|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 32, 20615-20621, August 7, 1998
From the The sodium/myo-inositol cotransporter
is a plasma membrane protein responsible for concentrative cellular
accumulation of myo-inositol in a variety of tissues. When
cells in kidney and brain are exposed to a hyperosmolar salt condition
(hypertonicity) due to the operation of urinary concentration mechanism
and pathological conditions, respectively, they survive the stress of
hypertonicity by raising the cellular concentration of
myo-inositol. Transcription of the
sodium/myo-inositol cotransporter gene is markedly
stimulated in response to hypertonicity, leading to an increase in the
activity of the cotransporter, which in turn drives the osmoprotective accumulation of myo-inositol. To understand the molecular
mechanisms by which hypertonicity stimulates transcription, we analyzed
the 5'-flanking region of the cotransporter gene for
cis-acting regulatory sequences. We identified five
tonicity-responsive enhancers that are scattered over 50 kilobase
pairs. All the enhancers are variations of the same type of enhancer
interacting with the transcription factor named tonicity-responsive
enhancer binding protein. In vivo methylation
experiments demonstrated that exposure of cells to hypertonicity
increases the binding of tonicity-responsive enhancer binding protein
to the enhancer sites, indicating that all of these enhancers are
involved in the transcriptional stimulation. We conclude that the
sodium/myo-inositol cotransporter gene is regulated by a
large region (~50 kilobase pairs) upstream of the gene.
The sodium/myo-inositol cotransporter
(SMIT)1 is a plasma membrane
protein catalyzing concentrative uptake of myo-inositol (MI)
using the electrochemical gradient of sodium across the cell membrane
(1). Since two sodium ions are coupled per molecule of MI (2), SMIT can
transport MI against a 1,000-fold concentration gradient,
i.e. 50 mM in a cell versus 50 µM in the plasma. The level of SMIT activity determines
the steady-state cellular concentration of MI at the point where uptake
and leak balance out.
SMIT is most abundantly expressed in the kidney medulla (1, 3), which
is hypertonic most of the time because of the operation of the urinary
concentration mechanisms. The high level of SMIT expression in the
renal medulla is secondary to the hypertonicity of this tissue in that
SMIT mRNA abundance changes pari passu with the tonicity
of the medulla (3, 4). The changes in mRNA abundance are primarily
due to changes in transcription (5). When SMIT is inhibited under
hypertonic conditions in cultured cells (6) or in kidneys in
vivo (7), cells undergo necrosis demonstrating the importance of
maintaining a high level of SMIT activity in a hypertonic
environment.
How elevated SMIT activity protects the renal cells is explained by the
theory of compatible osmolytes (8). It is useful to note that
osmolarity inside a mammalian cell is always in equilibrium with
interstitial osmolarity because blood facing plasma membranes are
highly permeable to water and very compliant mechanically. Immediately
after cells are exposed to hypertonicity, cellular ionic strength is
elevated due to osmosis. When the cells are kept in hypertonicity for
more than several hours, they accumulate small organic solutes called
compatible osmolytes and, as a result, lower cellular ionic strength
toward the isotonic level. If and when accumulation of compatible
osmolytes is prevented, cells do not survive (6, 7, 9), probably
because of the effects of elevated cellular ionic strength (8). The
major compatible osmolytes in the hypertonic medulla are MI, betaine,
sorbitol, taurine, and glycerophosphorylcholine (10). Like MI,
accumulation of betaine and sorbitol is also regulated at the level of
transcription; hypertonicity stimulates transcription of the genes for
the sodium- and chloride-coupled betaine/ During hypernatremia, which results in systemic hypertonicity, brain
(15), and eye (16) accumulate compatible osmolytes including MI. SMIT
mRNA is expressed throughout brain in neurons and glial cells (17)
and in eye (18). Hypernatremia increases the abundance of SMIT mRNA
in brain (17, 19) and eye (18), presumably due to an increase in
transcription. Thus, the SMIT gene in non-renal cells responds to
hypertonicity in the same way as it does in renal cells.
Studies of regulatory cis-elements involved in the
regulation of transcription uncovered two tonicity-responsive enhancers (TonEs) within 185 bp upstream of the BGT1 gene
(20).2 The AR gene is
regulated by three TonEs located about 1 kb upstream of the
transcription start site (21). All the TonEs of the BGT1 and AR genes
are functionally the same; they share a high level of sequence
similarity, and all of them specifically bind to a nuclear protein
named TonE-binding protein (TonEBP) (22). Cloning of TonEBP revealed
that it is a transcription factor mediating the effect of
TonE.3 When kidney-derived
MDCK cells are exposed to hypertonicity, the activity of TonEBP is
stimulated leading to the binding of TonEBP to TonE sites of the BGT1
gene and concurrent stimulation of transcription (22). Thus,
stimulation of TonEBP activity is central to the hypertonicity-induced
stimulation of transcription.
In this study, the 5'-flanking region of the SMIT gene is analyzed to
identify regulatory cis-elements. Five TonEs spread over 50 kb are identified. All of them appear to contribute to the regulation
of SMIT gene transcription, indicating that regulation of SMIT involves
unusually but not unprecedentedly long range interactions between
regulatory sequences and promoter.
Cell Culture--
MDCK cells were maintained in defined medium
as described previously (5). HeLa cells were maintained in Eagle's
spinner modification of minimum essential medium (Biofluids)
supplemented with 5% horse serum. Medium was made hypertonic by adding
200 mM raffinose to defined medium or 100 mM
NaCl to Eagle's spinner modification of minimum essential medium.
