![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 33, 20702-20711, August 14, 1998
1 Gene Promoter by
Mineralocorticoid and Glucocorticoid Receptors*
,
,
, and
¶
From the
Department of Biochemistry and Molecular
Pharmacology, Thomas Jefferson University, Philadelphia,
Pennsylvania 19107 and the § Department of Molecular
Genetics, Biochemistry and Microbiology, University of
Cincinnati, Cincinnati, Ohio 45267
| |
ABSTRACT |
|---|
|
|
|---|
Expression of the human Na/K-ATPase
1 subunit
is regulated by a mineralocorticoid- and glucocorticoid-responsive
elements. Here we identified an MR and GR responsive element, at
positions
650 to
630, within the
1 gene promoter that is
required for both MR and GR activation. Independent expression of MR
and GR activated by aldosterone or triamcinolone acetonide (TA) leads to significant transactivation of the
1 promoter. Yet coexpression of both receptors activated by aldosterone plus TA or cortisol results
in a much lower induction, indicating that coexpression of MR and GR is
inhibitory. Gel shift mobility assay using an oligonucleotide including
the 21-base pair MRE/GRE with whole cell extracts prepared from CV-1
cells overexpressing MR or GR showed specific MR and GR binding to this
sequence. Additionally, antibodies to both MR and GR effectively
supershifted the protein-DNA complexes, indicating that these receptors
bound to the DNA sequence. Finally, the 21-base pair MRE/GRE was
capable of activating transcription from a heterologous promoter in
response to both aldosterone and TA. Together these data indicate that
the 21-base pair sequence represents a true MRE/GRE and that optimal
activation of the human Na/K-ATPase
1 promoter is controlled by
mineralocorticoid and glucocorticoid hormones. It appears that an
interaction of MR with GR on the
1 promoter effectively
down-regulates transcription.
| |
INTRODUCTION |
|---|
|
|
|---|
Na/K-ATPase is an integral membrane protein responsible for the
transport of sodium and potassium across the plasma membrane in an
ATP-dependent manner (for review, see Refs. 1 and 2). Na/K-ATPase is composed of two subunits, the
subunit (113 kDa) which mediates the catalytic activity, and the smaller glycosylated
subunit (35 kDa) whose exact function is unclear (3). It has been
proposed that it may be involved in the localization of the enzyme to
the plasma membrane, protein folding, or stabilization of the
K+-bound form of the enzyme (4). Na/K-ATPase is encoded by
a multigene family and isoforms were described for both the
(
1,
2, and
3) and the
(
1,
2, and
3) subunits (5-7).
Expression of these isoforms occurs in a tissue-specific manner (8).
While the
1 and
1 isoforms are expressed in most tissues,
2 is
predominant in skeletal muscle and can be detected in the brain and
heart, whereas
3 is found in excitable tissues. The
2 and
3
isoforms are mostly found in neural tissues (4).
Aldosterone and glucocorticoid hormones regulate the expression of the
and
subunits of the Na/K-ATPase genes (9, 10). This regulation
by steroid hormones was shown to occur in a tissue-specific manner.
Aldosterone but not dexamethasone activates Na/K-ATPase gene expression
in cardiac cells while the reverse is observed in colonic cells,
suggesting that both mineralocorticoid and glucocorticoid receptors (MR
and GR)1 are
involved in the regulation of the enzyme and non-receptor factors might
be involved in conferring mineralocorticoid versus glucocorticoid specificity (11). MR is highly homologous to the GR (12,
13) which enhances expression of target genes by binding to specific
promoter DNA sequences. These sequences consist in imperfect inverted
hexanucleotide repeats separated by 3 nucleotides (GGTACA NNN TGTTCT),
known as the glucocorticoid response element (GRE) (for review, see
Refs. 14 and 15). MR was shown to bind, in vitro, to GRE
sequences (14, 16), but no distinct mineralocorticoid response element
(MRE) has ever been identified in genes induced by aldosterone.
