|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J Biol Chem, Vol. 273, Issue 32, 20568-20574, August 7, 1998
From the Shanghai Institute of Biochemistry, Chinese Academy of
Sciences, 320 Yue-Yang Road, Shanghai 200031, China
Nodulation genes (nod) of rhizobia
are essential for establishment of its symbiosis with specific legume
hosts and are usually located on the Sym(biosis) megaplasmid. In this
work we identified a new Sym plasmid independent protein in
Rhizobium leguminosarum, Px, by its ability to bind to
nod promoters and induce DNA bending. Depending upon its
concentrations relative to DNA templates, Px could either stimulate or
inhibit in vitro transcription of the major regulatory
nodulation gene nodD. This may result from its property to
bind to specific sites within nod promoters at lower concentration or in the presence of competitor calf thymus DNA but
nonspecifically associate with DNA at higher levels or in the absence
of competitors. Its binding sites within nodD and nodF promoters were determined by DNase I footprinting but
showed no sequence consensus. N-terminal sequencing and Western blot revealed that Px belongs to the HU class of prokaryotic histone-like proteins. Its binding feature and functioning mechanism were discussed in the light of this discovery.
The nodulation of legumes by (brady)rhizobia involves multiple
interactions between both symbiotic partners, and many of the concerned
genes have been identified. Rhizobial nodulation genes (nod
or nol or noe) are the major genetic determinants
of the host specificity of the bacteria (1, 2). In fast growing rhizobia such as Rhizobium leguminosarum and Rhizobium
meliloti, most nodulation genes are located in a Sym(biosis)
megaplasmid, and their products are involved in the synthesis of Nod
factors, which are lipo-chito-oligosaccharides composed of oligomers of Failure to induce nod promoters in Escherichia
coli even in the presence of corresponding NodD indicated that in
addition to the Sym plasmid, other genetic components of bacteria might also influence the expression of nodulation genes (5). Screening mutant
strains with reporter genes as indicators has led to the identification
of chromosomal loci that are involved in nod gene regulation. In R. meliloti, Kondorosi et al. (6,
7) demonstrated that nolR represses nod gene
expression, and Ogawa and Long (8) showed a role for a specific
groEL gene in nod gene expression. In R. leguminosarum, Mavridou et al. (9)
identified an allele-specific dctB mutation that lowered
nod gene expression (9).
During the analysis of interaction of NodD with the nod box
in R. leguminosarum, Hong et al. observed a
NodD-independent retardation of a nodA-nodD intergenic
fragment in electrophoresis mobility shift assay (10), indicating that
there existed protein(s) other than NodD binding to nodD
(nodA) promoter. In this work we proved that the retardation
was caused by a single protein with apparent Mr
of 10,300 and substantially purified this protein (named Px). We
analyzed its interaction with nodD and nodF
promoters and studied its effects on nodD transcription in
an in vitro system. Px was determined to be a member of
prokaryotic histone-like proteins homologous to HU in E. coli. HU has long been regarded as an architectural protein
involved in DNA compaction, recombination, repair, transcription and
transposition by binding to DNA without sequence conservation (11-13),
but in recent years its recognition of specific DNA sites with
structural irregularities was more underscored (14-19). After comparing with HU homologues in other systems, we suggested that Px
displayed some new characteristics with regard to its DNA binding feature.
Bacterial Strains and Buffers--
E. coli DH5 Plasmids and DNA Fragments-- pKT230 (23), broad host range vector, Kmr, Strr; pIJ1518 (22), pKT230 with a 1.7-kilobase pair BclI fragment containing the nodD gene under the control of the promoter of streptomycin resistance gene, Kmr; pBend2 (24), a plasmid vector designed for bending assay; pBendAD12 and pBendF12, recombinant plasmids with AD12 and F12 fragments (see below) cloned at the filled-in unique SalI site of pBend2, respectively; pUC18AD and pUC119F, constructed by recloning PstI-EcoRI inserts from M13mp8-IJ487 and M13mp8-IJ1549 (10, 25) into pUC18 and pUC119, respectively. Fragments AD13 and F14 were prepared through SalI/EcoRI digestion of pUC18AD and pUC119F, respectively (Fig. 1). Fragment AD12 was generated by polymerase chain reaction amplification on fragment AD13 with primers gggaaTTCGTTTTTTAGTTCC and GTCGAGTGCTACAAGAAGGTTTAGA (lowercase letters are additional nucleotides for EcoRI digestion). After cutting with EcoRI, it was filled-in and cloned into pBend2. Fragment F12 was one of the three sub-fragments of F14 obtained by digestion with HinfI (Fig. 1). It was also cloned into pBend2 after filling-in with Klenow. For bending assays, permutated fragments were prepared by cutting pBendAD12 or pBendF12 with a set of chosen restriction enzymes. DelA, DelB, and DelC fragments were mutants of AD13, deleting from nodD toward nodA (26, 27).