Restriction Mapping of P1 Clones and Localization of SacI
Fragments--
DNA from two P1 clones, 3283 and 3284 (23), was
digested with NotI, ClaI, or MluI and
then size-fractionated by pulse-field electrophoresis using the
following settings: initial A time 1 s, final A time 10 s,
A/B ratio of 1,200 V, run time 20 h in 0.5× TBE containing 45 mM Tris, 45 mM borate, and 1 mM
EDTA. Southern blots were prepared and probed with T7 and SP6
oligonucleotides (specific for the P1 vector sequence flanking the
cloning site) as well as various restriction fragments to delineate the
restriction map shown in Fig. 1. To localize the S14 and S31 fragments
(Fig. 1), P1 clones 3283 and 3284 were linearized with NotI
digestion and then a series of SacI partial digestions with
progressively less amount of enzyme were obtained. Southern blots of
the partially digested DNA was hybridized to T7 oligonucleotide to
determine the location of S14 and S31 fragments. The results were
confirmed by hybridization of S14 and S31 fragments to Southern blots
of P1 DNA.
Subcloning of 5'-Flanking Region of the Human SMIT Gene and
Reporter Plasmid Construction--
In order to obtain subclones of the
5'-flanking region of the human SMIT gene, DNA from the P1 3283 was
digested with SacI and shot-gun cloned in pBluescriptII
(Stratagen). Clones derived from the 5'-flanking region were identified
by hybridization to Southern blots of NotI-digested P1 clone
3283. Nine non-overlapping SacI clones that cover 47 kb out
of the 60-kb 5' franking region of human SMIT gene (see Fig. 1) were
obtained. To test tonicity-responsive regulatory activity of the
SacI fragments, each SacI fragment was subcloned
in front of the SMIT promoter (( Site-directed Mutagenesis--
TonE sequences in the S14-c and
S14-g fragments (Fig. 3) were mutated to inactivate their enhancer
activity using PCR. To mutate TonEA, fragment S14-c was separately
amplified with two pairs of primers. The first pair was
gggctgcatTGGGTGTTTTTATGGGA (primer A1; the sequence at one end of S14-c
is in uppercase letters, and the PstI site added is shown in
lowercase letters) and GCTCTTGGTcGTTaTCaACTTGC (TonEA
portion is underlined (antisense strand); lowercase letters represent
mutations) while the second pair was
GCAAGTtGAtAACgACCAAGAGC (TonEA portion is underlined (sense
strand); lowercase letters represent mutations) and
gggctgacgGCGGAACAGCAGAT (primer A2; the sequence at one end of S14-c is
in uppercase letters, and the PstI site added is shown in
lowercase letters). To generate S14-c with mutations in TonEA, aliquots
(1 µl each) of the two PCR products were mixed and subjected to PCR
amplification using primer A1 and A2. The resulting mutations were
confirmed by sequencing. TonEB2 in the S14-g was mutated in the same
way using the following two sets of primers: gggctgcagGAATTCCACATTTCGTT
(primer B1) and GATGTTTGGcATTaTCaAGCTAA (TonEB2/3 is
underlined; antisense strand); TTAGCTtGAtAATgCCAAACATC
(TonEB2/3 is underlined; sense strand) and gggctgcagAAGCTTCTTTCCTAGTC
(primer B2). These mutations in TonEB2 are also expected (22) to
inactivate TonEB3, which overlaps with TonEB2 in the antisense
direction (see Table II). All the mutant fragments were sequenced
completely to confirm the mutations and also to verify that the
sequence outside the TonE regions remain unchanged.
Transcription of the Sodium/myo-Inositol
Cotransporter Gene Is Regulated by Multiple Tonicity-responsive
Enhancers Spread over 50 Kilobase Pairs in the 5'-Flanking Region*
,,,, and¶
Division of Nephrology, Johns Hopkins School
of Medicine, Baltimore, Maryland 21205 and the § Department
of Pediatrics, University of Pennsylvania School of Medicine,
Philadelphia, Pennsylvania, 19104
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-aminobutyric
acid transporter (BGT1) and aldose reductase (AR: catalyzes synthesis
of sorbitol), leading to an increase in their activity, which results
in an increase in cellular concentration of betaine and sorbitol (11).
The signal for stimulation of transcription is most likely the cellular ionic strength because induction of AR correlates highly with the sum
of cellular sodium and potassium concentration (12). The abundance of
BGT1 (13) and SMIT (14) mRNA also correlates positively with
cellular ionic strength.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
128/+134) fragment) and the
luciferase reporter gene using pGL2-basic (Promega) (23). Some of the
SacI fragments displaying enhancer activity were divided into smaller fragments (see Fig. 2), which were again tested for tonicity-responsive enhancer activity as above. Likewise, synthetic DNA
fragments (Table I and Fig. 3) were also tested for tonicity-responsive enhancer activity.
Cell Transfection--
The reporter plasmid constructs were
transfected into MDCK cells using the DEAE-dextran method as described
previously (22). Briefly, 2 µg of each reporter construct or 10 ng of
-actin construct (the luciferase gene under the strong promoter of
the -actin gene) was transfected with 50 ng of pRL/CMV, a plasmid
containing the Renilla luciferase gene under control of CMV
promoter. Transfected cells were cultured in isotonic defined medium
for 20 h and then for an additional 20 h in isotonic or
hypertonic medium. Cell extracts were prepared, and the activity of
Photinus and Renilla luciferase was determined
using dual-luciferase reporter assay system (Promega). For each
extract, the activity of the Photinus luciferase was divided
by the activity of the Renilla luciferase to correct for
transfection efficiency. Under each tonicity condition, i.e.
isotonic or hypertonic, the corrected activity from cells transfected
with a test construct was again divided by that from cells transfected
with the -actin construct. The resulting luciferase activity
standardized for the -actin promoter was used to calculate -fold
induction of luciferase by hypertonicity: activity of luciferase in
hypertonic medium divided by activity of luciferase in isotonic medium.
Each experiment (n = 1) was performed in duplicate
dishes.