In the current study, we examined the promoter region of the human
Na/K-ATPase
1 gene subunit, for the presence of putative glucocorticoid or mineralocorticoid response elements (GRE or MRE). We
also analyzed the regulation of Na/K-ATPase
1 gene promoter by MR or
GR or coexpression of both receptors. This included both transcriptional and DNA binding studies. Our results show that, both MR
and GR are able to activate the Na/K-ATPase
1 gene promoter. Using
5' deletion constructs and electrophoretic mobility shift assays, we
identified a functional GRE/MRE at position
650 of the Na/K-ATPase
1 gene promoter for both glucocorticoid and mineralocorticoid. In
addition we show that co-transfection of both receptors inhibits transcription from the Na/K-ATPase
1 gene promoter.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials--
All hormones were purchased from Sigma. RU38486
was a gift from Roussel Uclaf (Romainville, France). Stock solutions
were prepared in ethanol. Stock solutions were at 10
3
M for aldosterone and TA and at 10
2
M for cortisol, RU38846, and spironolactone. 1 µl of
hormone solution was mixed with 10 ml of cell culture medium for each experiment.
Plasmids--
Construction of the luciferase plasmids containing
the human Na/K-ATPase
1 gene promoter (pH
1-1141Luc) or various
lengths of the 5'-flanking region (pH
1-726Luc, pH
1-554Luc,
pH
1141*(643-327)Luc, pH
1-456-luc, pH
1-327-luc, and
pH
1-83Luc) was described previously (17). A pH
1CAT promoter
vector was constructed. A double-stranded synthetic oligonucleotide
1MRE and
1mutMRE containing either a wild type sequence of the
human Na/K-ATPase
1 gene promoter from
662 to
628
(GGGTTTGGCAATTGTCCTGCTCGAGGTGGTTCAGG) or a
deletion at bases
650 to
645, were inserted into a BglII site, upstream of the SV40 promoter in the pCAT promoter vector (Promega, Madison, WI). The structures of these plasmids called pH
1MRE CAT and pH
1mutMRE CAT were confirmed by sequencing.
Expression plasmids for the human mineralocorticoid receptor (RshMR)
and the human glucocorticoid receptor (RshGR) were a generous gift from
R. M. Evans. The GRE TKCAT plasmid was provided by G. Schutz.
-Galactosidase expression plasmid (Rsv-
-gal) and 7Zf+
were purchased from Promega (Madison, WI).
Cell Culture and Transfection--
CV-1 cells were grown in
Dulbecco's modified Eagle's medium supplemented with 10% fetal calf
serum (Life Technologies, Inc.), penicillin at 100 units/ml, and
streptomycin at 100 µg/ml. Cells were washed 3 times with
phosphate-buffered saline and 8 × 104 cells were
plated overnight on 100-mm dishes in duplicates, in Dulbecco's
modified Eagle's medium supplemented with charcoal-stripped, steroid-free fetal calf serum. Cells were transfected by the calcium phosphate method with 10 µg of pH
1-1141Luc containing the human Na/K-ATPase
1 gene promoter or various lengths of the 5'-flanking region fused to a promoterless luciferase gene in pOLuc reporter plasmid (Promega), and 1 µg of the expression plasmid for the human
MR (RshMR) or 1 µg of the human GR (RshGR), or 1 µg of each receptor expression plasmid along with 5 µg of
-galactosidase expression plasmid (Rsv-
-gal) and 7Zf+ carrier DNA to a
total of 20 µg. Cells were incubated with DNA precipitates for
18 h, washed 3 times with phosphate-buffered saline and refed with
fresh medium supplemented with 100 nM aldosterone and 1 µM RU 38486 in MR transfections; 100 nM
triamcinolone acetonide (TA) and 1 µM spironolactone in
GR transfections and 1 µM cortisol when both MR and GR
were co-transfected. Forty-eight hours later, cells were harvested and
cell extracts were assayed for luciferase activity.
1 MRE
CAT or
1 mut MRE CAT construct and 1 µg of RshMR or RshGR, or 1 µg of each receptor, along with 5 µg of Rsv-
-gal and
7Zf+ carrier DNA to a total of 20 µg. Following 24 h
of hormone treatment as above, cell extracts were prepared and
processed for CAT enzyme-linked immunosorbent assay analysis
(Boehringer Mannheim).