Purification of Proteins-- Two forms of Px of different purity were used through this work. The purification process was monitored by gel retardation (radiolabeled AD13 fragment as probe) and SDS-polyacrylamide gel electrophoresis using the Schagger and von Jagow system (28). Form I Px was prepared through affinity column chromatography with pUC119F DNA as ligands. 12 mg pUC119F DNA was embedded in 10 ml of 4% agarose to make a DNA affinity column as described before (29, 30). 10 g wet weight of R. leguminosarum 8401(pIJ1518) was resuspended in 50 ml of TEB15 and sonicated for 30 s × 20 times at 80% output power (Ultrasonics W375 sonicator). The lysate was centrifuged at 100,000 × g for 1 h, and the supernatant was recycled overnight through the pUC119F DNA affinity column. The column was washed with TEB15 to base line then eluted with TEB15 ~ TEB100 linear gradient. Px peak appeared at about 0.3 M NaCl, whereas NodD appeared at 0.45 M NaCl. The peak tubes were pooled, concentrated in 30% PEG 6000 (prepared in TEB15), dialyzed against TEB15 containing 50% glycerol, then stored at 20 °C.
Form II Px was purified to much higher homogeneity. To 80 ml of
ultracentrifuged supernatant prepared as in Form I Px, streptomycin sulfate was added to the final concentration of 2% (w/v). After stirring for 1 h in an ice bath, the mixture was centrifuged at 10,000 rpm for 10 min. The resulting supernatant was then subject to
fractionation by ammonium sulfate precipitation. The fraction between
30% ~ 60% saturity was resuspended in TEB15 and dialyzed, then
applied to a P11 column (2×10.2 cm). The column was washed with TEB15
and eluted with 120 ml of TEB15 ~ TEB100 linear salt gradient.
Px activity eluted at about 0.65 M NaCl. The pooled fractions were concentrated and dialyzed against TEB5, then loaded onto
a column of DE-52 (1.5 × 7 cm). The column was washed with TEB5
and eluted with a linear gradient from TEB5 to TEB100. The flow-through
and a few foremost fractions displaying Px activity were combined and
adjusted to be of equal conductivity to TEB20, then directly pumped to
a pre-equilibrated heparin-Sepharose CL 6B column (1.5 × 9 cm).
The column was washed thoroughly then eluted with 100 ml of TEB20 ~ TEB120 linear gradient. Px was recovered in fractions around 0.5 M NaCl, concentrated, and kept as Form I Px.
In reference to the previous protocols (31, 32), RNA polymerase of
R. leguminosarum 8401 was purified to at least 95% pure by
estimating the Coomassie Blue-stained SDS gel of 5 µg of protein. The
details will be reported elsewhere. The protein concentration was
determined using Bio-Rad protein assay reagents with bovine IgG as the
standard protein.
Gel Retardation-- Gel retardation (33) was performed in 10 µl of final volume of 20 mM Tris-HCl, pH 8.0, at 25 °C, 100 mM KCl, 5 mM MgCl2, 5 mM CaCl2, 0.1 mM EDTA, 0.1 mM dithiothreitol, 50 µg/ml bovine serum albumin, 50 ~ 100 µg/ml ctDNA, 3% glycerol. Labeled DNA fragments (usually 1-10 ng and 500-1,000 cpm) and protein preparation (usually 0.1-1 µg) were incubated at 28 °C for 15 min, then loaded onto 5% nondenaturing polyacrylamide gel (8 × 8 cm). The gel was run at 150 V for 1.5 h then dried and autoradiographed for visualization. DNA Bending Assay--
To examine DNA bending, permutated DNA
fragments obtained by digestion of pBendA12 or pBendF12 with
appropriate restriction enzymes were labeled at their 5' termini with
[ DNase I and 1,10-Phenanthroline-Copper (OP-Cu)1 Footprinting-- DNase I protection experiments were carried out using end-labeled DNA fragments according to Galas and Schmitz (34) with some modifications. The binding buffer was the same as that for gel retardation except lacking glycerol and containing 33 µg/ml ctDNA as competitor. Px and labeled DNA were incubated at 28 °C for 30 min in the 30-µl volume, then 2 µl of DNase I (2 µg/ml, 4 units/µg, Boerhinger Mannheim) was added to digest for 30 s. The reaction was terminated by mixing with 8 µl of 1.5 M sodium acetate, pH 5.2, containing 20 mM EDTA, 100 µg/ml yeast tRNA and extracting with phenol-chloroform. The aqueous phase was precipitated with ethanol, and the samples were analyzed on 6% denaturing polyacrylamide gel. OP-Cu footprinting (35) was performed on the gel slice containing the Px·DNA complex formed between labeled fragment AD13 and crude extract of R. leguminosarum 8401(pIJ1518) (10). N-terminal Amino Acid Sequencing-- Form II Px was blotted to polyvinylidene difluoride membrane from SDS gel according to standard protocol (20). The membrane was stained with Coomassie Brilliant Blue, and the band with apparent Mr of 10,300 was excised and subjected to N-terminal sequence analysis on automatic sequencer ABI Model 491A. Western Blot-- Electroblotted proteins on BA-85 membrane was probed with anti-E. coli HU antiserum (a gift from G. Chaconas) and goat anti-rabbit IgG-horseradish peroxidase conjugate. In Vitro Transcription--