Preparation of Nuclear Extracts and Electrophoretic Mobility Shift Assay (EMSA)-- MDCK cells or HeLa cells cultured in isotonic or hypertonic medium were chilled to 4 °C, and nuclear extracts were prepared as described previously (22). To prepare probes for EMSA shown in Table I, single-stranded oligonucleotides were synthesized and purified. 200 pmol each of complementary oligonucleotides were annealed in 100 µl containing 100 mM NaCl to obtain a double-stranded probe. Five µg of nuclear extract was incubated initially for 10 min at room temperature in 20 µl containing 20 mM HEPES (pH 7.9), 100 mM KCl, 0.1 mM EDTA, 10% glycerol, 1 mM dithiothreitol, and 1.5 µg of poly(dA-dT), 5 mM MgCl2. The mixture was then incubated for an additional 20 min after adding 32P-labeled probe with or without an unlabeled competitor. The reaction was electrophoresed on a 4% polyacrylamide gel (79:1, acrylamide:bis) in 0.5× TBE buffer. The gel was dried and exposed to a PhosphorImage screen. The radioactivity was visualized and quantified using PhosphorImager and ImageQuant software (Molecular Dynamics).
In Vivo Footprinting-- In order to methylate G residues of the genomic DNA in vivo, HeLa cells in isotonic or hypertonic medium were incubated in the same medium containing 0.1% dimethyl sulfate for 2 min at room temperature. Cells were washed with phosphate-buffered saline twice to remove dimethyl sulfate, and DNA was isolated. The methylated DNA was converted to a single-stranded form and cleaved at sites immediately 3' to the methylated G residues by treatment with piperidine (Sigma) at 90 °C for 30 min. The cleaved G residues were detected using ligation-mediated PCR as described (22). The cleaved DNA was annealed to primer AP1 (CTCACTGTTCAACAAAAGCCC), BP1 (GTGACCTCATGGGTGGTGGT), CP1 (GATAGAATGAGGTGGGAGGA), or pP1 (GAATGTTCCAGAACCCCTG) to synthesize the first strand DNA covering the TonEA, TonEB2, TonEC2, or TonEp region, respectively. A staggered double-stranded linker (22) was ligated, and 18 cycles of PCR were performed at the specific annealing temperature using a nested primer: AP2 (CTCCCATGCAGTGAAGAGCTGGCCC), BP2 (TGGGGAAGACAGCAGCAGAAGCAAG), CP2 (GAGGCAGGCAGCTTGGAACCAAGAA), or pP2 (TTCCAGAACCCCTGCGAGCAGCCGTT). Two additional rounds of PCR were performed using a 32P-labeled nested primer. The reaction was electrophoresed on a sequencing gel with sequencing ladder. Radioactivity was detected and quantified as described above.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
Localization of Tonicity-responsive Enhancer Activity in the
5'-Flanking Region of the SMIT Gene--
Previously, we cloned the
canine SMIT gene and a total of 15 kb of flanking sequence (11 kb from
the 5' side and 4 kb from the 3' side) from overlapping 
clones
(24). When we examined the entire cloned region including the flanking
regions for tonicity-responsive regulatory activity, we detected only a
small tonicity-responsive enhancer activity, less than 2-fold
stimulation of the SMIT promoter in response to hypertonicity (see
below), which is localized within (2,900/119) relative nucleotide
region. Other investigators (16) studying the bovine SMIT gene reported
a TonE sequence similar to those of the BGT1 and AR genes (22) at
(346/336) relative nucleotide position. This enhancer stimulates
the SMIT promoter about 2-fold in response to hypertonicity (16).
Because transcription of the SMIT gene is stimulated over 10-fold under the same hypertonic conditions (5, 16), we anticipated more regulatory
sequences outside (further upstream and/or downstream) the cloned
region. To explore this possibility, we decided to search further
upstream of the gene for more tonicity-responsive regulatory sequences.
We turned to the two P1 clones (23), which contain the human SMIT gene
and about 60 kb of 5'-flanking sequence (Fig.
1). The structure and sequence of the
human SMIT gene is very similar to that of the canine gene (23). In
addition, like the canine SMIT gene, the immediate 5'-flanking region
of the human SMIT gene, the (2,444/130) relative nucleotide region, also displayed small tonicity-responsive enhancer activity (23).
|
|
Characterization of SMIT Tonicity-responsive Enhancers -- The DNA fragments S14 and S31 were divided into smaller restriction fragments and tested for tonicity-responsive enhancer activity (Fig. 2). The enhancer activity of S14 was narrowed to two small fragments: S14-c (357 bp) and S14-g (588 bp). Likewise, the enhancer activity of S31 was confined to an 877-bp fragment named S31-d. Sequencing of these fragments revealed that each of them contains one or more sequences (Table II) that fit the consensus of TonEs for the BGT1 and AR genes (22): YGGAANNNYNY (Y is C or T; N is any nucleotide). We investigated whether these TonEs are indeed responsible for the enhancer activity.
S14-c has only one TonE named TonEA. When three of the key residues (22) of TonEA were mutated to inactivate it (see "Experimental Procedures"), the enhancer activity of S14-c was lost; -fold induction of luciferase decreased from 2.66 (S14-c) to 1.44 (S14-c/mTonEA, Fig. 3). It was concluded that TonEA was responsible for the enhancer activity of S14-c.
|
|
|
|
2,444/130) relative nucleotide region, which
displayed a moderate tonicity-responsive enhancer activity (23),
revealed a TonE sequence named TonEp at (331/321) position (Table
II). TonEp is also found at (346/336) position of the bovine SMIT
gene and has been shown to display small TonE activity: 1.5-2-fold
induction (16). We conclude that TonEp is most likely responsible for
the enhancer activity of the (2,444/130) region (see more
below).