Luciferase and CAT values were all normalized to
-galactosidase
activity as follows. For each experiment, cells were co-transfected with equal amounts (1 µg) of Rsv-
-galactosidase reporter plasmid (Rsv-
-gal) and each transfection was carried out in duplicate.
-Galactosidase activity was evaluated for all samples by measuring the absorbance of the o-nitrophenol at 420 nm, produced by
transformation of the substrate
o-nitrophenyl-
-D-galactopyranoside, by the
-galactosidase enzyme contained in cell extracts. Differences in the
-galactosidase activity were expressed as a fraction (highest
activity divided by the other values). Luciferase and CAT values were
then normalized to
-galactosidase activity by multiplying the
luciferase or CAT value by the corresponding
-galactosidase ratio
for the same transfection.
COS-1 cells were grown and transfected as described above, with 7 µg
of receptor expression vector RshMR or RshGR, and 3 µg of
7Zf+ plasmid. When both MR and GR were co-transfected,
carrier DNA was supplemented to a total of 20 µg. Hormone incubations
were conducted for 2 h as above and cells were washed and pellets
stored at
80 °C, for preparation of whole cell extracts for
in vitro DNA binding analysis.
Preparation of Whole Cell Extract-- For luciferase and CAT assays, cell extracts were prepared from CV-1 cells as recommended by the manufacturers (Promega and Boehringer Mannheim). Pellets from transfected COS-1 cells were thawed on ice and homogenized by 20 strokes in ice-cold buffer containing 20 mM Tris-HCl (pH 7.4), 600 mM KCl, 20% glycerol, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, and 5 µg/ml antipain, using a glass homogenizer. The homogenate was centrifuged (75,000 × g at 4 °C) for 30 min to obtain whole cell extract.
Electrophoretic Mobility Shift Assay--
A double-stranded
oligonucleotide corresponding to the wild type human Na/K-ATPase
1
gene (
wt MRE) from position
662 to
628
GGGTTTGGCAATTGTCCTGCTCGAGGTGGTTCAGG, or including different deletions (
1 mutMRE 1 to
1 mutMRE 5), were synthesized (Fig. 5A). A GRE 31 oligomer consisting of two GREs
(TGTACAGGATGTTCT)2, separated by 16 base pairs, was obtained by excising the GRE 31 TK-CAT plasmid using
BamHI and HindIII digestion. GRE 31 and
1 wt
MRE were filled using the Klenow fragment (Boehringer Mannheim) and
labeled by incorporating [
-32P]dCTP (NEN Life Science
Products Inc.) and were used as probes. Whole cell extract of cells
overexpressing MR or GR or both MR and GR (3 to 6 µg) were incubated
on ice for 10 min in 10 mM Tris-HCl (pH 7.5), 80 mM KCl, 10% glycerol, 1 mM dithiothreitol, 1 mM poly(dI-dC), in a total volume of 18 µl. An anti-GR
polyclonal antibody (
GR), directed against the DNA-binding domain,
or an anti-MR polyclonal antibody (
MR) recognizing the N terminus
and the DNA-binding domain, as well as a preimmune serum were included
in reaction mixtures where indicated. A 50-200-fold excess of
unlabeled oligonucotide was used in competition reactions. 0.1 ng of
5'-32P-end labeled GRE 31 or
1 MRE was added to the
reaction and incubation was continued for 10 min at room temperature.
Reaction mixtures were applied to a 4% nondenaturing polyacrylamide
gel and DNA-protein complexes were resolved by electrophoresis (250 mV)
at 4 °C, with buffer recirculation in 1 × TAE (6.7 mM Tris-HCl (pH 7.5), 3.3 mM sodium acetate, 1 mM EDTA). The gel was dried under vacuum and
autoradiographed at
80 °C.
| |
RESULTS |
|---|
|
|
|---|
Both Aldosterone and Glucocorticoid Induce Na/K-ATPase
1 Gene
Promoter Activity--
To analyze regulation of the Na/K-ATPase
1
promoter by mineralocorticoid and glucocorticoid, CV-1 cells were
transiently transfected with a reporter plasmid encoding the human
1
gene promoter, spanning nucleotides
1141 to +490, linked to the
luciferase gene (pH
1-1141Luc). An expression vector for the human
MR (RshMR) or the human GR (RshGR) or both MR and GR were
co-transfected in CV-1 cells. These cells are known to express very
little if any endogenous MR and GR.
