases. We reasoned
that RecG should be able to target both flayed duplexes formed at the
junctions between double-stranded and single-stranded DNA at either end
of the loop and therefore would readily form both RecG-junction complex
1 and complex 2. The loop substrate was incubated with different concentrations of RecG, and binding was analyzed as previously. As
predicted, two specific RecG-DNA complexes were observed (Fig. 5C, lanes f-h). The faster complex migrated in
the gel to approximately the same position as complex 1 formed with
X-12, whereas the slower complex migrated to approximately the same
position as complex 2 formed with X-12. Furthermore, it is evident that
RecG forms complex 2 far more readily with the loop substrate than with
X-12 (Fig. 5C and data not shown). Complex 2 formation with
X-12 may be impeded by steric interference between the two molecules of RecG attempting to dock on the same junction. Such conflict may not
arise with the loop substrate because its flayed duplex components are
sufficiently spaced to avoid such clashes. These data are consistent
with RecG binding readily to both flayed duplex junctions at either end
of the loop.
To see if RecG's ability to bind a particular DNA substrate correlates
with its ability to unwind that substrate, we analyzed the unwinding of
substrates A-G by RecG (Fig. 4D). Very low levels (
1%)
of unwinding were observed with the two flayed duplex DNA molecules
(substrates E and F, lanes j and l) and the
partial duplex molecule (substrate G, lane n). We also
detected very little unwinding of the other two flayed duplex molecules
(substrates H and I) and the loop DNA (data not shown). In contrast,
efficient unwinding of substrates A, B, C, and D was observed
(lanes b, d, f, and h). The
three-strand junction (substrate A) was dissociated by the removal of
either oligonucleotide 2 or 3 predominantly. Small amounts of free
oligonucleotide 1 were also observed that could have come directly from
dissociation of the three-strand junction or from a secondary reaction
on the flayed duplex molecules produced following oligonucleotide 2 or
3 removal. The Y-junction (substrate B) was dissociated in similar
fashion by removal of either oligonucleotide 2 or 4 predominantly.
Dissociation of substrates C and D was predominantly by removal of the
short oligonucleotide in each case. These data show that the ability of
RecG to bind to a DNA substrate does not always correlate with its
ability to unwind that substrate. Furthermore, it is clear that,
although RecG will readily bind to a three-way junction with only one
duplex arm (i.e. a flayed duplex), efficient DNA unwinding
by RecG requires at least two of the arms to be double-stranded.
The Mg2+/ATP Ratio Affects the Unwinding of X-12 by
RecG--
As shown in Fig. 1, RecG depends on both ATP and
Mg2+ to unwind X-12. Previous studies have indicated that
branch migration catalyzed by RecG favors high concentrations of ATP
(10, 16) and is inhibited by high concentrations of MgCl2
(11). To investigate further RecG's dependence on ATP and
Mg2+ for unwinding X-12, we analyzed the rate of the
reaction at four concentrations of MgCl2 and a fixed
concentration of ATP. The rate was reduced dramatically with
Mg2+ in molar excess over ATP. A 10-fold reduction was
observed when the molar ratio was increased from 1:2 to 2:1 (Fig.
6A). The negative effect of
excess Mg2+ was reversed by reestablishing a more favorable
ratio during the reaction (Fig. 6B). These data show that
the unwinding of X-12 by RecG depends critically on the
Mg2+/ATP ratio, with the optimal ratio being <1:1 and
junction unwinding being significantly inhibited when there is excess
free Mg2+.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 6.