EMSA of SMIT TonEs-- Previously, we identified a 200-kDa nuclear protein of MDCK cells named TonEBP, which displays very slow mobility in non-denaturing gel electrophoresis (22). Recent cloning of TonEBP3 demonstrate that it is a transcription factor mediating the enhancer activity of TonEs. Since the SMIT TonEs described above are of human origin, we searched for human cells to study the regulation of SMIT transcription. We found that HeLa cells expressed SMIT and AR mRNA, the abundance of which was stimulated ~10-fold by hypertonicity as in MDCK and other kidney-derived cells (data not shown). Nuclear extracts of HeLa cells displayed TonEBP bands in EMSA gels when "hTonE," a prototypical TonE (22), was used as a probe (Fig. 4A, right); TonEBP of HeLa cells were indistinguishable (data not shown) from TonEBP of MDCK cells in their binding specificity described previously (22). On the other hand, all the other bands including the dominant band in the HeLa lanes about a third of the way down do not display correct binding specificity, indicating that they are not TonEBP: they are either not competed by active TonE sequences or competed by inactive TonE sequences (data not shown). We conclude that HeLa cells possess functional TonEBP.
When TonEA was used as a probe, TonEBP are also detected from MDCK and HeLa cells as expected (Fig. 4A, left). To quantify binding of the SMIT TonEs to TonEBP, we measured the ability of each SMIT TonE to compete hTonE binding to TonEBP as described in the legend for Fig. 4B. Under these conditions, functional (or active) TonEs compete better than 50% (22). As shown in Fig. 4B, all the active SMIT TonEs (TonEA, TonEB(2/3), TonEC1, TonEC2, and TonEp) competed away more than 60% of hTonE binding, demonstrating that these TonEs are functional, consistent with the data presented in Fig. 4. On the other hand, TonEB1 and TonEC3 competed poorly, in keeping with their lack of enhancer activity (Fig. 4B). Collectively, the data in Figs. 3 and 4 prove that the SMIT TonEs reported here are functionally identical to the TonEs of the BGT1 and AR genes (22).Increase in Site Occupancy of the SMIT TonEs in Response to
Hypertonicity--
When MDCK cells are exposed to hypertonicity,
activity of TonEBP is markedly stimulated, leading to an increase in
TonEBP binding to the TonE sites upstream of the BGT1 gene and
stimulation of BGT1 transcription (22).2 The increase in
TonEBP activity in HeLa cells in response to hypertonicity (Fig. 4)
predicts that there should be a parallel increase in binding of TonEBP
to the SMIT TonEs. To address this issue directly, we performed
in vivo footprinting assays where methylation of G residues
on HeLa genomic DNA by treatment with dimethyl sulfate was measured
using quantitative PCR as described under "Experimental
Procedures." Nested PCR primers were designed to examine regions
covering TonEA, TonEB2, TonEC2, and TonEp (Fig. 5). We did not detect any consistent
change in methylation outside the TonE sites described below. In TonEA,
methylation of the 2nd and 3rd G residues is decreased by 46% in
hypertonicity. Likewise, methylation of the 2nd G in TonEB2 and TonEC2
was inhibited by 36 and 33%, respectively. In TonEB2 and TonEC2, the
3rd G residues were not methylated even in control DNA (data not
shown), indicating that these nucleotides are inaccessible to dimethyl
sulfate. It was not possible to examine the TonEp region in the sense
direction because (300/50) region is GC-rich (83%) and repetitive.
We managed to come up with a pair of PCR primers covering TonEp in the
antisense direction. G residues complementary to the last two C
residues were protected from methylation by 30% in hypertonicity. Collectively, the data in Fig. 5 demonstrate that activated TonEBP gets
access to and binds to all the SMIT TonEs spread over 50 kb, providing
in vivo functional support to the idea that all the TonEs
contribute to the stimulation of transcription by hypertonicity.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
When kidney-derived cells are challenged with hypertonicity, transcription of the SMIT (5), BGT1 (25), and AR (26) genes increases over 10-fold. Expression of the reporter gene controlled by two TonEs2 and the promoter within 185 bp of the BGT1 gene (20) or three TonEs ~1 kb upstream of the AR gene and its promoter (21) is also stimulated over 10-fold by hypertonicity. On the other hand, ~3 kb immediate upstream of the SMIT gene containing a TonE (TonEp) induces reporter gene expression at most 2-fold in response to hypertonicity (16, 23, 24), indicating that the major cis-regulatory sequences are outside this region. Our previous efforts (24) established that the putative major regulatory sequences are outside the 52 kb of the cloned canine genomic region containing the entire SMIT gene, 11 kb of 5'-flanking, and 4 kb of 3'-flanking sequence. The data presented in this paper demonstrate that the additional regulatory sequences are spread in the region 15-55 kb upstream of the human gene as a form of four TonEs: TonEA, TonEB2, TonEC1, and TonEC2. The five TonEs (including TonEp) would provide enough additive enhancer activity to account for greater than 10-fold stimulation of transcription in response to hypertonicity. The most convincing support for this idea is the in vivo footprinting data (Fig. 5), which show that at least four out of the five TonE sites are active in that binding to these sites is increased under hypertonicity as in the TonE sites of the BGT1 gene (22).2
The osmo-protective accumulation of compatible osmolytes is conserved throughout evolution (8). Interestingly, the role of transcription is also widely conserved. In bacteria, transcription of the Pro U operon is markedly stimulated by hypertonicity, resulting in an increase in the activity of the ATP-consuming betaine transporter and accumulation of betaine (27). In yeast, transcription of GPD1 is stimulated by hypertonicity leading to an increased synthesis and accumulation of glycerol (28), which is the major yeast compatible osmolyte. Exposure of plants including sugar beet, spinach, and barley to high salt environments results in transcriptional stimulation of the betaine aldehyde dehydrogenase gene and consequent synthesis and accumulation of betaine (29). The molecular basis for the foregoing transcriptional regulation is not clear. Transcriptional regulation is far better understood for accumulation of MI, betaine, and sorbitol in mammalian cells. This work and previous studies (22) collectively demonstrate that a cis-element TonE and its cognate transcription factor TonEBP play the central role in the hypertonicity-induced stimulation of the SMIT, BGT1, and AR genes.