1
full-length promoter (FLP) (Fig. 1). In
cells transfected with GR, 100 nM TA induced a 23-fold
increase in luciferase activity, indicating that GR is a somewhat
stronger transactivator of the
1 gene promoter than MR (Fig. 1).
Interestingly, co-transfection of both receptors, followed by treatment
with 1 µM cortisol, which activates both MR and GR,
induced only a 2-fold increase in activation (Fig. 1). These data
indicate that together MR and GR have an inhibitory effect on
activation of the human Na/K-ATPase
1 gene promoter.
|
1 gene subunit for the presence of GRE-like sequences. Three
potential response elements were identified at position
1048,
650,
and
276 relative to the transcriptional start (Fig. 2A), containing consensus
binding sequences for GR (GRE). The first two sequences contain two
half-binding sites separated by 10 and 9 base pairs, respectively,
whereas the last one consists of a single half-site (Fig.
2A). To determine the functionality of these potential
response elements and their specificity for MR versus GR,
luciferase plasmids containing various lengths of the 5'-flanking
region of the human Na/K-ATPase
1 gene (Fig. 2B) were
generated and transfected into CV-1 cells, along with the MR and/or GR
expression plasmids.
|
726 (726-Luc) induced an 8-fold increase in luciferase activity following treatment with 100 nM aldosterone (Fig.
3A). This activation consists
of half of that induced by the full-length promoter construct
(1141-Luc). Deletion of an additional 172-base pair in the 554-Luc
plasmid resulted in a 4-fold reduction in transcriptional activation.
Finally, deletion of the remaining sequence in the 83-Luc construct
abolishes the hormonal response (Fig. 2A). These data
suggest that the deleted intervals in the various constructs contained
potential functional elements, including the GRE-like sequences,
responsible for the activation of the
1 promoter by aldosterone.
|
726 and
554 (726-Luc, 554-Luc) induced 10- and 5-fold increase in luciferase activity, respectively, following treatment with 100 nM TA
(Fig. 3B). The construct with an end point at
83 (83-Luc),
did not retain hormone inducibility (Fig. 3B). These results
suggest that sequences deleted from these intervals, including the
putative GREs, may constitute positive regulatory elements contributing to the activation of the
1 promoter by GR.
In addition, a luciferase plasmid containing the full-length promoter
including an internal deletion
1141*(643-327) abolishing the
sequence from position
643 through
327, was analyzed in the
presence of MR or GR. In MR experiments, this construct induced a
2-fold increase in luciferase expression (Fig. 3A) and a
4-fold activation was obtained in GR experiments (Fig. 3B).
This result reflects a significant decrease in promoter activity when
compared with that of the full-length promoter (Fig. 1), suggesting
that the deleted interval (
643 to
327) includes important positive cis-acting elements. Interestingly, deletion constructs such as 554-Luc, 456-Luc, and 327-Luc containing most of this interval (643-327), but not the GRE-like sequence at position
650, induced, similar to the FLP*643-327-Luc construct, 2-5-fold increases in luciferase expression but were not capable of re-establishing promoter
activity to a higher level such as that of 726-Luc. Together these
results indicate that the GRE/MRE sequence at position
650 plays an
important role in conferring hormone responsiveness and that other
elements including the GREs at position
1048 and
276 are necessary
for optimal activation of
1 promoter by aldosterone and
glucocorticoid.
Co-transfection of both MR and GR, followed by treatment with 1 µM cortisol, resulted in a 2-3-fold increase in
luciferase activity with the variant deletion constructs (Fig.
3C). The inhibition of promoter activity was similar to that
obtained with the full-length promoter (Fig. 3C) suggesting
that MR and GR are inhibitory to each other when they are coexpressed.
To examine the ability of cortisol to activate the
1 promoter via MR
and GR, CV-1 cells were co-transfected with the full-length promoter
(
1141-Luc) or various deletion constructs in the presence of MR or GR
and cells were treated with 100 nM cortisol. These
treatments induced significant luciferase activation by the full-length
promoter for both MR and GR (data not shown). This activation was lower than that induced by the more specific ligands aldosterone and TA when
used in MR and GR experiments, respectively.