The effect of MgCl2 on the rate
of unwinding of X-12 by RecG. A, reactions (60 µl)
contained 0.05 nM RecG and 2.75 nM X-12 in
reaction buffer 2 with 2 mM ATP and MgCl2 as
indicated. Reactions were preincubated at 37 °C for 2 min before
adding RecG. Samples (10 µl) were taken at timed intervals and
processed as described under "Materials and Methods." B,
reactions were as in A except that the concentration of X-12
was 2 nM. After 5 min, ATP was added to one of the
reactions as indicated to raise its concentration from 2 to 8 mM.
|
|
Mg2+ Reduces RecG Junction Binding--
The inhibition
of junction unwinding by excess Mg2+ could be explained by
an inhibition of RecG junction binding. We investigated this
possibility by comparing junction binding in the presence of 2 mM EDTA, 200 µM MgCl2, and 5 mM MgCl2. X-12 was incubated with a range of
RecG concentrations, and band shift gels were used to analyze the
binding. Both binding and electrophoresis were carried out under the
same conditions. Data similar to the data shown in Fig. 1A
was quantitated by PhosphorImager analysis, and the percentage of X-12
bound for each concentration of RecG was plotted against the logarithm
of the protein molarity (Fig. 7). From
this, the relative dissociation constants were estimated to be 0.5-1.5
nM in 2 mM EDTA and 5 nM in 200 µM MgCl2. However, in the presence of 5 mM MgCl2, we detected little or no binding and
were therefore unable to estimate the dissociation constant (data not
shown). These data indicate that Mg2+ inhibits RecG binding
to X-junction DNA.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 7.
The effect of MgCl2 on the
binding of X-12 by RecG. Reaction mixtures (20 µl) contained
varying concentrations of RecG with 1.6 nM
32P-labeled X-12 in reaction buffer 2 plus 2 mM
EDTA or 200 µM MgCl2 as indicated. Reactions
were incubated on ice for 10 min before loading onto a 4%
polyacrylamide binding gel containing 2 mM EDTA or 200 µM MgCl2 as indicated. The data was
quantitated by PhosphorImager analysis, and the percentage of X-12
bound for each concentration of RecG was plotted against the logarithm
of the protein molarity.
|
|
To provide a further test for the effect of Mg2+ on RecG
junction binding, we analyzed the dissociation of RecG from X-12 in the
presence and absence of MgCl2 (5 mM). At the
same time, we also tested the effect of ATP
S (5 mM) and
ADP (5 mM) on junction binding in the presence of
MgCl2 (5 mM). ATP
S was used in place of ATP
to avoid unwinding X-12. Binding reactions between RecG and
32P-labeled X-12 were set up, and, after a period to allow
for equilibration, sufficient unlabeled double-stranded DNA (competitor
DNA) was added to act as a sink for any RecG protein that was not bound to X-12. Samples were then taken and loaded directly onto a band shift
gel, running at 200 V and containing 2 mM EDTA, at timed intervals in order to monitor binding (Fig.
8, A-D). After the addition
of the competitor DNA, the amount of X-12 bound at time 0 was different
for each set of conditions. This reflects not only different amounts of
dissociation of RecG from X-12 occurring in the time taken to load each
sample onto the gel but also different equilibriums reached between
free RecG and RecG bound to X-12. These equilibrium positions are not
necessarily represented by the amount of binding observed in the
absence of competitor DNA, because binding can occur during loading and
electrophoresis of the sample onto the gel.2 For example,
the high level of junction binding observed in the presence of
inhibitory amounts of MgCl2 and absence of competitor DNA
(Fig. 8B, lane b) is due to the dilution and
titration of the Mg2+ as the sample is electrophoresed into
the gel. From time zero, the amount of free X-12 increased over time
for each set of conditions. However, the rate at which this happened
varied in each case, signifying different rates of dissociation of RecG
from X-12 (Fig. 8E). The slowest rate of dissociation of
RecG from X-12 was observed in the presence of EDTA with virtually all
of the RecG-X-12 complex remaining intact over a 30-min incubation on
ice. As expected from the data in Fig. 7, very little binding of RecG
to X-12 was detected in the presence of 5 mM
MgCl2 at time zero, and what binding there was rapidly
decayed in the first few minutes following the addition of the
competitor DNA. The destabilizing effect of MgCl2 was
partly ameliorated by the addition of a titrating amount of either
ATP
S or, by a lesser extent, ADP (Fig. 8, C and
D). These data provide further evidence that
Mg2+ inhibits RecG binding to X-12. They are also
consistent with junction binding being a possible rate-limiting step
for the unwinding of X-12 in the presence of excess Mg2+
observed in Fig. 6.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 8.