The consensus sequence of TonE, YGGAAnnnYnY (Table II), was based on (a) seven known TonE sequences at the time and (b) analysis of nine TonE mutants where each mutant has a single nucleotide mutated in one of nine different positions (22). Inspection of five additional TonEs identified in this paper provides further insight into the consensus. Most TonEs, 10 out of 11 known TonEs so far (TonEC1 is the same as hTonE in Ref. 22), start with T rather than C. The sixth nucleotide ("n" in the consensus) is A in all the TonEs, even though mutating A to T affects its activity only moderately (22). Therefore, a more definitive consensus sequence is TGGAAAnnYnY (Table II). In DNA with random sequence, this sequence should be present on average 1 in every 16 kb. This should be an underestimate because certain nucleotides are flexible, i.e. the first and sixth nucleotides. In this regard, the 5'-flanking region of the SMIT gene is not particularly rich in TonEs: Five TonEs in ~50 kb recovered from 60 kb of the 5'-flanking region or an average of one in every ~10 kb, a value close to the expected frequency. This contrasts with the BGT1 and AR genes, where TonEs are more concentrated near the promoter; two TonEs within 185 bp upstream of the BGT1 gene and three TonEs within 1.2 kb upstream of the AR gene. It is possible that the five SMIT TonEs spread over 50 kb are physically close to the promoter, perhaps by way of multiple long range looping, and act additively to stimulate the SMIT promoter. This is based on the observation that bringing TonEC1 and TonEC2 closer (from 494 bp apart in S31-d to 20 bp apart in TonEC123; Fig. 3) increases the enhancer activity. The binding of TonEBP to the TonE sites in hypertonicity (Fig. 5) may facilitate the looping or reorganization of local chromatin structure to enable additive action of the bound TonEBP to the promoter.
Regulation of transcription by enhancers located far from the gene is
well established. In the locus control region for the -globin gene
cluster, five enhancers spread over 15 kb are believed to function as a
single unit or holocomplex where all the enhancers are brought close to
each other (30). In adult erythrocyte precursors, the locus control
region stimulates transcription of the -globin gene located some 40 kb downstream (30). Studies involving homologous deletion of genomic
sequences in mice revealed that the insulin-like growth factor 2 gene
is regulated by a pair of enhancers ~90 kb away from the gene (31).
Although the insulin-like growth factor 2 and -globin genes are
regulated by imprinting and developmental cues, respectively, the
distant enhancers and the locus control region are constitutively
active in adult tissues. In contrast, the SMIT TonEs are regulated by
ever-changing fluctuations in tonicity. In this regard, the SMIT TonEs
are a rare and important model system that provides an unusual
opportunity to study the role of chromatin structure in regulation of
gene expression in response to physiological and pathological
signals.
| |
ACKNOWLEDGEMENT |
|---|
We thank S. K. Woo for providing nuclear extracts of HeLa cells.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant DK42479 (to H. M. K.), a fellowship from the Juvenile Diabetes Foundation International (to J. S. R.), and National Research Service Awards Grants DK07712 and DK09469 (to M. G. A.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom all correspondence should be addressed: 963 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205. Tel.: 410-614-0085; Fax: 410-614-5129; E-mail: mkwon{at}welchlink.welch.jhu.edu.
The abbreviations used are:
SMIT, the
sodium/myo-inositol cotransporterMI, myo-inositolBGT1, the sodium- and chloride-coupled
betaine/-aminobutyrate transporterAR, aldose reductaseTonE, tonicity-responsive enhancerTonEBP, TonE-binding proteinEMSA, electrophoretic mobility shift assayMDCK, Madin-Darby canine kidneyPCR, polymerase chain reactionbp, base pair(s)kb, kilobase
pair(s).
2 H. Miyakawa, J. S. Rim, and H. M. Kwon, unpublished observations.
3 H. Miyakawa, S. K. Woo, and H. M. Kwon, unpublished observations.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
-
Kwon, H. M.,
Yamauchi, A.,
Uchida, S.,
Preston, A. S.,
Garcia-Perez, A.,
Burg, M. B.,
and Handler, J. S.
(1992)
J. Biol. Chem.
267,
6297-6301
[Abstract/Free Full Text] - Hager, K., Hazama, A., Kwon, H. M., Loo, D. D. F., Handler, J. S., and Wright, E. M. (1995) J. Membr. Biol. 143, 103-113[Medline] [Order article via Infotrieve]
- Yamauchi, A., Miyai, A., Shimada, S., Minami, Y., Tohyama, M., Imai, E., and Kamada, T. (1995) J. Clin. Invest. 96, 1195-1201
- Yamauchi, A., Nakanishi, T., Takamitsu, Y., Sugita, M., Imai, E., Noguchi, T., Fujiwara, Y., Kamada, T., and Ueda, N. (1994) J. Am. Soc. Nephrol. 5, 62-67[Abstract]
-
Yamauchi, A.,
Uchida, S.,
Preston, A. S.,
Kwon, H. M.,
and Handler, J. S.
(1993)
Am. J. Physiol.
264,
F20-F23
[Abstract/Free Full Text] -
Kitamura, H.,
Yamauchi, A.,
Nakanishi, T.,
Takamitsu, Y.,
Sugiura, T.,
Akagi, A.,
Moriyama, T.,
Horio, M.,
and Imai, E.
(1997)
Am. J. Physiol.
272,
F267-F272
[Abstract/Free Full Text] - Kitamura, H., Yamauchi, A., Sugiura, T., Matsuoka, Y., Horio, M., Tohyama, M., Shimada, S., Imai, E., and Hori, M. (1998) Kidney Int. 53, 146-153[CrossRef][Medline] [Order article via Infotrieve]
-
Yancey, P. H.,
Clark, M. E.,
Hand, S. C.,
Bowlus, R. D.,
and Somero, G. N.
(1982)
Science
217,
1214-1222
[Abstract/Free Full Text] - Uchida, S., Kwon, H. M., Yamauchi, A., Preston, A. S., Marumo, F., and Handler, J. S. (1991) J. Clin. Invest. 88, 656-662
-
Garcia-Perez, A.,
and Burg, M. B.