To examine whether the inhibition of promoter activity observed in the
presence of both receptors and cortisol is ligand specific, CV-1 cells
were co-transfected as above in the presence of both MR and GR and
cells were treated with 100 nM aldosterone plus 100 nM TA. In these conditions, the full-length promoter
induced a 5-fold increase in luciferase gene expression, while
1-3-fold increases were observed with the different deletion
constructs (Fig. 3D). These data indicate that activation by
the
1 promoter, in the presence of both MR and GR and their specific
ligands, aldosterone and TA, is 2-fold higher than that induced in the same conditions by cortisol. However, these results confirm that coexpression of MR and GR inhibits gene expression.
Mineralocorticoid Receptor Binds to the Na/K-ATPase
1 MRE/GRE
(
650 to
630) in Vitro--
Based on our observation of a 4-fold
reduction in hormone inducibility of the
1 promoter upon deletion of
the putative binding site at position
650 in the presence of MR but
not with GR, it appears to function as a mineralocorticoid response
element. To examine DNA-binding properties of MR to the
1 promoter
650 MRE, human MR was transfected into COS-1 cells and whole cell
extract was prepared following 2 h treatment with 100 nM aldosterone. Electrophoretic mobility shift assay was
performed using 3 µg of whole cell extract and a sequence of the
Na/K-ATPase
1 promoter from
662 to
628 as a probe
(GGGTTTGGCAATTGTCCTGCTCGAGGTGGTTCAGG). This probe contains consensus binding sequences for GR, organized in
two half-binding sites (bold) separated by 9 base pairs, as well as a
NF1-binding site (underlined).
1
palindrome in vitro (Fig. 4A, lanes 2 and
5). These complexes may correspond to different MR
oligomeric forms bound to the DNA, which includes monomers and dimers,
with different mobility properties. DNA binding was competed completely
with a 200-fold excess of unlabeled
1 MRE oligonucleotide (Fig.
4A, lane 4). A consensus GRE oligonucleotide (GRE 31),
containing double GRE sequences separated by 16 base pairs, was also
used as a competitor. GRE 31 was partially effective at competing the
1 MRE binding when a 200-fold excess was used (Fig. 4A, lane
7). Moreover, in a reverse experiment,
1 MRE competed partially
the binding when the GRE 31 was used as a probe (Fig. 4B),
suggesting that MR binds with higher affinity to the
1 MRE. These
data indicate that protein extracts of cells overexpressing MR bind
specifically to the
650 MRE of the
1 promoter.
|
-MR) raised against human MR. The
protein-DNA complexes were shifted to a higher position when the
-MR
was used but remained unchanged when a preimmune serum was included in
the reaction (Fig. 4C). This result indicates that both
complexes contain MR.
To examine the involvement of the GRE-like binding sites and the NF1
sequences contained in Na/K-ATPase
1 MRE (
662 to
628) in MR
binding in vitro, 5' and/or 3' deletions were introduced in
1 palindrome (Fig. 5A) and
used as cold competitors in gel shift analysis. Human MR was
transfected into COS-1 cells and whole cell extract was prepared
following 2 h treatment with 100 nM aldosterone.
Electrophoretic mobility shift assay was performed using 3 µg of
whole cell extracts and the
1 MRE as a probe. Unlike the wild type
oligonucleotide (
1 wt MRE), none of the mutated sequences were able
to compete effectively for DNA binding, when a 200-fold excess of cold
mutated oligonucleotide (
1 mut MRE) was included in gel shift
reactions (Fig. 5B), suggesting that optimal binding of MR
requires both half-sites and the NF1 site, in total spanning at least
28 base pairs.