Dissociation of RecG from X-12.
A-D, band-shift analysis of dissociation of RecG from X-12.
Reactions (60 µl) contained 5 nM RecG and 1.4 nM X-12 in buffer 2 plus 2 mM EDTA
(A), 5 mM MgCl2 (B), or 5 mM MgCl2 plus 5 mM ATP S
(C), or 5 mM MgCl2 plus 5 mM ADP (D). Reactions were incubated on ice for
10 min either with or without 12 µg of poly(dI·dC)-poly(dI·dC)
competitor DNA as indicated. Following incubation, 10-µl samples were
loaded from each reaction mixture onto a standard 4% polyacrylamide
gel containing 2 mM EDTA as described under "Materials
and Methods." 12 µg of poly(dI·dC)-poly(dI·dC) was then added
to each of the reactions not containing competitor DNA, and further
10-µl samples from these were loaded onto the gel at timed intervals.
E, quantitated data from A-D.
|
|
Inhibition of Junction Binding and Unwinding by Other
Cations--
The inhibitory effect of MgCl2 on junction
binding could be due to its interaction with RecG and/or DNA. In order
to distinguish between these possibilities, we sought to determine
whether the inhibitory effects of MgCl2 were specific to
Mg2+ or could be manifested by other cations. We first
examined the effect of CaCl2. Ca2+ was unable
to substitute for Mg2+ in the unwinding of X-12 by RecG
(data not shown). However, both junction binding and unwinding in the
presence of Mg2+ were inhibited by CaCl2 to a
similar extent as by MgCl2 (data not shown). These data
indicate that inhibition is not mediated specifically by
Mg2+. Furthermore, they suggest that the inhibitory effects
of Mg2+ may be mediated largely by its interaction with the
X-junction DNA.
There are at least two ways in which the interaction of
Mg2+ with X-junction DNA could affect RecG binding: 1) By
providing a general screening of the phosphodiester backbone (23, 24) or 2) By affecting the conformation of the X-junction DNA. In the
absence of cations the DNA arms of the X-junction adopt a 4-fold
symmetrical pattern. However, in the presence of sufficient cations
(approximately 100 µM in the case of Mg2+)
the negative charges of phosphates on the DNA backbone are neutralized, allowing coaxial stacking of junction arms (5). Complete folding appears to require the site binding of a cation at an electronegative cleft created at the center of the stacked X-junction (25). To test
both of these possibilities, we compared the effects of different
concentrations of MgCl2, hexamminecobalt(III) chloride, and
NaCl on the binding of X-12 by RecG. Hexamminecobalt(III) chloride
stacks X-junctions far more efficiently than Mg2+, with <2
µM required for complete stacking (5), whereas,
Na+ can provide a general screening of the phosphodiester
backbone but will fully stack an X-junction only at very high
concentrations (>0.5 M), probably due to an inability to
site-bind at the center of the stacked X-junction (25). Therefore, if
general screening of the phosphodiester backbone is responsible for the
inhibition of junction binding, then equivalent ionic strengths of
Na+ and Mg2+ should equally affect binding of
RecG to X-12, whereas if the junction conformation is important for
RecG's ability to bind to X-12, then hexamminecobalt(III) chloride
should be a better inhibitor of binding than Mg2+.
To compare the effects of these different cations on junction binding,
we utilized the dissociation assay shown in Fig. 8 and analyzed binding
over a range of concentrations of cations. However, instead of
monitoring binding over time following the addition of the competitor
DNA, we analyzed the level of binding only immediately following its
addition. As mentioned before, this level of binding reflects both
ongoing dissociation of RecG from X-12 and the equilibrium between free
RecG and RecG bound to X-12. Increasing the concentrations of any of
the cations inhibits binding of X-12 by RecG (Fig.
9A). Hexamminecobalt(III)
chloride is the best inhibitor, requiring only 10-20 µM
to elicit a 50% reduction in the amount of X-12 bound. In comparison,
approximately 700-800 µM MgCl2 or 100 mM NaCl is required to achieve the same reduction in
binding. These data do not support the idea that general screening of
the phosphodiester backbone is the primary way in which relatively low
concentrations of Mg2+ inhibit junction binding, because
equal ionic strengths of Na+ and Mg2+ do not
elicit the same reduction in junction binding. For example, at 15 mM NaCl, which has an ionic strength equivalent to 5 mM MgCl2, no reduction in junction binding is
observed, whereas at 5 mM MgCl2 binding is
greatly reduced. However, these results do support the idea that
junction stacking is responsible for the inhibition of RecG-junction
binding observed at relatively low concentrations of Mg2+,
because the concentrations of MgCl2 and
hexamminecobalt(III) chloride required to inhibit binding correlate
well with those required to stack X-junctions (see above).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 9.
A comparison of the effect of
MgCl2 NaCl and hexamminecobalt(III) chloride on the binding
and unwinding of X-12 by RecG. A, binding of X-12 by
RecG with varying cation and cation concentration following the
addition of a saturating amount of competitor DNA. Reactions (20 µl)
contained 5 nM RecG and 1.4 nM X-12 in buffer 2 containing the indicated amount of MgCl2/NaCl or
hexamminecobalt chloride. After incubation on ice for 10 min, 4 µg of poly(dI·dC)-poly(dI·dC) competitor DNA was added to each
reaction. Immediately following the addition of the competitor DNA to a
reaction mix, a 10-µl sample from it was loaded onto a 4%
polyacrylamide gel containing 2 mM EDTA running at 200 V as
described under "Materials and Methods." Data from the band shift
gel (not shown) was quantitated by PhosphorImager analysis, and the
percentage of X-12 bound for each concentration of cation was plotted
against the logarithm of the cation molarity. B, the effect
of hexamminecobalt(III) chloride on the rate of unwinding X-12 by RecG.
Reactions (40 µl) contained RecG and 3.2 nM X-12 in
buffer 2 plus 1 mM MgCl2 and 10 mM
ATP. 200 µM hexamminecobalt(III) chloride was added to
reactions as indicated. Reactions were incubated at 37 °C following
the addition of RecG. Samples (7 µl) were taken at timed intervals
and processed as described under "Materials and Methods."
|
|
Hexamminecobalt(III) chloride cannot substitute for Mg2+ in
the unwinding of X-12 by RecG (data not shown). However, to see if its
effect on junction binding also affected junction unwinding, we
compared the rates of unwinding X-12 with and without 200 µM hexamminecobalt(III) chloride for two different
concentrations of RecG in reactions that also contained an excess of
ATP (10 mM) over MgCl2 (1 mM) to
limit any effects of free Mg2+ (Fig. 9B). At
both concentrations of RecG, the addition of 200 µM
hexamminecobalt(III) chloride to the standard reaction reduced the rate
of unwinding approximately 5-fold. This amount of inhibition correlates
reasonably well with the reduction in junction binding in Fig.
9A, indicating that, as expected, inhibiting junction binding by RecG also perturbs its unwinding.
 |
DISCUSSION |
Previous studies have exposed two key features of the mechanism by
which RecG catalyzes branch migration. First, RecG binds with a high
degree of specificity to Holliday junction DNA; second, RecG is a
DNA-dependent ATPase that can unwind short stretches (
25
bp) of duplex DNA in a reaction that, like branch migration, is
dependent on Mg2+ and the hydrolysis of ATP (10, 12). In
the present study, we have added to this basic characterization by
showing that, as expected for a protein that targets Holliday
junctions, the rate of ATP hydrolysis catalyzed by RecG is much more
strongly stimulated by X-junction DNA than by linear duplex DNA.
Furthermore, we have shown that DNA unwinding at Holliday junctions is
limited to
30 bp/junction arm. This confirms that DNA unwinding at
Holliday junctions and partial linear duplex substrates is similarly
restricted. These data are consistent with RecG catalyzing the branch
migration of Holliday junctions and other recombination intermediates
by unwinding DNA at or near to the junction crossover point.
Presumably, limited DNA unwinding is sufficient to promote
extensive branch migration of Holliday junctions, three-strand
junctions, and R-loops through regions of homology, because for every
base pair that is broken a new base pair is formed, thereby preventing
the newly unwound strands from snapping back together (11, 15, 26).
The main focus of this paper is the study of Holliday junction binding
by RecG. A variety of enzymes have been discovered that bind with some
degree of specificity to X-junction DNA. These include not only the
branch-migrating proteins RuvAB and RecG, and the resolvases RuvC,
RusA, CCE1, SpCCE1, T4 endonuclease VII, and T7 endonuclease
I, but also binding proteins without detectable catalytic activity such
as HMG1, HU, and CBP from HeLa cells (10, 27-36). Using a variety of
enzyme and chemical probes to analyze protein-DNA interactions, it is
clear that these proteins, at least where tested, bind to DNA at and
around the junction crossover point (36-40). The
1,10-phenanthroline-copper footprinting of the RecG-junction complex
presented here shows that RecG too binds at the junction crossover
point.
What precisely is RecG recognizing when it binds to X-junction DNA?
Many possibilities exist, since the X-junction structure offers a whole
array of potential sites for interaction that could singly or in
combination provide a potent signature for its identification. These
include a high affinity binding site for certain intercalators (41-44), local widening of groove widths (45), and a range of angles
subtended within or between DNA helices. In the latter case, the angles
presented by a junction are dependent on presence or absence of metal
ions. In the absence of metal ions, electrostatic repulsion between the
four arms of the junction forces them into a 4-fold symmetrical
arrangement in which each arm subtends an angle of 90° with its
neighbor. In the presence of metal ions, charges are neutralized,
enabling the junction to fold into a more compact structure in which
the helical arms stack pairwise upon each other to form an X-shaped
structure with 2-fold symmetry (5, 46). This stacked X-structure
presents a large angle of approximately 120° and a small angle of
approximately 60° between DNA helices.
T4 endonuclease VII has the ability to bind and cleave a range of DNA
structures, including X-junctions, that have in common two mutually
inclined helices (47). This presents a strong argument for it
"measuring" the angle of helical inclination for binding and
catalytic activation. RecG's ability to bind and unwind a range of DNA
structures in addition to X-junctions suggests that it too may
recognize angles inclined between DNA helices. However, it has now been
found that most, if not all, X-junction-binding proteins dramatically
alter the conformation of the junction upon binding (7, 39, 48-50).
The same appears to be true for
RecG.3 From this it can be
concluded that it is not necessarily the initial conformation of the
DNA that is critical for recognition but rather an intrinsic ability of
that DNA to be molded into the binding site(s) of the protein in
question. By analyzing RecG's ability to bind to various substrates
made from the component parts of an X-junction, it is clear that the
minimal structure that it will bind to is a flayed duplex molecule.
Therefore, the critical feature for specific protein-DNA interaction is
the displacement of two single strands from one end of a common duplex
strand. Presumably, RecG contacts each of the three arms emanating from the common junction point in a flayed duplex, manipulating each arm
relative to the others so that they are fitted into its binding site(s). If RecG does use this feature to recognize branched DNAs, then
multiple binding sites should be available to it, the exact number
depending on the DNA species; e.g. X-junctions should
present four binding sites, three-strand junctions and Y-junctions
should present three binding sites, and flayed duplexes should present only one binding site. The observation from band shift data that only
two RecG-X-junction complexes are formed and that only one complex is
formed efficiently with Y-junction and three-strand junction DNA
indicates that not all binding sites can be bound simultaneously by
RecG. Presumably, this is because binding at one site interferes with
binding at the other sites either by direct physical interaction
between the protein molecules or indirectly by RecG altering and fixing
the conformation of the other sites such that they cannot be bound. If
the binding sites are separated by an intervening region of DNA, then
both sites can be efficiently bound within a single DNA molecule as is
the case with the loop substrate (Fig. 5C). The intervening
DNA provides both physical separation of protein molecules and a degree
of flexibility that could enable both binding sites to be
conformationally altered to fit the RecG binding site(s).
It is clear that RecG binds to flayed duplex DNA; however, it is also
evident from the data presented here and elsewhere that additional
substrate complexity is required to stimulate efficient DNA unwinding
(see Fig. 5D and Ref. 20). The minimal requirement for
efficient DNA unwinding appears to be a junction with at least two
duplex arms like the part Y-junctions (substrates C and D, Fig. 5).
Interestingly, it is the short oligonucleotide that is unwound from
both substrates C and D (Fig. 5D, lanes f and
h). Unwinding of both oligonucleotides (oligonucleotides 5 and 6) occurs with approximately the same efficiency despite them
having opposite polarities with respect to the junction center. This is
unlike RecG's action on conventional partial duplex Matson style
helicase substrates, where unwinding proceeds with a clear 3'-5'
polarity with respect to the single strand that is bound (12). These
observations together with the binding data suggest that RecG binds to
a flayed duplex component of a junction in an orientation dependent
fashion. It then proceeds to unwind DNA along both arms of the
"flay." "Unwinding" may be promoted by RecG attempting to
anneal two strands displaced from a common junction point (15). This
"reverse" helicase action would be efficient for the branch
migration of recombination intermediates, because homology between the
strands would clearly aid them being brought together.
Observations made here and elsewhere indicate that although a
particular DNA species may appear on paper to present the necessary features for specific recognition by RecG, in practice it can be a very
poor substrate for binding. For example, RecG's affinity for flayed
duplex molecules and loop DNAs that differ in size and/or nucleotide
sequence can vary dramatically (see Fig. 5 and Ref. 20). Furthermore,
RecG may prefer only a subset of possible junction binding sites. This
appears to be the case when RecG binds to X-0 in the absence of
cations, because instead of the predicted 4-fold symmetrical pattern of
protection from 1,10-phenanthroline-copper, it yields a 2-fold
symmetrical pattern, suggesting that only two of the four possible
binding sites on X-0 are efficiently bound by RecG. Presumably, these
variations in binding affinity and binding site preference are due to
differences in nucleotide sequence. Nucleotide sequence affects
junction conformation, which in turn could affect how RecG "sees"
the junction. In the case of the flayed duplex and loop substrates,
conformational differences may be simply due to limited inter- and
intrastrand base pairing of the single-stranded regions of these DNA
molecules, whereas in the case of X-junctions the nucleotide sequence
is known to affect the crossover isomer bias (51) and presumably also
influences the unfolded junction conformation. Alternatively, the
nucleotide sequence could influence the malleability of a junction,
thereby affecting its ability to be fitted into the RecG binding
site(s). This would be analogous to the effect of
sequence-dependent DNA bending on CAP protein-DNA binding
affinity (52).
RecG depends on Mg2+ for branch migration and DNA
unwinding. However, quite low concentrations of free Mg2+
inhibit X-junction unwinding. In the current study, we have shown that
the inhibition of X-junction unwinding directly correlates with a
reduction in junction binding by RecG. These inhibitory effects are not
specifically mediated by Mg2+; e.g. both
Ca2+ and hexamminecobalt(III) chloride also inhibit
junction binding and unwinding by RecG. The relative abilities of these
cations to mediate inhibition closely correlates with their relative
abilities to stack X-junctions (5, 25). Furthermore, the respective concentrations of cation at which inhibition is mediated are similar to
those required for complete stacking of the X-junction. From this we
conclude that the stacking of the X-junction mediated by cations
inhibits RecG binding to the junction.
RecG's apparent inability to bind to the stacked X-junction is in
marked contrast to other Holliday junction binding proteins like RuvA,
RuvC, and CCE1, whose binding is relatively unaffected by stacking
concentrations of Mg2+ (7, 50, 53). This may be significant
for RecG's functioning in vivo. The intracellular level of
free Mg2+ is estimated to be on the order of 1 mM (54). If this is true, then naked Holliday junctions
would be fully stacked in vivo and RecG's ability to
branch-migrate them would be severely impaired. If this situation
occurs in vivo, how might RecG function? One possibility is
that RecG activity could be modulated by changes in the level of
intracellular free Mg2+. Alternatively, DNA-binding
proteins, e.g. RecA, could hold the junction in an unstacked
conformation and thereby enable RecG to bind. There may even be no need
for RecG to bind to Holliday junctions at all, since branch migration
could, presumably, be catalyzed adequately by RuvAB.
Recently, it has become clear that RecG's function is not restricted
to branch-migrating Holliday junctions. For example, RecG can
branch-migrate DNA junctions at D-loops (20). This activity appears to
be important for ensuring efficient recombination in the presence of
the PriA helicase (19). Furthermore, RecG can unwind R-loops, which
helps to limit their accumulation in vivo (15, 21, 22).
Clearly, these activities do not require RecG's interaction with a
Holliday junction and therefore may not be as sensitive to the
concentration of free Mg2+. However, this has yet to be
tested. Still, it remains an intriguing possibility that, in
vivo, D-loops and R-loops present more attractive targets than
Holliday junctions to RecG.
 |
ACKNOWLEDGEMENTS |
We are grateful to David Sherratt for advice
and support, Julie Dixon for excellent technical support, and Peter
McGlynn for critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported by a Career Development Award from
the Medical Research Council (to M. C. W.) and by grants from the Medical Research Council and Biotechnology and Biological Sciences Research Council (to R. G. L.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence and reprint requests should be addressed:
Microbiology Unit, Dept. of Biochemistry, University of Oxford, South
Parks Rd., Oxford OX6 9FS, United Kingdom. Tel.: 44-1865-275192; Fax:
44-1865-275297; E-mail: whitby{at}bioch.ox.ac.uk.
1
The abbreviations used are: bp, base pair(s);
DTT, dithiothreitol; ssDNA, single-stranded DNA; BSA, bovine serum
albumin; ATP
S, adenosine 5'-O-(thiotriphosphate).
2
M. C. Whitby and R. G. Lloyd,
unpublished data.
3
S. D. Vincent and R. G. Lloyd,
unpublished data.
 |
REFERENCES |
-
West, S. C.
(1992)
Annu. Rev. Biochem.
61,
603-640[CrossRef][Medline]
[Order article via Infotrieve]
-
Johnson, R. D.,
and Symington, L. S.
(1993)
J. Mol. Biol.
229,
812-820[CrossRef][Medline]
[Order article via Infotrieve]
-
Panyutin, I. G.,
and Hsieh, P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2021-2025[Abstract/Free Full Text]
-
Panyutin, I. G.,
Biswas, I.,
and Hsieh, P.
(1995)
EMBO J.
14,
1819-1826[Medline]
[Order article via Infotrieve]
-
Duckett, D. R.,
Murchie, A. I.,
and Lilley, D. M. J.
(1990)
EMBO J.
9,
583-590[Medline]
[Order article via Infotrieve]
-
West, S. C.
(1996)
J. Bacteriol.
178,
1237-1241[Free Full Text]
-
Parsons, C. A.,
Stasiak, A.,
Bennett, R. J.,
and West, S. C.
(1995)
Nature
374,
375-378[CrossRef][Medline]
[Order article via Infotrieve]
-
Rafferty, J. B.,
Sedelnikova, S. E.,
Hargreaves, D.,
Artymiuk, P. J.,
Baker, P. J.,
Sharples, G. J.,
Mahdi, A. A.,
Lloyd, R. G.,
and Rice, D. W.
(1996)
Science
274,
415-421[Abstract/Free Full Text]
-
Lloyd, R. G.,
and Sharples, G. J.
(1991)
J. Bacteriol.
173,
6837-6843[Abstract/Free Full Text]
-
Lloyd, R. G.,
and Sharples, G. J.
(1993)
EMBO J.
12,
17-22[Medline]
[Order article via Infotrieve]
-
Whitby, M. C.,
Ryder, L.,
and Lloyd, R. G.
(1993)
Cell
75,
341-350[CrossRef][Medline]
[Order article via Infotrieve]
-
Whitby, M. C.,
Vincent, S. D.,
and Lloyd, R. G.
(1994)
EMBO J.
13,
5220-5228[Medline]
[Order article via Infotrieve]
-
Sharples, G. J.,
Whitby, M. C.,
Ryder, L.,
and Lloyd, R. G.
(1994)
Nucleic Acids Res.
22,
308-313[Abstract/Free Full Text]
-
Mahdi, A. A.,
McGlynn, P.,
Levett, S. D.,
and Lloyd, R. G.
(1997)
Nucleic Acids Res.
25,
3875-3880[Abstract/Free Full Text]
-
Vincent, S. D.,
Mahdi, A. A.,
and Lloyd, R. G.
(1996)
J. Mol. Biol.
264,
713-721[CrossRef][Medline]
[Order article via Infotrieve]
-
Lloyd, R. G.,
and Sharples, G. J.
(1993)
Nucleic Acids Res.
21,
1719-1725[Abstract/Free Full Text]
-
Parsons, C. A.,
Kemper, B.,
and West, S. C.
(1990)
J. Biol. Chem.
265,
9285-9289[Abstract/Free Full Text]
-
Sigman, D. S.,
Kuwabara, M. D.,
Chen, C.-H. B.,
and Bruce, T. W.
(1991)
Methods Enzymol.
208,
414-433[Medline]
[Order article via Infotrieve]
-
Al-Deib, A. A.,
Mahdi, A. A.,
and Lloyd, R. G.
(1996)
J. Bacteriol.
178,
6782-6789[Abstract/Free Full Text]
-
McGlynn, P.,
Al-Deib, A. A.,
Liu, J.,
Marians, K. J.,
and Lloyd, R. G.
(1997)
J. Mol. Biol.
270,
212-221[CrossRef][Medline]
[Order article via Infotrieve]
-
Hong, X.,
Cadwell, G. W.,
and Kogoma, T.
(1995)
EMBO J.
14,
2385-2392[Medline]
[Order article via Infotrieve]
-
Fukuoh, A.,
Iwasaki, H.,
Ishioka, K.,
and Shinagawa, H.
(1997)
EMBO J.
16,
203-209[CrossRef][Medline]
[Order article via Infotrieve]
-
Porschke, D.
(1976)
Biophys. Chem.
4,
383-394[CrossRef][Medline]
[Order article via Infotrieve]
-
Lohman, T. M.
(1985)
CRC Critical Rev. Biochem.
19,
191-245
-
Møllegaard, N. E.,
Murchie, A. I. H.,
Lilley, D. M. J.,
and Nielsen, P. E.
(1994)
EMBO J.
13,
1508-1513[Medline]
[Order article via Infotrieve]
-
Whitby, M. C.,
and Lloyd, R. G.
(1995)
EMBO J.
14,
3302-3310[Medline]
[Order article via Infotrieve]
-
Parsons, C. A.,
Tsaneva, I.,
Lloyd, R. G.,
and West, S. C.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
5452-5456[Abstract/Free Full Text]
-
Dunderdale, H. J.,
Benson, F. E.,
Parsons, C. A.,
Sharples, G. J.,
Lloyd, R. G.,
and West, S. C.
(1991)
Nature
354,
506-510[CrossRef][Medline]
[Order article via Infotrieve]
-
Sharples, G. J.,
Chan, S. C.,
Mahdi, A. A.,
Whitby, M. C.,
and Lloyd, R. G.
(1994)
EMBO J.
13,
6133-6142[Medline]
[Order article via Infotrieve]
-
White, M. F.,
and Lilley, D. M. J.
(1996)
J. Mol. Biol.
257,
330-341