(1991)
Physiol. Rev.
71,
1081-1115
[Abstract/Free Full Text] - Kwon, H. M., and Handler, J. S. (1995) Curr. Opin. Cell Biol. 7, 465-471[CrossRef][Medline] [Order article via Infotrieve]
-
Uchida, S.,
Garcia-Perez, A.,
Murphy, H.,
and Burg, M. B.
(1989)
Am. J. Physiol.
256,
C614-C620
[Abstract/Free Full Text] -
Ferraris, J. D.,
Burg, M. B.,
Williams, C. K.,
Peters, E. M.,
and Garcia-Perez, A.
(1996)
Am. J. Physiol.
270,
C650-C6514
[Abstract/Free Full Text] - Kwon, H. M. (1993) in Cellular and Molecular Physiology of Cell Volume Regulation (Strange, K., ed), pp. 383-394, CRC Press, Boca Raton, FL
- Gullans, S. R., and Verbalis, J. G. (1993) Annu. Rev. Med. 44, 289-301[CrossRef][Medline] [Order article via Infotrieve]
- Zhou, C., and Cammarata, P. (1997) Exp. Eye Res. 35, 349-363
- Minami, Y., Inoue, K., Shimada, S., Morimura, H., Miyai, A., Yamauchi, A., Matsunaga, T., and Tohyama, M. (1996) Mol. Brain Res. 40, 64-70[Medline] [Order article via Infotrieve]
- Morimura, H., Shimada, S., Otori, Y., Yamauchi, A., Minami, Y., Inoue, K., Miyai, A., Ishimoto, I., Tano, Y., and Tohyama, M. (1996) Mol. Brain Res. 35, 333-338[Medline] [Order article via Infotrieve]
-
Ibsen, L.,
and Strange, K.
(1996)
Am. J. Physiol.
271,
F877-F885
[Abstract/Free Full Text] -
Takenaka, M.,
Preston, A. S.,
Kwon, H. M.,
and Handler, J. S.
(1994)
J. Biol. Chem.
269,
29379-29381
[Abstract/Free Full Text] -
Ko, B. C. B.,
Ruepp, B.,
Bohren, K. M.,
Gabbay, K. H.,
and Chung, S. S. M.
(1997)
J. Biol. Chem.
272,
16431-16437
[Abstract/Free Full Text] -
Miyakawa, H.,
Woo, S. K.,
Chen, C. P.,
Dahl, S. C.,
Handler, J. H.,
and Kwon, H. M.
(1998)
Am. J. Physiol.
274,
F753-F761
[Abstract/Free Full Text] - Mallee, J. J., Atta, M. G., Lorica, V. L., Rim, J. S., Kwon, H. M., Lucente, A. D., Wang, Y., and Berry, G. T. (1997) Genomics 46, 459-465[CrossRef][Medline] [Order article via Infotrieve]
- Rim, J. S., Tana, S., Takenaka, M., Handler, J. S., and Kwon, H. M. (1997) Arch. Biochem. Biophys. 341, 193-199[CrossRef][Medline] [Order article via Infotrieve], 1997
- Uchida, S., Yamauchi, A., Preston, A. S., Kwon, H. M., and Handler, J. S. (1993) J. Clin. Invest. 91, 1604-1607
-
Smardo, F. L.,
Burg, M. B.,
and Garcia-Perez, A.
(1992)
Am. J. Physiol.
262,
C776-C782
[Abstract/Free Full Text] -
Lucht, J. M.,
Dersch, P.,
Kempf, B.,
and Bremer, E.
(1994)
J. Biol. Chem.
269,
6578-6586
[Abstract/Free Full Text] -
Albertyn, J.,
Hohmann, S.,
Thevelein, J. M.,
and Prior, B. A.
(1994)
Mol. Cell. Biol.
14,
4135-4144
[Abstract/Free Full Text] - Ishitani, M., Nakamura, T., Han, S. Y., and Takabe, T. (1995) Plant Mol. Physiol. 27, 307-315
- Wijgerde, M., Grosveld, F., and Fraser, P. (1995) Nature 377, 209-213[CrossRef][Medline] [Order article via Infotrieve]
-
Leighton, P. A.,
Saam, J. R.,
Ingram, R. S.,
Stewart, C. L.,
and Tilgman, S. M.
(1995)
Genes Dev.