|
Protein-DNA Complexes Contain Both MR and GR When
Coexpressed--
To examine protein binding to the
1 MRE (
662 to
628) in the presence of both receptors, human MR, GR, or both MR and
GR were transfected into COS-1 cells. Cell extracts were prepared following 2 h induction with 100 nM TA or 1 µM cortisol, respectively. Electrophoretic mobility shift
assay was performed using 3 µg of whole cell extracts and
1 MRE as
a probe. In extracts of cells overexpressing GR, two classes of
DNA-protein complexes were formed on the
1 MRE in vitro,
similar to that seen for MR (Fig. 6). Protein binding to the
1 MRE was eliminated when a GR antibody was
included in the gel shift reaction, and was unaffected in the presence
of a nonspecific serum. In the presence of both receptors, extracts
from cells transfected with both MR and GR (3 µg), or in
vitro mixtures of equal amounts of protein extracts prepared from
cells overexpressing one of the two receptors (3 µg total), show no
difference in DNA binding pattern, when compared with the binding of
receptors expressed separately. Addition of MR antibody (
-MR) or GR
antibody (
-GR) to reaction mixtures resulted in band shifting and
elimination of DNA binding, respectively, indicating the presence of
both MR and GR in the protein-DNA complexes formed in vitro,
when both receptors are present (Fig. 6).
|
1 MRE with lower affinity in
comparison with MR/MR or GR/GR homodimers. In addition, differences in
the reduction of the upper and lower bands observed between in
vivo coexpressed MR/GR and in vitro mixtures of MR+GR
may reflect variations in the formation and equilibrium of the MR/GR
heterodimer under different conditions.
Mineralocorticoid and Glucocorticoid Activation of the Putative
1 MRE/GRE and Its Mutant Upstream of the SV40 Promoter--
To
determine whether the sequence extending from
650 to
628 of the
Na/K-ATPase
1 gene relative to the transcriptional start constituted
a functional mineralocorticoid and glucocorticoid regulatory element, a
double-stranded oligonucleotide corresponding to this sequence was
inserted into a BglII site, upstream of the SV40 promoter in
the CAT promoter vector (pH
MRE CAT). A mutated oligonucleotide was
cloned, also, into the site. CV-1 cells were transfected with either
1MRE CAT construct or
1mutMRE CAT along with MR, GR, or both MR
and GR and treated with 100 nM aldosterone or TA or 1 µM cortisol, respectively. In MR experiments, CAT
activity was stimulated 3-fold in CV-1 cells transfected with MR and
pH
1MRE CAT. No induction was obtained with MR and the mutated MRE
containing a deletion in the left consensus half-site (Fig.
7A). Following treatment with
100 nM TA, GR stimulated a 2-fold induction of CAT activity
(Fig. 7B). However, coexpression of both MR and GR in the
presence of 1 µM cortisol resulted in no induction of the CAT gene expression (Fig. 7B). These results demonstrate
that the sequence from
662 to
628 of the Na/K-ATPase
1 gene
contains a potential MRE/GRE that is sufficient for mineralocorticoid
and glucocorticoid responsiveness in a heterologous promoter when MR
and GR are expressed independently and that coexpresion of both MR and
GR leads to inhibition of transcription.
|
| |
DISCUSSION |
|---|
|
|
|---|
The mineralocorticoid receptor mediates aldosterone-induced
regulation of sodium transport. It is well established that the
and
isoforms of the Na/K-ATPase gene family are regulated by
corticosteroid hormones in a tissue-specific manner, at both the
mRNA and protein levels (9-11), however, the molecular mechanism of this regulation and its tissue specificity are still to be elucidated. In the current study, we investigated the transactivation of the Na/K-ATPase
1 gene promoter by the mineralocorticoid and glucocorticoid receptors. To locate DNA sequences required for hormone
transactivation, we carried out a detailed analysis of the promoter and
used 5' deletions of the flanking region of the
1 gene fused to the
luciferase reporter gene.
This approach allowed us to identify three potential sequences
containing consensus binding sequences for GR (GRE) at positions
1048,
650, and
276, relative to the transcriptional start. Two of
the sequences contained two half-binding sites, whereas the last one
consisted of a single half-site at position
276. Using 5' deletions
of the promoter region, MR and GR activation was shown with deletion
constructs containing the MRE/GREs at position
650 and
276,
suggesting that they are responsive both to aldosterone and the
glucocorticoid TA. This activation was 50% lower than that induced by
the full-length promoter construct indicating that the potential MRE at
position
1048 may be functional. Importantly, 80-90% of promoter
activation via MR and GR were lost with a deletion construct containing
the full-length promoter including an internal deletion abolishing the
left half-site of the MRE/GRE at position
650. This suggests an
important role for this sequence in hormone responsiveness. Although a
3-fold activation was observed with constructs containing the single half-binding site at position
276, luciferase gene activation decreased dramatically when compared with that of constructs including the full site sequences at positions
1048 and
650. This observation is consistent with the current hypothesis for requirement of two copies
of half-sites, to which GR and MR bind as homodimers, to generate a
functional GRE. Presence of multiple GREs in the promoter of genes
regulated by GR has been described and the transcriptional increase
observed in our system when three or two of these sequences are present
is in agreement with the known role played by multiple GREs in the
amplification of the steroid hormone signal by synergy (18).
Functionality of one of these potential MRE/GREs as minimal sequences
conferring mineralocorticoid and/or glucocorticoid responsiveness was
examined. We demonstrate that the sequence from
662 to
628, containing the potential MRE/GRE at position
650, is capable of
transactivation when cloned upstream of the SV40 promoter by both MR
and GR in CV-1 cells. This sequence consists in two half-binding sites
separated by 9 base pairs and each half-site exhibits a 5/6 match with
a consensus GRE sequence. However, when the left half-site is deleted
no induction of transcription was observed in response to hormone.
Activation of the
1 gene promoter was demonstrated for both MR and
GR. Importantly, GR induced regulation of the full-length promoter was
shown to be roughly equal to that of MR. Results have been reported
with a TATA3-TATA reporter plasmid, containing 3 near consensus HREs
showing a greater induction of transcription by GR than MR in CV-1
cells (19, 20). This difference is not due to a difference in the level
of expression of GR and MR but seems to be a result of the inability of
MR to self-synergize at multiple HREs, while GR does (20).
Activation of gene expression by corticosteroid receptors was thought
to involve exclusively, binding of receptor homodimers to GRE sequences
(21). In cells expressing both receptors, molecular studies have
demonstrated that MR and GR are capable of forming heterodimers, with
transactivation properties different from those of the respective
homodimers (19, 22). Examination of the regulation of the human
Na/K-ATPase
1 gene promoter, by MR and GR when both receptors are
expressed, show inhibition of the transcriptional activation,
indicating that MR has an inhibitory effect on GR activation of the
1 gene promoter and vice versa. Inhibition of GR induced
transcriptional activity by MR has been reported in a different
regulatory context supporting the idea that MR-GR heterodimers are less
efficient activators than GR-GR homodimers (19, 23). It has been
proposed that a region within the N terminus of MR disrupts GR
self-synergy in MR-GR heterodimers. In our system, inhibition of GR
induced transcriptional activity of the
1 gene promoter by MR may
represent a mechanism for differential regulation of the Na/K-ATPase by
glucocorticoid and mineralocorticoid in different tissue contexts.
To determine whether activation of the Na/K-ATPase
1 gene promoter
by mineralocorticoid involves a direct interaction between MR and the
putative cis-elements identified in the flanking region, we examined
the ability of the potential MRE/GRE sequence at position
650 to bind
MR in mobility shift assays. We demonstrate that activated human MR
binds specifically to the palindromic
1MRE (
662 to
628) and two
protein-DNA complexes were formed. Affinity of
1 MRE for MR was
similar to that of a double consensus GRE oligomer. The observation of
a supershift in the bands when a polyclonal antibody against human MR
(
-MR) is included, demonstrates that the latter complexes indeed
contained MR. Formation of multiple protein-DNA complexes in
vitro has been previously reported for MR and GR and reflect
existence of monomeric and dimeric forms of MR bound to the DNA (20).
Using whole cell extracts prepared from COS-1 cells overexpressing GR
or both MR and GR, induced with 100 nM TA or 1 µM cortisol, respectively, immuno-binding assays show, as
expected, that GR binds to the Na/K-ATPase
1 MRE and further
demonstrate the presence of both MR and GR in protein-DNA complexes
formed in vitro. These data indicate that a direct
interaction of the
1 gene promoter with MR and GR is involved in the
regulation of the Na/K-ATPase gene by mineralocorticoids and
glucocorticoids.
The specificity of mineralocorticoid hormone action remains unclear
(24). Despite the fact that some physiological studies show differences
in the effect mediated by MR and GR, few hypothesis for specific
mineralocorticoid regulation have been established by molecular
studies. Steroid hormones were shown to regulate the expression of
Na/K-ATPase genes in a tissue-specific manner. Aldosterone but not the
glucocorticoid dexamethasone induces Na/K-ATPase gene expression in
cardiac cells, while the reverse is observed in colonic cells (11, 25),
suggesting that both hormone receptors are involved in the regulation
of the enzyme and that non-receptor factors might be involved in
conferring mineralocorticoid versus glucocorticoid
specificity. Tissue-specific factors may include other transcription
factors. It is known that steroid receptors can bind to composite GREs
containing binding sites both for the receptor and for other
transcription factors. Differential regulation by MR and GR was shown
at pIFG, a composite AP1/GRE site (26, 27). In the present study, we
identified a putative NF1-binding site at position
657, upstream of
the
1 MRE, indicating that NF1 may play a role in the regulation of
Na/K-ATPase gene by MR and GR. Tissue-specific factors may also include
members of the recently described family of steroid receptor
coactivators and corepressors such as SRC1-a and GRIP1, N-COR and SMRT,
which might be involved in conferring mineralocorticoid
versus glucocorticoid specificity and their roles remain to
be evaluated in the regulation of the Na/K-ATPase
1 gene promoter
(28-30).
| |
ACKNOWLEDGEMENTS |
|---|
We express our appreciation to Dr. Gwen Gilinger and Michelle Croyle for their help with this work.
| |
FOOTNOTES |
|---|
* This work was supported by Research Grants DK 44441 (to G. L.) and CA67032 (to D. J. H.) from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M25161 and J03078.
¶ To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Pharmacology, Bluemle Life Science Building, Rm. 350, Thomas Jefferson University, 233 S. 10th St., Philadelphia, PA 19107. Tel.: 215-503-4634; Fax: 215-503-5393; E-mail: Gerry.Litwack{at}mail.tju.edu.
The abbreviations used are: MR, mineralocorticoid receptor; GR, glucocorticoid receptor; GRE, glucocorticoid response element; MRE, mineralocorticoid response element; TA, triamcinolone acetonide; CAT, chloramphenical acetyltransferase.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Irita, T. Okura, M. Kurata, K.-i. Miyoshi, T. Fukuoka, and J. Higaki Osteopontin in Rat Renal Fibroblasts: Functional Properties and Transcriptional Regulation by Aldosterone Hypertension, February 1, 2008; 51(2): 507 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Huang, B. Jiao, C. K. Fung, Y. Zhang, W. K K Ho, C. B. Chan, H. Lin, D. Wang, and C. H K Cheng The presence of two distinct prolactin receptors in seabream with different tissue distribution patterns, signal transduction pathways and regulation of gene expression by steroid hormones J. Endocrinol., August 1, 2007; 194(2): 373 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kiilerich, K. Kristiansen, and S. S Madsen Cortisol regulation of ion transporter mRNA in Atlantic salmon gill and the effect of salinity on the signaling pathway J. Endocrinol., August 1, 2007; 194(2): 417 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. MATLHAGELA and M. TAUB Prostaglandins Regulate Transcription by Means of Prostaglandin Response Elements Located in the Promoters of Mammalian Na,K-ATPase beta1 Subunit Genes Ann. N.Y. Acad. Sci., December 1, 2006; 1091(1): 233 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Matlhagela and M. Taub Regulation of the Na-K-ATPase beta1-subunit promoter by multiple prostaglandin-responsive elements Am J Physiol Renal Physiol, September 1, 2006; 291(3): F635 - F646. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Z. Jaffe and M. E. Mendelsohn Angiotensin II and Aldosterone Regulate Gene Transcription Via Functional Mineralocortocoid Receptors in Human Coronary Artery Smooth Muscle Cells Circ. Res., April 1, 2005; 96(6): 643 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
|