Single-round transcription was
carried out basically as described previously (36). Fragment AD13 (7 ng) and R. leguminosarum 8401 RNA polymerase (3 µg) was
incubated at 28 °C for 20 min in a 20-µl volume containing 40 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 2 mM spermidine-HCl, 0.15 M KCl, 0.1 mM EDTA, 0.1 mM dithiothreitol, 1 unit/µl
RNasin, 100 µg/ml bovine serum albumin. Then 10 µl of prewarmed
NTP/heparin mixture (0.15 mM ATP, GTP, CTP; 0.015 mM UTP; 200 µg/ml heparin; 10 µCi
[
Purification of Px-- As introduced above, several chromosomal loci in rhizobia have been found to affect the expression of nodulation genes in recent years (6-9). To search for additional regulators, we remembered a previous observation in gel retardation assay. Crude cell-free extract of R. leguminosarum 8401(pIJ1518) formed two retarded complexes with radiolabeled fragment AD13 (10). Although the one migrating slower had been ascribed to be NodD·DNA complex (10), the nature of the other remained obscure. We studied that complex and found it contained a proteinaceous factor not encoded by Sym plasmid or broad host range vector pKT230, for the extracts from bacterial strains lacking either plasmid still kept the binding activity, but the retardation disappeared after protease treatment of binding reactions(data not shown). The factor was tentatively called Px and inferred to be encoded by the bacterial chromosome or the other two megaplasmids present in R. leguminosarum 8401(21). Cao and Hong (30) previously described a method to enrich NodD by stepwise elution of a pUC119F DNA affinity column after loading the lysate of R. leguminosarum 8401 (pIJ1518) (30). As described under "Experimental Procedures," we applied a linear salt gradient to elute such a column. Such a modification successfully separated Px activity from NodD, the former being eluted at 0.3 M NaCl, whereas NodD eluted at 0.45 M. The Px preparation thus obtained was immediately used to study its DNA binding properties and was later called Form I Px (Fig. 2A, lane 1).
Px Binds to Specific Sites within nodA-nodD Intergenic Region and nodF Promoter-- At the initial stage of this study the binding characteristics of Px were examined with Form I preparation. When the protein was kept at low level or sufficient competitor ctDNA was present in the binding reactions, one retarded band with nodA-D probe (AD13) and two with nodF probe (F14) could be observed. However, as the amount of the protein was raised and no competitor ctDNA was added, a ladder of complexes or an aggregate appeared on the gel (Fig. 3). This result implicates that Px displays two sides when binding to DNA. One is that it shows nonspecific affinity to DNA molecules. The other is that Px prefers some sites to others; when possible it will occupy these sites first. This conclusion was ascertained through performing similar experiments with Form II Px. Comparable results excluded the possible interference of contaminants in Form I preparation.
DNA Sites Protected by Px Showed Little Sequence Conservation-- Form I Px was used in DNase I footprinting experiments to map its binding sites within nodA-nodD intergenic region and nodF promoter. Fig. 6 summarized the footprinting results. One site in AD13 and two sites in F14 were reproducibly protected using different batches of protein and probes, agreeing well with the results of gel retardation. Inclusion of ctDNA in the reactions is necessary to discern these specific sites. In its absence the overall protection along the probes could be observed, reflecting the nonspecific binding side of Px (not shown). For the protected sequences, the most striking feature was that they share no observable sequence consensus; even the length of footprints varied to a considerable extent. The longest protected stretch spanned 54 bases with several uncovered gaps, whereas the shortest extended only 21 bases. At least on fragment AD13 the protected region was further verified by DNase I footprinting with highly purified Form II Px and direct OP-Cu footprinting in the gel slice. The protection pattern on this fragment remains unchanged when using purified Px (not shown), whereas the footprint acquired by OP-Cu nuclease is localized at nearly the same area, largely overlapping that delineated by DNase I footprinting (Fig. 6C).
Px Induces DNA Bending-- The importance of intrinsic and protein-induced DNA bending has been demonstrated in many situations. Such DNA structural distortions may have regulatory implications themselves, or they lead to the interaction of proteins bound at distant sites on DNA, thus provide more regulatory schemes (38). Protein-induced DNA bending can be measured by gel retardation using a set of permutated DNA fragments as described previously (39). To analyze Px-induced bending in the nodA-nodD intergenic region, a polymerase chain reaction-amplified fragment AD12 (Fig. 1) was cloned into the pBend2 vector, which is designed to facilitate the bending assay. A series of DNA fragments of equal length could then be conveniently obtained by cutting pBendAD12 with selected restriction enzymes and labeled for gel retardation. As shown in Fig. 7A, these equal-length free DNA fragments exhibited nearly the same mobilities after electrophoresis, indicating no significant intrinsic bending in AD12. Nevertheless, the Px·DNA complexes migrated with markedly different retardation, depending on the location of the Px binding site relative to the ends of these fragments. A similar phenomenon was also seen when using DNA fragments prepared by digesting pBendF12 (Fig. 7B). These observations strongly suggest that Px bends nod promoters upon binding to them.
/2), where µM and
µE stand for the gel mobilities of DNA molecules that have a
bend at their middle (fastest migrating) and at their ends (slowest
migrating), respectively, and is the angle by which DNA deflects
from linearity. Following this equation (complex with MluI
fragment as the slowest for AD12), we found that the bend angles
induced by Px are 77° and 44° for fragments AD12 and F12,
respectively. As pointed out before, the bending degrees might be
underestimated because the binding sites cannot actually be placed at
the ends of permutated fragments even for the fastest migrating ones.
Even so, the bendings caused by Px are remarkable, and they are
reasonably presumed to result in great conformational changes of DNA
and affect the action of other proteins binding to nod
promoters.
Px Affects nodD Transcription in Vitro-- An in vitro transcription system has been established with purified RNA polymerase from R. leguminosarum 8401.2 Using fragment AD13 as the template, two major specific transcripts could be observed, both orienting toward nodD (Fig. 8A). When increasing amounts of Form II Px were included in the transcription reactions, the output of nodD transcripts was found to be differentially affected depending on the relative concentration of Px. At first the transcription from both nodD promoters was stimulated with the raising of Px concentration (Fig. 8A, lanes 2-4). The highest enhancement occurred at the ratio of 120 ng of Px/7 ng of AD13 fragment. But after that point, further increase of Px led to the diminishing of nodD transcripts (Fig. 8A, lanes 5-6). Fig. 8B showed the results of scanning the intensities of nodDp1 transcript in the presence of different amounts of Px. Compared with the control reaction (no Px), the production of nodDp1 rose about 1.43-fold when 120 ng of Px was added, whereas 720 ng of Px reduced the transcription to only 94% that of the control level. The results could be explained by the characteristics of Px binding to and bending nod promoters. At relatively lower concentration, Px may specifically land on its preferential site in AD13 then induce or stabilize particular conformation of the fragment to favor the action of RNA polymerase on the nodD promoter. Here it is interesting to notice that the binding site of Px is located downstream of that of RNA polymerase, extending into the reading frame of nodD gene. When too much Px (compared with template DNA) exists, it not only protects the specific site, but also attaches to the other parts of the DNA molecules, even coating the whole length of them (referring to Fig. 2), impeding RNA polymerase access to nodD promoters, thus inhibiting the initiation of nodD transcription.
Px Is a HU-like Protein-- The molecular weight, bending capability, nonspecific binding to DNA and no sequence consensus between specific binding sites suggested that Px have some relations to those proteins that bind to DNA without or with loose sequence specificity, such as histone-like proteins HU, H-NS, and general regulator Lrp in E. coli (for reviews, see Refs. 38 and 41). N-terminal sequencing of Form II Px revealed that its first 10 amino acids were MNKNELVSAV. In a database search, the sequence showed extensive homology to N-terminal of HU proteins from diverse sources and was completely identical to that of HU1rle and HU2rle (42), two E. coli HU counterparts isolated from different strains of R. leguminosarum. Consequently we assume that Px is a HU-like protein. The conclusion was supported by Western blot, showing that Px reacted with anti-HU antibody (Fig. 2B) and also by the fact that Px binding activity survived 30 min boiling at 100 °C(not shown), indicating its heat-stable property just as HU protein (11, 17).
To characterize new regulators of nodulation genes in R. leguminosarum, we studied a rhizobial protein Px that formed complexes with nod promoters even in the challenge of a 1,000-fold excess of nonspecific competitor ctDNA. It was also found to affect nodD transcription in an in vitro system. The DNA regions protected by this protein within nodA-nodD intergenic region and nodF promoter were both determined by footprinting techniques but showed no observable sequence consensus. The apparently confusing result could be reconciled with the discovery that Px is a HU-like protein. We will discuss the properties and functions of Px in this context. Binding Features of Px-- HU protein is an abundant, small, basic, and dimeric protein associated to the bacterial nucleoid in E. coli. It is also a ubiquitous protein, and its sequence is highly conserved among prokaryotes. Its family members have been found to play important roles in many biological processes and thought to exert effects by binding to DNA without sequence specificity (11). However, in recent years, several labs reported that HU-like proteins show preferential binding to supercoiled DNA (43), to DNA sites containing sharp bends, kinks, cruciform or bulged structures, or to DNA containing single-strand breaks or gaps (14-19). They were thus proposed to recognize structural peculiarities of DNA and share functional similarity to eukaryotic chromatin-associated HMG1-like proteins (12, 13). But until a few years ago the experiments were unsuccessful to determine the specific binding sites of HU-like proteins by common footprinting techniques. Later, by converting HU protein itself into a chemical nuclease, its specific binding sites in the Mu transpososome and gal promoter were resolved (14, 19). The residues protected by HU were mapped by hydroxyl radical footprinting on a HU-cruciform-DNA complex (16). DNase I footprinting failed on all these occasions, but it succeeded more recently in defining two binding sites of a HU homologue in the replication-enhancing region of plasmid pKYM in Shigella sonnei (18). In this case the specific binding was observed only when the sequence-specific RepK protein bound to contiguous cognate site (18). The scenario occurred in gal promoter too, where specific binding of HU entirely depended upon binding of GalR to the two operators (19). Compared with the above examples, it is striking that Px binding sites within nod promoters were so easily detected. This became even more attractive considering that no sequence-specific DNA-binding proteins are needed as prerequisites, and DNA probes were in linear forms without specially designed structural irregularities (including intrinsic bends). One of the reasons to explain the novelties of Px binding may be the stability and easy recognition of a particular conformation adopted by DNA fragments containing nod promoters. We noticed that the contents of A/T nucleotides in the determined Px binding sites within nod promoters were always more than 50%, and A/T usually appeared in clusters. Besides, several palindromic sequences could be identified in or around protected regions (Fig. 6). Such characteristics might favor the extrusion of cruciform structures (16), although preliminary examination with S1 nuclease did not discover a sensitive single-strand hairpin region in fragment AD13 (not shown). The actual mechanism underlying the selectivity of binding sites of Px remains elusive. Considering its activator nature in nodD transcription, another surprise concerning Px binding feature is that it binds downstream of the nodD promoter. At present we think that Px may function by bending DNA molecules and through this promoting the formation of the transcriptionally competent open complex. But once the open complex is formed, Px may be dispensable just as activator cAMP-CRP at E. coli lac promoter (44).Px May Affect in Vivo Transcription of nodD--
Originally HU was
discovered as a factor that stimulates transcription of the
bacteriophage ), they found that -galactosidase activities of
both deleted constructs dropped down to about half of that of wild
type, from 806.4 Miller units of wild type to 439.4 units (DelA) and
404.8 units (DelB). This observation agreed well with the results of in vitro experiments. As demonstrated in Fig. 8, Px
stimulates nodD transcription upon specific binding. Since
disruption of target sites abolished Px binding to DelA and DelB
fragments (Fig. 5), those promoters consequently lost the stimulation
of Px and therefore exhibited lower expression. For confirmation of
in vivo effects, it is interesting to test if overexpression
of px gene will inhibit transcription of nodD in
rhizobia. Since NodD is the major regulator of the whole nod
regulon, characterization of its own modulators such as Px is of great
importance for the research on nodulation.
We are grateful to S. Adhya for providing pBend2, to G. Chaconas for presenting anti-HU antibody, and to J. A. Downie for reading the preliminary manuscript and suggestions. We are also indebted to Laigen Xu for amino acid sequencing.
* The work was supported by a grant from Pan-Deng Plan of China (to G.-F. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The abbreviations used are: OP-Cu, 1,10-Phenanthroline-Copper; ct, calf thymus. 2 S.-T. Liu, H.-L. Hu, G.-S. G., and G.-F. Hong, unpublished data.
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||