9,
2079-2089
[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Grewal, N. Defamie, X. Zhang, S. De Gois, A. Shawki, B. Mackenzie, C. Chen, H. Varoqui, and J. D. Erickson SNAT2 Amino Acid Transporter Is Regulated by Amino Acids of the SLC6 {gamma}-Aminobutyric Acid Transporter Subfamily in Neocortical Neurons and May Play No Role in Delivering Glutamine for Glutamatergic Transmission J. Biol. Chem., April 24, 2009; 284(17): 11224 - 11236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Hasler Controlled aquaporin-2 expression in the hypertonic environment Am J Physiol Cell Physiol, April 1, 2009; 296(4): C641 - C653. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. K. Hoffmann, I. H. Lambert, and S. F. Pedersen Physiology of Cell Volume Regulation in Vertebrates Physiol Rev, January 1, 2009; 89(1): 193 - 277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Rodgaard, K. Schou, M. B. Friis, and E. K. Hoffmann Does the intracellular ionic concentration or the cell water content (cell volume) determine the activity of TonEBP in NIH3T3 cells? Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1528 - C1534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Saito, T. Saito, K. Kasono, H. Tamemoto, M. Kawakami, S. Sasaki, and S.-e Ishikawa Hypotonicity reduces the activity of murine aquaporin-2 promoter induced by dibutyryl cAMP Exp Physiol, October 1, 2008; 93(10): 1147 - 1156. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bissonnette, K. Lahjouji, M. J. Coady, and J.-Y. Lapointe Effects of hyperosmolarity on the Na+-myo-inositol cotransporter SMIT2 stably transfected in the Madin-Darby canine kidney cell line Am J Physiol Cell Physiol, September 1, 2008; 295(3): C791 - C799. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Xu, C. C. L. Wong, E. H. Y. Tong, S. S. M. Chung, J. R. Yates III, Y. Yin, and B. C. B. Ko Phosphorylation by Casein Kinase 1 Regulates Tonicity-induced Osmotic Response Element-binding Protein/Tonicity Enhancer-binding Protein Nucleocytoplasmic Trafficking J. Biol. Chem., June 20, 2008; 283(25): 17624 - 17634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Lee, M. Kim, Y. S. Im, W. Choi, S. H. Byeon, and H. K. Lee NFAT5 Induction and Its Role in Hyperosmolar Stressed Human Limbal Epithelial Cells Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1827 - 1835. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kosuge, A. I. Chuang, S. Uematsu, K. P. Tan, K. Ohashi, B. C.B. Ko, and S. Ito Discovery of Osmosensitive Transcriptional Regulation of Human Cytochrome P450 3As by the Tonicity-Responsive Enhancer Binding Protein (Nuclear Factor of Activated T Cells 5) Mol. Pharmacol., October 1, 2007; 72(4): 826 - 837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ito, Y. Fujio, K. Takahashi, and J. Azuma Degradation of NFAT5, a Transcriptional Regulator of Osmotic Stress-related Genes, Is a Critical Event for Doxorubicin-induced Cytotoxicity in Cardiac Myocytes J. Biol. Chem., January 12, 2007; 282(2): 1152 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. O'Connor, S. T. Mills, K. A. Jones, S. N. Ho, and G. K. Pavlath A combinatorial role for NFAT5 in both myoblast migration and differentiation during skeletal muscle myogenesis J. Cell Sci., January 1, 2007; 120(1): 149 - 159. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Padda, A. Wamsley-Davis, M. C. Gustin, R. Ross, C. Yu, and D. Sheikh-Hamad MEKK3-mediated signaling to p38 kinase and TonE in hypertonically stressed kidney cells Am J Physiol Renal Physiol, October 1, 2006; 291(4): F874 - F881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-T. Tsai, K. G. Danielson, A. Guttapalli, E. Oguz, T. J. Albert, I. M. Shapiro, and M. V. Risbud TonEBP/OREBP Is a Regulator of Nucleus Pulposus Cell Function and Survival in the Intervertebral Disc J. Biol. Chem., September 1, 2006; 281(35): 25416 - 25424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. H. Y. Tong, J.-J. Guo, A.-L. Huang, H. Liu, C.-D. Hu, S. S. M. Chung, and B. C. B. Ko Regulation of Nucleocytoplasmic Trafficking of Transcription Factor OREBP/TonEBP/NFAT5 J. Biol. Chem., August 18, 2006; 281(33): 23870 - 23879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Neuhofer and F.-X. Beck Survival in Hostile Environments: Strategies of Renal Medullary Cells Physiology, June 1, 2006; 21(3): 171 - 180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Hasler, U. S. Jeon, J. A. Kim, D. Mordasini, H. M. Kwon, E. Feraille, and P.-Y. Martin Tonicity-Responsive Enhancer Binding Protein Is an Essential Regulator of Aquaporin-2 Expression in Renal Collecting Duct Principal Cells J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1521 - 1531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Yang, A. D. Hodgkinson, P. J. Oates, H. M. Kwon, B. A. Millward, and A. G. Demaine Elevated activity of transcription factor nuclear factor of activated T-cells 5 (NFAT5) and diabetic nephropathy. Diabetes, May 1, 2006; 55(5): 1450 - 1455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Hasler, M. Vinciguerra, A. Vandewalle, P.-Y. Martin, and E. Feraille Dual Effects of Hypertonicity on Aquaporin-2 Expression in Cultured Renal Collecting Duct Principal Cells J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1571 - 1582. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rojek, J. Nielsen, H. L. Brooks, H. Gong, Y.-H. Kim, T.-H. Kwon, J. Frokiaer, and S. Nielsen Altered expression of selected genes in kidney of rats with lithium-induced NDI Am J Physiol Renal Physiol, June 1, 2005; 288(6): F1276 - F1289. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Prabhu, R. J. Arner, H. Vunta, and C. C. Reddy Up-regulation of Human myo-Inositol Oxygenase by Hyperosmotic Stress in Renal Proximal Tubular Epithelial Cells J. Biol. Chem., May 20, 2005; 280(20): 19895 - 19901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang, B. C. B. Ko, J. Y. Yang, T. T. L. Lam, Z. Jiang, J. Zhang, S. K. Chung, and S. S. M. Chung Transgenic Mice Expressing Dominant-negative Osmotic-response Element-binding Protein (OREBP) in Lens Exhibit Fiber Cell Elongation Defect Associated with Increased DNA Breaks J. Biol. Chem., May 20, 2005; 280(20): 19986 - 19991. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kasono, T. Saito, T. Saito, H. Tamemoto, C. Yanagidate, S. Uchida, M. Kawakami, S. Sasaki, and S.-e Ishikawa Hypertonicity regulates the aquaporin-2 promoter independently of arginine vasopressin Nephrol. Dial. Transplant., March 1, 2005; 20(3): 509 - 515. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Umenishi, S. Yoshihara, T. Narikiyo, and R. W. Schrier Modulation of Hypertonicity-Induced Aquaporin-1 by Sodium Chloride, Urea, Betaine, and Heat Shock in Murine Renal Medullary Cells J. Am. Soc. Nephrol., March 1, 2005; 16(3): 600 - 607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sheikh-Hamad and M. C. Gustin MAP kinases and the adaptive response to hypertonicity: functional preservation from yeast to mammals Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1102 - F1110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Umenishi and R. W. Schrier Hypertonicity-induced Aquaporin-1 (AQP1) Expression Is Mediated by the Activation of MAPK Pathways and Hypertonicity-responsive Element in the AQP1 Gene J. Biol. Chem., April 25, 2003; 278(18): 15765 - 15770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Storm, E. Klussmann, A. Geelhaar, W. Rosenthal, and K. Maric Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells Am J Physiol Renal Physiol, January 1, 2003; 284(1): F189 - F198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. C. B. Ko, A. K. M. Lam, A. Kapus, L. Fan, S. K. Chung, and S. S. M. Chung Fyn and p38 Signaling Are Both Required for Maximal Hypertonic Activation of the Osmotic Response Element-binding Protein/Tonicity-responsive Enhancer-binding Protein (OREBP/TonEBP) J. Biol. Chem., November 22, 2002; 277(48): 46085 - 46092. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Trama, W. Y. Go, and S. N. Ho The Osmoprotective Function of the NFAT5 Transcription Factor in T Cell Development and Activation J. Immunol., November 15, 2002; 169(10): 5477 - 5488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Woo, S. D. Lee, K. Y. Na, W. K. Park, and H. M. Kwon TonEBP/NFAT5 Stimulates Transcription of HSP70 in Response to Hypertonicity Mol. Cell. Biol., August 15, 2002; 22(16): 5753 - 5760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. R Alfieri, A. Cavazzoni, P. G. Petronini, M. A Bonelli, A. E Caccamo, A. F Borghetti, and K. P Wheeler Compatible osmolytes modulate the response of porcine endothelial cells to hypertonicity and protect them from apoptosis J. Physiol., April 15, 2002; 540(2): 499 - 508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. CHA, S. K. WOO, K. H. HAN, Y. H. KIM, J. S. HANDLER, J. KIM, and H. M. KWON Hydration Status Affects Nuclear Distribution of Transcription Factor Tonicity Responsive Enhancer Binding Protein in Rat Kidney J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2221 - 2230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Ferraris and A. Garcia-Perez Osmotically Responsive Genes: The Mammalian Osmotic Response Element (ORE) Integr. Comp. Biol., August 1, 2001; 41(4): 734 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Matsuzaki, T. Suzuki, and K. Takata Hypertonicity-induced expression of aquaporin 3 in MDCK cells Am J Physiol Cell Physiol, July 1, 2001; 281(1): C55 - C63. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Franchi-Gazzola, R. Visigalli, V. Dall'Asta, R. Sala, S. K. Woo, H. M. Kwon, G. C. Gazzola, and O. Bussolati Amino acid depletion activates TonEBP and sodium-coupled inositol transport Am J Physiol Cell Physiol, June 1, 2001; 280(6): C1465 - C1474. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Graef, J. M. Gastier, U. Francke, and G. R. Crabtree Evolutionary relationships among Rel domains indicate functional diversification by recombination PNAS, May 8, 2001; 98(10): 5740 - 5745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Dahl, J. S. Handler, and H. M. Kwon Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP Am J Physiol Cell Physiol, February 1, 2001; 280(2): C248 - C253. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Trama, Q. Lu, R. G. Hawley, and S. N. Ho The NFAT-Related Protein NFATL1 (TonEBP/NFAT5) Is Induced Upon T Cell Activation in a Calcineurin-Dependent Manner J. Immunol., November 1, 2000; 165(9): 4884 - 4894. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. BAGNASCO, T. PENG, Y. NAKAYAMA, and J. M. SANDS Differential Expression of Individual UT-A Urea Transporter Isoforms in Rat Kidney J. Am. Soc. Nephrol., November 1, 2000; 11(11): 1980 - 1986. [Abstract] [Full Text]
|
|
|
|
|
|
S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity Am J Physiol Renal Physiol, June 1, 2000; 278(6): F1006 - F1012. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Hoffert, V. Leitch, P. Agre, and L. S. King Hypertonic Induction of Aquaporin-5 Expression through an ERK-dependent Pathway J. Biol. Chem., March 17, 2000; 275(12): 9070 - 9077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Woo, D. Maouyo, J. S. Handler, and H. M. Kwon Nuclear redistribution of tonicity-responsive enhancer binding protein requires proteasome activity Am J Physiol Cell Physiol, February 1, 2000; 278(2): C323 - C330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tsukaguchi, S. Weremowicz, C. C. Morton, and M. A. Hediger Functional and molecular characterization of the human neutral solute channel aquaporin-9 Am J Physiol Renal Physiol, November 1, 1999; 277(5): F685 - F696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Bai, J. F. Collins, Y. L. Muller, H. Xu, P. R. Kiela, and F. K. Ghishan Characterization of cis-elements required for osmotic response of rat Na+/H+ exchanger-2 (NHE-2) gene Am J Physiol Regulatory Integrative Comp Physiol, October 1, 1999; 277(4): R1112 - R1119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Miyakawa, S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity PNAS, March 2, 1999; 96(5): 2538 - 2542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Nakayama, T. Peng, J. M. Sands, and S. M. Bagnasco The TonE/TonEBP Pathway Mediates Tonicity-responsive Regulation of UT-A Urea Transporter Expression J. Biol. Chem., December 1, 2000; 275(49): 38275 - 38280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Nahm, S. K. Woo, J. S. Handler, and H. M. Kwon Involvement of multiple kinase pathways in stimulation of gene transcription by hypertonicity Am J Physiol Cell Physiol, January 1, 2002; 282(1): C49 - C58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Fenton, C. A. Cottingham, G. S. Stewart, A. Howorth, J. A. Hewitt, and C. P. Smith Structure and characterization of the mouse UT-A gene (Slc14a2) Am J Physiol Renal Physiol, April 1, 2002; 282(4): F630 - F638. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. R. Alfieri, A. Cavazzoni, P. G. Petronini, M. A. Bonelli, A. E. Caccamo, A. F. Borghetti, and K. P. Wheeler Compatible osmolytes modulate the response of endothelial cells to hypertonicity and protect them from apoptosis J. Physiol., February 22, 2002; (2002) 200101339. [Abstract] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |