|
J Biol Chem, Vol. 273, Issue 33, 20737-20743, August 14, 1998
The 134.5 Protein of Herpes Simplex Virus 1 Has
the Structural and Functional Attributes of a Protein Phosphatase 1 Regulatory Subunit and Is Present in a High Molecular Weight Complex
with the Enzyme in Infected Cells*
Bin
He ,
Martin
Gross§, and
Bernard
Roizman ¶
From the Marjorie B. Kovler Viral Oncology
Laboratories and the § Department of Pathology, The
University of Chicago, Chicago, Illinois 60637
 |
ABSTRACT |
The carboxyl-terminal domain of the
134.5 protein of the herpes simplex virus 1 binds
to protein phosphatase 1 (PP1) and is required to prevent the
shut-off of protein synthesis resulting from phosphorylation of the subunit of eIF-2 by the double-stranded RNA-activated protein kinase.
The corresponding domain of the conserved GADD34 protein homologous to
134.5 functionally substitutes for 134.5.
This report shows that 134.5 and PP1 form a complex in
the infected cells, that fractions containing this complex specifically
dephosphorylate eIF-2 , and that both 134.5 and GADD34
proteins contain the amino acid sequence motif common to subunits of
PP1 that is required for binding to the PP1 catalytic subunit. An
oligopeptide containing this motif competes with 134.5 for binding to PP1. Substitution of Val193 and
Phe195 in the PP1-binding motif abolished activity. These
results suggest that the carboxyl-terminal domain of
134.5 protein has the structural and functional
attributes of a subunit of PP1 specific for eIF-2 , that it has
evolved to preclude shut-off of protein synthesis, and that GADD34 may
have a similar function.
 |
INTRODUCTION |
The 134.5 gene of herpes simplex virus 1 (HSV-1)1 encodes two
functions. The first enables the virus to replicate in vivo and particularly to multiply and spread in the central nervous system
of experimental animal systems (1, 2). This function appears to map
throughout the coding domain of the gene (3, 4). The second blocks the
shut-off of protein synthesis resulting from phosphorylation of the subunit of the translation initiation factor eIF-2 by the
double-stranded RNA-activated protein kinase (PKR). This function maps
in the 3'-terminal domain of the 263-codon gene (5, 6). Earlier studies
have shown that in HSV-1-infected cells PKR is activated but that in
cells infected with wild-type virus or virus carrying in-frame
deletions of the 5'-terminal coding domain of the gene eIF-2 was not
phosphorylated (7). In subsequent studies (8) we have shown that the
134.5 protein interacts with the protein phosphatase
1 (PP1). Indeed, infected cells contain a phosphatase activity that
specifically dephosphorylates eIF-2 at a rate 3000-fold greater than
that measured in uninfected cells. This phosphatase activity is
inhibited by inhibitors of PP1. The hypothesis that emerged from these
studies is that transcription of complementary sequences of the HSV-1
DNA results in the formation of double-stranded RNA, that PKR is
activated in cells infected with both wild-type and mutant viruses, and
that a domain of the 134.5 protein binds PP1 and
redirects its activity to dephosphorylate eIF-2 . This report centers
on one aspect of this hypothesis: we show that in infected cells
134.5 protein is a component of a multi-protein,
cytoplasmic complex containing PP1 and that the interacting domain of
the 134.5 protein is near the carboxyl terminus of the
protein and has an amino acid motif shared with accessory proteins or
subunits interacting with the catalytic subunit of PP1.
Relevant to this report are the following: (i) The HSV-1
134.5 gene encodes a protein consisting of a 159-amino
acid amino-terminal domain, the amino acids Ala-Thr-Pro repeated 5-10
times depending on virus strain, and a 74-amino acid carboxyl-terminal
domain (9-11). The gene maps in the inverted repeat sequence
ab and b'a' flanking the unique long
(UL) sequence, between the terminal a sequence
and the gene encoding the regulatory infected cell protein number 0. Earlier studies described a series of mutants in which in-frame
deletions truncated the amino-terminal domain or prematurely terminated
the translation of the carboxyl-terminal domains. The key observation
was that protein synthesis was shut off after the onset of synthesis of
viral DNA in cells infected with mutants either lacking the entire
134.5 coding domain or that are unable to express the
carboxyl-terminal domain (6). (ii) The 134.5 gene is
conserved in very few herpesviruses, suggesting that other herpesviruses have evolved different methods for blocking the consequences of double-stranded RNA accumulation in infected cells. Homologs of the 134.5 carboxyl-terminal domain have been
found, however, in the African swine fever virus (12), a DNA virus belonging to the unrelated, Iridovirus family, and in the corresponding domain of a highly conserved mammalian protein known as GADD34 (growth arrest and DNA
damage protein 34) (13-16). The GADD proteins are induced in cells subjected to growth arrest as a consequence of
serum deprivation or damage to their DNA or in the course of differentiation (14-16). It has been reported that overexpression of
GADD34 results in apoptosis (17). It is of interest, however, that the
carboxyl-terminal domain of the mouse GADD34 protein substituted for
the HSV-1 134.5 carboxyl-terminal domain in blocking the
shut-off of protein synthesis (18). This observation suggests that the
shared sequences are sufficient to block the shut-off of protein
synthesis and that the corresponding GADD34 protein domain may perform
upon induction a similar function. The homologous domains of known
GADD34 proteins and of the HSV-1 and HSV-2 and African swine fever
virus homologs are shown in Fig. 1. (iii) The catalytic subunit of PP1
is a highly conserved protein with a Mr of
38,000 (19). PP1 exists in holoenzyme complexes with noncatalytic or
regulatory components that modulate catalytic activity or restrict the
subcellular localization of the catalytic subunit. In essence, PP1 is
regulated by different cellular proteins. Many of such regulatory
proteins have been described (20-25), and these complexes have diverse
functions within the cell (19, 26). While this work was in progress, it
has been reported that these subunits share an amino acid sequence
required for binding to the catalytic subunit of PP1 (27, 28).
 |
MATERIALS AND METHODS |
Cells and Viruses--
The HeLa and SK-N-SH cell lines were
obtained from American Type Culture Collection and propagated in
Dulbecco's modified Eagle's medium supplemented with 5% (HeLa) or
10% (SK-N-SH cells) fetal bovine serum, respectively. The rabbit skin
cell line originally obtained from J. McClaren was propagated in
Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine
serum. HSV-1(F) is the prototype HSV-1 strain used in this laboratory
(29). Recombinant virus R3616 lacks 1000 base pairs from the coding region of the HSV-1(F) 134.5 gene (1). In recombinant
R8301, the 3' sequence encoding amino acids 206-263 was deleted from the carboxyl-terminal domain of the 134.5 gene (18). In
recombinant viruses R4002, R931, R908, and R909, the sequences of the
134.5 encoding amino acids 1-30, 31-72, 72-106, and
107-146, respectively, were deleted (6). As previously reported, all
recombinant viruses listed above except R3616 and R8301 preclude the
shut-off of protein synthesis.
For infection, cells were exposed to the indicated virus for 2 h.
at 37 °C. The inoculum was then replaced with medium 199V consisting
of mixture 199 supplemented with 1% calf serum.
Plasmids--
In plasmid pRB4892 the coding domain of
glutathione S-transferase (GST) is fused to the entire
coding domain of PP1 except for the initiator methionine codon (8). In
plasmid pRB4893 the coding domain of GST is fused to codons 146-263 of
the 134.5 gene (8). To construct plasmid pRB4895,
an oligonucleotide linker,
AATTCCCAGCACGTGTACGTTTCTCGCCTCACGTCCGAGTACGTCACG, and its complement,
TCGACGTGACGTACTCGGACGTGAGGCGAGAAACGTACACGTGCTGGG, were cloned into the
EcoRI and SalI sites of pGEX4T-1. In this plasmid, codons 190-203 of the 134.5 gene were fused in
frame to the coding sequences of GST. To construct plasmid pRB4894, an
oligonucleotide linker, AATTCCACCTGGTGTCCGGA, and its complement, TCGACTCCGGACACCAGGTGG, were inserted into the EcoRI
and SalI sites of pGEX 4T-1, yielding plasmid pRB4896. A
244-base pair DraIII-BspEI fragment encoding
amino acids 205-263 was then isolated from plasmid pRB3207 (18) and
ligated into the DraIII and BspEI sites of pRB4896.
To construct pRB4897, a BstEII-DraIII fragment
encoding codons 28-205 of 134.5 was amplified by
polymerase chain reaction from plasmid pRB143 with primers
CCACCCCGGCACGCTCTCTGT and
CAGACCACCAGGTGGCGCACCCGGACGTGGGGCGATAAGCGCTCCCGCGCGGGGGTC. The amplified polymerase chain reaction fragment with nucleotide changes (underlined) incorporated in the 3' end primer was inserted into the BstEII and DraIII sites of pRB143,
resulting in plasmid pRB4897, which was sequenced to verify that the
plasmid contained the desired mutations. In this plasmid, the codons
encoding Val193 and Phe195 of
134.5 were replaced with those encoding Glu and Leu,
respectively.
Expression of GST fusion proteins was induced by the addition of
isopropyl -D-thiogalactoside to cultures of
Escherichia coli BL21 cells transformed with plasmid
pRB4892, pRB4893, pRB4894, or pRB4895, followed by affinity
purification of the fusion proteins from bacterial lysates on agarose
beads conjugated with glutathione. Purified PP1 was obtained by
cleavage of GST-PP1 fusion protein with thrombin (Sigma).
Construction of the Recombinant Virus R8321--
Recombinant
virus R8321 was constructed by cotransfection of the intact viral DNA
of R3659 (30) with the plasmid pRB4897 on rabbit skin cells. In the
parent virus R3659 (31), a 1-kilobase fragment from the coding
sequences of 134.5 was replaced with the chimeric
27-tk gene. The progeny of the recombinant was selected and
plaque-purified on 143 TK mutant cells in medium consisting of mixture
199V supplement with 100 µg of bromodeoxyuridine/ml and 2% fetal
calf serum. Preparation of viral stocks and titrations of infectivity
were done with Vero cells.
Cell Lysates--
HeLa cells either mock-infected or infected
with viruses were harvested at 18 h after infection, rinsed with
phosphate-buffered saline, resuspended in lysis buffer containing 10 mM Hepes (pH 7.6), 250 mM NaCl, 10 mM MgCl2, 1% Triton X-100, 0.5 mM
phenylmethylsulfonyl fluoride, and 2 mM benzamidine, stored
on wet ice for 30 min, and subjected to low speed centrifugation to
remove nuclei. The supernatant fluids (S10 fractions) were saved for
analysis.
Immunoblotting--
Samples were solubilized in disruption
buffer containing 50 mM Tris-HCl (pH 7.0), 5%
2-mercaptoethanol, 2% SDS, and 2.75% sucrose, sonicated and boiled,
subjected to electrophoresis in SDS-polyacrylamide gels, transferred to
a nitrocellulose sheet, blocked with 5% nonfat milk, reacted with
either anti- 134.5 antibody (9) or anti-PP1 antibody
(Upstate Biotechnology Inc. Lake Placid, NY), rinsed, and reacted with
goat anti-rabbit immunoglobulin coupled to alkaline phosphatase as
recommended by the manufacturer (Bio-Rad).
[35S]Methionine Labeling--
Replicate cultures
of SK-N-SH cells were either mock-infected or exposed to 10 plaque-forming units (pfu) of HSV-1(F) or one of the
134.5 mutants per cell at 37 °C. At 14 h after
infection, cells were overlaid with 1 ml of medium lacking methionine
but supplemented with 50 µCi of [35S]methionine
(specific activity, >1000 Ci/mmol; Amersham Pharmacia Biotech) and
reincubated for 1 h. The cells were then harvested, solubilized,
subjected to electrophoresis in denaturing polyacrylamide gels, and
transferred to a nitrocellulose sheet and subjected to autoradiography
as described previously (5).
Gel Filtration on Superdex 200--
A Superdex 200 HR 10/30
column (1.0 × 30 cm; Amersham Pharmacia Biotech) was equilibrated
in 10 mM Tris-HCl (pH 7.5), 50 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, and
0.1 mM EDTA and pumped at 0.5 ml/min, using the Amersham
Pharmacia Biotech Fast Protein Liquid Chromatography system. Samples
(final volume of 0.5 ml) were injected, 0.5-ml fractions were collected
on ice, and the absorbance at 280 nm was monitored.
Determination of eIF-2 Phosphatase Activity--
Rabbit
reticulocyte eIF-2, purified as described previously (32), was
phosphorylated with partially purified, hemin-controlled translational
repressor as described elsewhere (33, 34) to yield phosphorylated
eIF-2 and eIF-2 (1.0 and 0.7 mol/mol of eIF-2, respectively).
This preparation also contains a phosphoprotein with a
Mr of 39,000.
S10 fractions were prepared from lysates of HeLa cells infected with
HSV-1(F) (7) and fractionated on a Superdex 200 column as described
above. Aliquots (3.0 µl) of the fractions were incubated with 1.2 pmol of phosphorylated eIF-2 and a final concentration of 0.8 mM ATP in a final volume of 4.0 µl for 1.0 min at
34 °C. Reactions were terminated with SDS and subjected to
electrophoresis on 7% denaturing, polyacrylamide gels, followed by
silver staining, drying, and autoradiography as described (8). The
percentage of eIF-2( 32P) and eIF-2( 32P)
that was dephosphorylated was determined by excising these bands and
comparing their Cerenkov radiation to that of equivalent eIF-2( , 32P) that was not further incubated and was
subjected to electrophoresis in parallel.
 |
RESULTS |
Localization of Protein Phosphatase 1-binding Site(s) in
134.5 Protein--
Earlier studies have shown that the
carboxyl-terminal domain of the 134.5 protein (Fig.
1) is required to prevent the shut-off of
protein synthesis, that it interacts with PP1, and that it is highly
conserved among several viral and GADD34 proteins. The objective of
this series of experiments was to determine the PP1-binding sites in
the 134.5 protein.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 1.
Amino acid sequence alignment of the
carboxyl-terminal domains of hamster (15), mouse (14), and human (17)
GADD34 proteins and of the 134.5 homologs of HSV-1 (11)
and HSV-2 (41) and of the NL protein of African swine fever virus
(12).
|
|
In the first series of experiments, purified GST-PP1 protein bound to
beads was incubated with cell extracts prepared from HeLa cells
infected with 20 pfu of wild-type virus or mutants carrying
134.5 genes from which various domains of the gene had been deleted (Fig. 2A). The
proteins bound to GST-PP1 were solubilized, electrophoretically
separated in denaturing gels, transferred to nitrocellulose, and
reacted with antibody to the Ala-Thr-Pro repeat of the
134.5 protein (9). The results in Fig.
3A indicate that GST-PP1 was
able to bind to the wild-type 134.5 protein (lane
6), the 134.5 mutants with the nested deletions
from amino acids 1-146 at the amino-terminal domain (lanes
1-3 and 5), and the 134.5 protein
lacking the amino acids 205 to 263 (lane 4). These results
indicate that a PP1-binding site is located between amino acids 146 and
205.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2.
A, schematic representation of the
genome structure and sequence arrangements of HSV-1(F) and of the
134.5 deletion mutants. The top line
represents the two covalently linked components of HSV-1 DNA, L and S,
each consisting of unique sequences (UL and US,
respectively) flanked by inverted repeats (42, 43). The reiterated
sequences flanking UL, designated ab and
b'a', are each 9 kilobase pairs in size, whereas the repeats
flanking US, designated a'c' and ca,
are 6.3 kilobase pairs in size (43). The location of the
134.5 gene is shown in an expanded portion of the
inverted repeat sequences b and b'. The
shaded bar and the arrow indicate the coding
region and the direction of transcription of 134.5,
respectively. Because the b sequence is repeated in an
inverted orientation, the HSV-1 genome contains two copies of the
134.5 gene. The thick lines indicate the
134.5 deletion mutants. The numbers above the
lines indicate the position of amino acid residues. The
gaps between numbers indicate the deletions in
the 134.5 gene. B, schematic diagram of
GST- 134.5 chimeric proteins. The hatched bars
indicate the domains of the 134.5 protein, and
numbers indicate the terminal 134.5 amino
acids of the portion present in the chimeric protein. The designation
of the plasmids encoding the chimeric proteins are shown to the
left of the schematic diagrams.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 3.
Association of PP1 with 134.5
protein in vitro. A, replicate HeLa cell
cultures were harvested in lysis buffer containing 10 mM
Hepes (pH 7.6), 250 mM NaCl, 10 mM
MgCl2, 1% Triton X-100, 0.5 mM
phenylmethylsulfonyl fluoride, and 2 mM benzamidine 18 h after mock infection or infection with 10 pfu of the indicated
viruses. After 30 min on ice and low speed centrifugation to remove
nuclei, the supernatant fluids were precleared with GST beads and then
reacted with GST-PP1 beads at 4 °C for 14 h. The proteins bound
to beads were rinsed extensively, solubilized by boiling in disruption
buffer containing 50 mM Tris-Cl (pH 7.0), 5%
2-mercaptoethanol, 2% SDS, and 2.75% sucrose, electrophoretically
separated on denaturing 12% polyacrylamide gels, transferred to a
nitrocellulose sheet, and reacted with rabbit polyclonal
anti- 134.5 serum (9). The positions of the full-length
and truncated 134.5 are shown. B, an aliquot
of GST-PP1 fusion protein bound to beads was reacted with 25 units of
thrombin (Sigma) in phosphate-buffered saline at room temperature.
After 12 h, the mixture was centrifuged in a tabletop centrifuge,
and the supernatant fluid containing PP1 was then dialyzed against
lysis buffer, reacted with GST or GST- 134.5c chimeric
proteins containing the amino acids (aa) 190-203, 205-263,
or 146-263 bound to beads, and processed as described above. PP1 was
detected with anti-PP1 antibody (Upstate Biotechnology, Inc.).
|
|
In the second set of experiments, purified PP1 was reacted with beads
carrying GST or GST fused to the sequence of amino acids 146-263,
190-203, or 205-263 of the 134.5 protein (Fig.
2B). The proteins bound to GST fusion proteins were
solubilized, subjected to electrophoresis on a denaturing gel, and
reacted with anti-PP1 antibody. The results in Fig. 3B
indicate that PP1 bound strongly to the 134.5 peptide
sequence encompassing amino acids 190-203. In addition, PP1 bound less
efficiently to the carboxyl-terminal domain of the 134.5
protein encompassing amino acids 205-263. PP1 did not bind to GST
(Fig. 3B).
In the third series of experiments, a competition assay was done
to test whether a synthetic test peptide containing amino acids
185-211 could block the interaction between intact
134.5 protein and PP1. To control for the specificity,
we synthesized a second peptide containing the same amino acids but in
a scrambled order. GST-PP1 bound to beads was mixed with cell lysates
prepared from HeLa cells infected with HSV-1(F) in the presence or
absence of the synthetic peptides. The protein complex was separated in a denaturing protein gel and processed for immunoblotting with the
anti- 134.5 antibody. As shown in Fig.
4, the test peptide competed with the
134.5 protein for binding to PP1, whereas the control
peptide was not.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 4.
Immunoblot of 134.5 protein
pulled down by PP1 in the presence of increasing amounts of the
peptide.
Ala-Thr-Pro-Ala-Thr-Pro-Ala-Arg-Val-Arg-Phe-Ser-Pro-His-Val-Arg-Val-Arg-His-Leu-Val-Val-Trp-Ala-Ser-Ala-Ala
representing the amino acids 185-211 and containing the
PP1c-binding motif and the control peptide
Ala-Pro-Val-Ala-Pro-Ala-Thr-Ser-Arg-His-Ala-Phe-Ala-Arg-Trp-Pro-Arg-Val-Leu-Val-Ser-Arg-Val-His-Val-Ala-Thr
containing the same amino acids but in a random sequence were
used. Replicate HeLa cell cultures were infected with 10 pfu of
wild-type virus, and cell lysates were prepared 18 h after
infection as described in Fig. 3. The cell lysates were reacted with
GST-PP1 bound to beads in the absence or presence of increasing amounts
of the peptide for 14 h. The beads were then collected and rinsed
extensively. The proteins bound to the beads were solubilized in
disruption buffer, separated on a denaturing 12% polyacrylamide gel,
and transferred to a nitrocellulose sheet (5). The 134.5
protein was detected with the antibody described by Ackermann et
al. (9).
|
|
We conclude from these experiments that a PP1-binding site of
134.5 is located between amino acids 190 and 203. PP1
also interacts with the carboxyl-terminal domain of the
134.5 protein (amino acids 205-263) but with a lower
affinity.
The Domain of the 134.5 Protein Carboxyl-terminal to
the PP1-binding Site Is Required to Prevent Shut-off of Protein
Synthesis in HSV-1-infected Cells--
In this series of experiments
replicate cultures of SK-N-SH cells were exposed to 10 pfu/cell of
wild-type and mutant viruses and incubated at 37 °C. At 14 h
after infection, the cultures were labeled with
[35S]methionine for 1 h. As shown in Fig.
5, protein synthesis continued in cells
infected with wild-type virus or with the mutants with deletions in the
amino-terminal domain, whereas protein synthesis was shut off in cells
infected with either R3616, from which 1 kilobase pair of coding
sequences of the 134.5 had been deleted, or R8301, from
which 244 base pairs of the carboxyl-terminal domain had been deleted.
It is noteworthy that the 134.5 protein encoded by R8301
bound PP1 but was unable to prevent the shut-off of protein synthesis.
We conclude from this experiment that both the PP1-binding site
described above and the functions encoded by the carboxyl-terminal domain of the 134.5 protein are required to prevent the
shut-off of protein synthesis.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 5.
Autoradiographic images of
[35S]methionine-labeled proteins in SK-N-SH cells.
The cells were mock-infected or infected with 10 pfu/cell of the
indicated virus. At 14 h after infection, the cells were overlaid
with 1 ml of medium 199V lacking methionine but supplemented with 50 µCi of [35S]methionine (specific activity > 1000 Ci/mmol; Amersham Pharmacia Biotech). After 1 h of incubation in
labeling medium, the cells were harvested, solubilized in disruption
buffer, subjected to electrophoresis on a denaturing 12%
polyacrylamide gel, transferred to a nitrocellulose sheet, and
subjected to autoradiography.
|
|
The PP1-binding Site Is Required to Prevent Shut-off of Protein
Synthesis in HSV-1-infected Cells--
The purpose of this series of
experiments was to determine whether mutations in the PP1-binding site
abolish the ability of the 134.5 protein to prevent the
shut-off of protein synthesis in HSV-1-infected cells. To address this
question, we constructed the recombinant virus R8321 in which the
conserved amino acids Val193 and Phe195 in the
PP1-binding motif were mutated to Glu and Leu, respectively, and
created the novel restriction site Eco47III. The inserted mutations were verified by sequencing of the plasmid and the presence of the restriction site in the viral DNA (data not shown).
Replicate cultures of human neuroblastma SK-N-SH cells were either
mock-infected or infected with HSV-1(F), R3616, or R8321 at 10 pfu/cell. At 14 h after infection, the cells were labeled for
1 h with [35S]methionine and then harvested,
solubilized, subjected to electrophoresis in denaturing polyacrylamide
gel, and transferred to a nitrocellulose sheet. The autoradiogram shown
in Fig. 6A indicates premature shut-off of protein synthesis in cells infected with R8321 or R3616 but
not in mock-infected cells or those infected with HSV-1(F).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 6.
A, autoradiographic images of
[35S]methionine-labeled proteins in SK-N-SH cells. The
cells were mock-infected or infected with 10 pfu/cell of the indicated
virus. At 14 h after infection, the cells were overlaid with 1 ml
of medium 199V lacking methionine but supplemented with 50 µCi of
[35S]methionine (specific activity > 1000 Ci/mmol;
Amersham Pharmacia Biotech). After 1 h of incubation in labeling
medium, the cells were harvested, solubilized in disruption buffer,
subjected to electrophoresis on a denaturing 12% polyacrylamide gel,
transferred to a nitrocellulose sheet, and subjected to
autoradiography. B, photograph of the immunoblot of the
nitrocellulose sheet described for A and reacted with
antibody made against the 134.5 protein.
|
|
To determine whether R8321 expressed the mutant 134.5 in
SK-N-SH cells, the nitrocelluse sheet described above was reacted with
the anti- 134.5 antibody. As shown in Fig. 6B,
the lysates of cells infected with HSV-1(F) or R8321 expressed
full-length 134.5 protein. The decrease in the amount of
the 134.5 protein made in cells infected with the R8321
mutant was expected because 134.5, as its name
indicates, is made mostly after the onset of DNA synthesis, and its
accumulation would be affected by the shut-off of protein synthesis.
The antibody did not react with lysates of mock-infected cells or cells
infected with the R3616. On the basis of these experiments, we conclude
that Val193 and Phe195 in the PP1 biding motif
of 134.5 are essential for the function of
134.5.
Cytoplasmic PP1 and 134.5 Protein Cofractionate in a
Complex with an Apparent Molecular Weight of 340,000--
The purpose
of this experiment was to determine whether PP1 forms a complex with
134.5 protein in cells infected with wild-type virus.
Replicate 150-cm2 flask cultures of HeLa cells were exposed
to 20 pfu of HSV-1(F)/cell. At 15 h after infection, the cells
were harvested and lysed, and the S10 fraction was chromatographed on a
Superdex 200 column. The fractions were then assayed for their ability
to dephosphorylate eIF-2( P). Aliquots of these fraction were also
solubilized, subjected to electrophoresis in denaturing gels,
transferred to nitrocellulose sheets, and reacted with anti-PP1 and
134.5 antibodies, respectively, as described under
"Materials and Methods." The results (Fig. 7) indicate that the eIF-2( P)
phosphatase eluted as a single discrete component in fractions 22-24.
This activity was relatively specific for eIF-2 , because it had
little or no effect on eIF-2( P) or on the 39-kDa phosphoprotein
(Figs. 7 and 8B). A separate
activity that dephosphorylated eIF-2( P) eluted in fractions 25-26.
Comparison of the elution of eIF-2( 32P) phosphatase with
that of known proteins (Fig. 7) yielded an estimated molecular weight
of 340,000 for the eIF-2 -specific phosphatase activity.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7.
Gel filtration analysis of cytoplasmic
extracts from HSV-1(F)-infected cells on a Superdex 200 column.
HeLa cells were exposed to 20 pfu of HSV-1(F)/cell and harvested
15 h after incubation at 37 °C. The S10 fraction (0.5 ml)
prepared as described under "Materials and Methods" was
chromatographed on a Superdex 200 column (1.0 × 30 cm), and the
fractions were assayed for their ability to dephosphorylate
eIF-2( 32P) and eIF-2( 32P) (8, 32). The
smooth tracing represents the absorbance at 280 nm. The Superdex 200 column was calibrated by chromatographing 200 µg of molecular size
marker proteins individually using conditions that were identical to
the chromatography of HeLa cell S10 fraction on this column, except the
absorbance was monitored at 10-fold greater sensitivity. The molecular
weight size markers and their Mrs were: horse
spleen apoferritin (465,000); aldolase (150,000); bovine serum albumin
(69,000); ovalbumin (45,000); and rabbit reticulocyte thioredoxin (11,
600).
|
|

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 8.
A, immunoblot of proteins contained in
chromatographic fractions obtained as described in the legend to Fig.
7. 20 and 50 µl of unfractionated S10 fraction (lanes 1 and 2) and 250-µl portions of fractions 15-26
(numbered at top and in lanes 3-14),
to which were added 40 µg of sperm whale apomyoglobin as carrier,
were precipitated by mixing with 2 volumes of acetone at 20 °C
(44). The solubilized precipitates and 20 µl of S10 fraction that was
not precipitated (lane 15) were subjected to electrophoresis
in denaturing gels, transferred electrically to nitrocellulose sheets,
and reacted with antibody to PP1 or 134.5 protein as
described under "Materials and Methods." B,
autoradiographic image of purified, in vitro phosphorylated
eIF-2 reacted with fractions 17-32 described in the legend to Fig. 7.
Aliquots of the indicated Superdex 200 fractions from HSV-1-infected
HeLa cell lysates were tested for their ability to dephosphorylate
32P-labeled eIF-2( , ) as described under "Materials
and Methods." Lane 8 contains untreated,
32P-labeled eIF-2, and the mixture in lane 9 received 0.5 µl of the initial HeLa cell S10 fraction. The
arrows marked and indicate the positions of the and subunits of eIF-2. The arrow marked 39 K
indicates the position of a Mr 39,000 protein
unrelated to eIF-2 (8).
|
|
The results of assays of the fractions for PP1 and 134.5
proteins shown in Fig. 8A indicate that virtually all of
134.5 protein and a majority of PP1 cofractionated in
fractions 22-24, exactly paralleling the elution of eIF-2( P)
phosphatase (Fig. 7). These results were reproduced in a separate
experiment in which smaller aliquots (30 µl) of fractions 15-36 of
Superdex 200 fractions were subjected to electrophoresis and reacted
with the antibody to the 134.5 protein. The results were
identical to those shown in Fig. 8A and showed no detectable
134.5 protein in fractions 27-36 (data not shown).
Because fractions 22-24 constitute a minimum of the protein eluting
from the column, as estimated by the A280
profile (Fig. 7), the results strongly suggest that the activated
eIF-2( P) phosphatase in HSV-1-infected HeLa cells consists of a
complex with a molecular weight of approximately 340,000 that contains
the 134.5 protein and PP1 either alone but in multiple
copies or in association with other proteins.
To characterize this complex further, we chromatographed crude
HSV-1(F)-infected HeLa cell lysate or the purified complex obtained
from gel filtration on Superdex 200 (Figs. 7 and 8) on a Mono Q column.
To our surprise, none of the fractions from either chromatographic
procedures yielded any phosphatase activity specific for eIF-2 .
Assays of the aliquots of fractions 2-40 from the Mono Q
chromatography indicated that the 134.5 protein eluted in fractions 28-34 with peaks at 29 and 32-33 (data not shown). Because the KCl in these fractions is approximately 0.53-0.68 M, our inability to recover activated eIF-2( P)
phosphatase was probably the result of the dissociation of the complex
by the high KCl concentrations required to elute the
134.5 protein.
 |
DISCUSSION |
The salient features of this report are as follows. First, in an
earlier article we reported that the 134.5 protein binds to PP1 and that the cells infected with wild-type virus but not the
cells infected with the 134.5 mutant
contain a highly potent, phosphatase activity specific for the subunit of the translation initiation factor eIF-2. In this report we
link the two observations by showing that the cytoplasm of wild-type
virus-infected cells contained a high molecular weight complex that
contained both 134.5 protein and PP1 and that this
fraction specifically dephosphorylated eIF-2( P). The approximate molecular weight of the complex (340,000) is
significantly higher than the combined molecular weight of single
copies of 134.5 protein and PP1. The results suggest
that either one or both interacting proteins are present in several
copies or that the complex has additional as yet unknown
polypeptides.
Although we have not specifically addressed the issue, the results of
our studies do not support the hypothesis that the amount of PP1
increased after infection. In several experiments we have not observed
significant change in the level of protein phosphatase 1, as measured
by immunoblotting with anti-PP1 antibody in HeLa cells infected with
HSV-1 when compared with HeLa cells that were mock-infected or infected
with the 134.5 deletion mutant (data not shown). Rather,
the results of this and preceding studies are consistent with the
hypothesis that the 134.5 protein binds to PP1 and that
the activity is enhanced and redirected to dephosphorylate eIF-2 .
Second, we have identified the domain of the 134.5
protein that binds to PP1. Specifically, the sequence of amino acids
190-203 of the 134.5 protein fused to GST strongly
bound and pulled down PP1. Moreover, a peptide containing amino acids
185-211 of the 134.5 protein competed with the protein
for binding to PP1 and substitution of Val193 and
Phe195 with Glu and Leu, respectively, abolished the
activity of the 134.5 protein. The significance of these
observations stems from the fact that this sequence is highly conserved
among homologs of GADD34 and is also present in the NL protein of
African swine fever virus (Fig. 1). More important, this sequence,
exemplified in greater detail in Table I,
contains a motif ((Arg/Lys)-(Val/Ile)-Xaa-Phe) present in all of the
subunit, accessory, or regulatory proteins that bind directly to the
catalytic subunit of PP1 (27, 28). These proteins interact with the
catalytic subunit of PP1 (PP1c) in a mutually exclusive manner. Among
the interacting proteins studied to date are the G-subunit
(GM), which targets the PP1 to glycogen particles in muscle
(35), DARPP-32 (dopamine and cAMP-regulated phosphoprotein) (36),
inhibitor 1 (37), splicing factor polypyrimidine tract-binding
protein-associated splicing factor (38), p53BP2 (39), and NIPP-1 (40).
Peptides containing this motif have been shown to bind PP1c and to
disrupt or attenuate the effects of binding of interacting subunits
(27, 28). In this report, we also showed that the 134.5
peptide containing this motif disrupted the binding of the
134.5 protein to PP1.
The current definition of PP1 regulatory or subunit proteins is that
they bind to the catalytic domain of the PP1 and that they regulate or
direct PP1 activity to specific substrates. Inasmuch as (i)
134.5 protein binds PP1, (ii) the binding site has the motif common to PP1 subunits that bind the catalytic subunit, and (iii)
the function of PP1 is redirected to dephosphorylate eIF-2( P), the
carboxyl-terminal domain of the 134.5 protein has the
structural and functional attributes of a PP1 subunit.
Third, as shown in Fig. 5, the recombinant virus carrying a truncated
134.5 protein that contains the PP1-binding motif did not block the shut-off of protein synthesis associated with activated PKR. This result indicates that the binding site is necessary to enable
binding but not sufficient to redirect PP1 to dephosphorylate eIF-2( P). We have also noted that the domain of the
134.5 protein carboxyl-terminal to the binding motif
(amino acids 205-263) also binds PP1 but weakly. Relevant to the
interpretation of these data are two observations: (i) subunits of PP1
may contain catalytic subunit-binding sites in addition to the
(Arg/Lys)-(Val/Ile)-Xaa-Phe binding motif (28) and (ii) as noted in the
Introduction, the carboxyl terminus of the GADD34 protein can
substitute for the carboxyl terminus of the 134.5
protein in blocking the shut-off of protein synthesis and also binds
PP1. GADD34 and 134.5 proteins share significant
homology in their amino acid sequences carboxyl-terminal to the
(Arg/Lys)-(Val/Ile)-Xaa-Phe binding motif. We interpret these results
to suggest that like other subunits of the PP1, 134.5
protein contains sequences that interact with the PP1 catalytic domain
and also, possibly, with other proteins to bring about the direct
interaction of PP1 with eIF-2 . As is the case with many other
subunits of the PP1 protein, this aspect of the three-body interaction
(the catalytic PP1 domain, the regulatory subunit, and the
substrate) remains to be elucidated.
Fourth, the question remains as to the function of GADD34. Of the
various GADD proteins, GADD34 is the least well understood. Our studies
suggest that at least the carboxyl-terminal domain of the protein has
functions consistent with those of a PP1 subunit similar to that of the
134.5 protein. The conclusion that GADD34 can perform
this function does not exclude the possibility that this protein has
other functions as well.
Lastly, it seems appropriate to stress that activation of PKR is a
common obstacle facing most viruses studied to date. In turn, viruses
have evolved a variety of mechanisms to block the shut-off of protein
synthesis resulting from phosphorylation of the eIF-2 . The herpes
simplex viruses and possibly, African Swine fever virus, have a
mechanism very different from any studied to date in that they have
expropriated a piece of a cellular protein to cause the
dephosphorylation of eIF-2 rather than to block the activation of
PKR or the phosphorylation of eIF-2 . It is also important to note
that this mechanism is not universally used by all herpesviruses
because the 134.5 gene is conserved among very few
herpesviruses sequenced to date. These observations are consistent with
the hypothesis that GADD34 does indeed enable the dephosphorylation of
eIF-2 in response to stress and that the transient expression of the
gene may explain why so few viruses captured the essential domain of
the GADD34 gene to nullify the effect of activated PKR.
 |
ACKNOWLEDGEMENTS |
We thank Suzanne Hessefort and Annette Olin
for technical assistance.
 |
FOOTNOTES |
*
This work was supported by Grants CA47451 and AI124009 from
the National Cancer Institute (to B. R.), Grant HL30121 from the NHLBI, National Institutes of Health (to M. G.), and a grant from the United States Public Health Service.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Marjorie B. Kovler
Viral Oncology Laboratories, University of Chicago, 910 East 58th St.,
Chicago IL 60637. Tel.: 773-702-1898; Fax: 773-702-1631; E-mail:
bernard{at}kovler.uchicago.edu.
The abbreviations used are:
HSV-1, herpes
simplex virus 1; PKR, double-stranded RNA-activated protein kinase; PP1, protein phosphatase 1 ; GST, glutathione
S-transferasepfu, plaque-forming unit(s).
 |
REFERENCES |
-
Chou, J.,
Kern, E. R., R. J.,
Whitely, R. J.,
and Roizman, B.
(1990)
Science
250,
1262-1266[Abstract/Free Full Text]
-
Whitley, R. J.,
Kern, E. R.,
Chatterjee, S.,
Chou, J.,
and Roizman, B.
(1993)
J. Clin. Invest.
91,
2837-2843
-
Andreansky, S. S.,
He, B.,
Gillespie, G. Y.,
Soroceanu, L.,
Markert, J.,
Chou, J.,
Roizman, B.,
and Whitley, A. J.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
11313-11318[Abstract/Free Full Text]
-
Andreansky, S.,
Soroceanu, L.,
Flote, E. R.,
Chou, J.,
Markert, J. M.,
Gillespie, G. Y.,
Roizman, B.,
and Whitley, J. W.
(1997)
Cancer Research
57,
1502-15099[Abstract/Free Full Text]
-
Chou, J.,
and Roizman, B.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
3266-3270[Abstract/Free Full Text]
-
Chou, J.,
and Roizman, B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5247-5251[Abstract/Free Full Text]
-
Chou, J.,
Chen, J. J.,
Gross, M.,
and Roizman, B.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10516-10520[Abstract/Free Full Text]
-
He, B.,
Gross, M.,
and Roizman, B.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
843-848[Abstract/Free Full Text]
-
Ackermann, M.,
Chou, J.,
Sarmiento, M.,
Lerner, R. A.,
and Roizman, B.
(1986)
J. Virol.
58,
843-850[Abstract/Free Full Text]
-
Chou, J.,
and Roizman, B.
(1986)
J. Virol.
57,
629-637[Abstract/Free Full Text]
-
Chou, J.,
and Roizman, B.
(1990)
J. Virol.
64,
1014-1020[Abstract/Free Full Text]
-
Sussman, M. D.,
Kutish, L. G.,
Afonso, C. L.,
Roberts, P.,
and Rock, D. L.
(1992)
J. Virol.
66,
5586-5589[Abstract/Free Full Text]
-
McGeoch, D. J.,
and Barnett, B. C.
(1991)
Nature
353,
609[Medline]
[Order article via Infotrieve]
-
Lord, K. A.,
Hoffman-Liebermann, B.,
and Liebermann, D. A.
(1990)
Nucleic Acids Res.
18,
2823[Free Full Text]
-
Zhan, Q. M.,
Lord, K. A.,
Alamo, I., Jr.,
Hollander, M. C.,
Carrier, F.,
Ron, D.,
Kohn, K. W.,
Hoffman, B., D. A.,
Liebermann, D. A.,
and Fornace, A. J., Jr.
(1994)
Mol. cell. Biol.
14,
2361-2371[Abstract/Free Full Text]
-
Fornace, A. J., Jr.,
Nebert, D. W., M. C.,
Hollander, M. C., J. D.,
Luethy, J. D., M.,
Papathanasiou, M., J.,
Fargnoli, J.,
and Holbrook, N. J.
(1989)
Mol. Cell. Biol.
9,
4196-4203[Abstract/Free Full Text]
-
Hollander, M. C.,
Zhan, Q.,
Bae, I.,
and Fornace, A. J., Jr.
(1997)
J. Biol. Chem.
272,
13731-13737[Abstract/Free Full Text]
-
He, B.,
Chou, J.,
Liebermann, D. A.,
Hoffman, B,
and Roizman, B.
(1996)
J. Virol.
70,
84-90[Abstract]
-
Cohen, P.
(1989)
Annu. Rev. Biochem.
58,
453-508[CrossRef][Medline]
[Order article via Infotrieve]
-
Hemmings, B. A.,
Resink, T. J.,
and Cohen, P.
(1982)
FEBS lett.
150,
319-324[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, Y. H.,
Chen, M. X.,
Alessi, D. R.,
Campbell, D. G.,
Shanahan, C.,
Cohen, P.,
and Cohen, P. T.
(1994)
FEBS Lett.
356,
51-55[CrossRef][Medline]
[Order article via Infotrieve]
-
Tang, P. M.,
Bondor, J. A.,
Swiderek, K. M.,
and DePaoli-Roach, A. A.
(1991)
J. Biol. Chem.
266,
15782-15789[Abstract/Free Full Text]
-
Hirano, K.,
Ito, M.,
and Hartshorne, D. J.
(1995)
J. Biol. Chem.
270,
19786-19790[Abstract/Free Full Text]
-
Doherty, M. J.,
Moorhead, G.,
Morrice, N.,
Cohen, P.,
and Cohen, P. T. W.
(1995)
FEBS Lett.
375,
294-298[CrossRef][Medline]
[Order article via Infotrieve]
-
Doherty, M. J.,
Young, P. R.,
and Cohen, P. T. w.
(1996)
FEBS Lett.
399,
339-343[CrossRef][Medline]
[Order article via Infotrieve]
-
Shenolikar, S.
(1994)
Annu. Rev. Cell Biol.
10,
55-86[CrossRef]
-
Kwon, Y. G.,
Huang, H. B.,
Desdouts, F.,
Giraul, J. A.,
Greengard, P.,
and Nairn, A. C.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
3536-3541[Abstract/Free Full Text]
-
Egloff, M. P.,
Johnson, D. F.,
Moorhead, G.,
Cohen, P. T. W.,
Cohen, P.,
and Barford, D.
(1997)
EMBO J.
16,
1876-1887[CrossRef][Medline]
[Order article via Infotrieve]
-
Ejercito, P. M.,
Kieff, E. D.,
and Roizman, R.
(1968)
J. Gen. Virol.
2,
357-364[Abstract/Free Full Text]
-
Post, L. E.,
and Roizman, B.
(1981)
Cell
25,
227-233[CrossRef][Medline]
[Order article via Infotrieve]
-
Lagunoff, M.,
and Roizman, B.
(1995)
J. Virol.
69,
3605-3623[Abstract]
-
Gross, M.,
and Kaplansky, D. A.
(1980)
J. Biol. chem.
255,
6270-6275[Free Full Text]
-
Gross, M.,
and Rabinovitz, M.
(1973)
Biochem. Biophys. Res. Commun.
50,
832-838[CrossRef][Medline]
[Order article via Infotrieve]
-
Gross, M.,
and Kaplansky, D. A.
(1983)
Biochim. Biophys. Acta
740,
255-263[Medline]
[Order article via Infotrieve]
-
Dent, P.,
Lavoinne, A.,
Nakielny, S.,
Caudwell, F. B.,
Watt, P.,
and Cohen, P.
(1990)
Nature
348,
302-308[CrossRef][Medline]
[Order article via Infotrieve]
-
Williams, K. R., Hemmings, H. C., Jr., LoPresti, M. B.,
Konigsberg, W. H., and Greengard, P. (1986) 261, 1890-1903
-
Aitken, A.,
and Cohen, P.
(1982)
FEBS Lett.
147,
54-58[CrossRef][Medline]
[Order article via Infotrieve]
-
Hirano, K.,
Erdodi, F.,
Patton, J. G.,
and Hartshorne, D. J.
(1996)
FEBS Lett.
389,
191-194[CrossRef][Medline]
[Order article via Infotrieve]
-
Helps, N. R.,
Barker, H. M.,
Elledge, S. J.,
and Cohen, P. T.
(1995)
FEBS Lett.
377,
295-300[CrossRef][Medline]
[Order article via Infotrieve]
-
Van Eynde, A.,
Wera, S.,
Beullens, M.,
Torrekens, S.,
Van Leuven, F.,
Stalmans, W.,
and Bollen, M.
(1995)
J. Biol. Chem.
270,
28068-28074[Abstract/Free Full Text]
-
McGeoch, D. J.,
Cunningham, C.,
McIntyre, G.,
and Dolen, A.
(1991)
J. Gen. Virol.
72,
3057-3075[Abstract/Free Full Text]
-
Sheldrick, P.,
and Bertelot, N.
(1975)
Cold Spring Harber symp. Quant. Biol.
39,
667-678
-
Wadsworth, S.,
Jacob, R. J.,
and Roizman.
(1975)
J. Virol.
15,
1487-1497[Abstract/Free Full Text]
-
Gross, M.,
Wing, M.,
Rundquist, C.,
and Rubino, M. S.
(1987)
J. Biol. Chem.
262,
6899-6907[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Tang, A. Patel, and P. R. Krause
Novel Less-Abundant Viral MicroRNAs Encoded by Herpes Simplex Virus 2 Latency-Associated Transcript and Their Roles in Regulating ICP34.5 and ICP0 mRNAs
J. Virol.,
February 1, 2009;
83(3):
1433 - 1442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Verpooten, Y. Ma, S. Hou, Z. Yan, and B. He
Control of TANK-binding Kinase 1-mediated Signaling by the {gamma}134.5 Protein of Herpes Simplex Virus 1
J. Biol. Chem.,
January 9, 2009;
284(2):
1097 - 1105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rivera, C. Abrams, B. Hernaez, A. Alcazar, J. M. Escribano, L. Dixon, and C. Alonso
The MyD116 African Swine Fever Virus Homologue Interacts with the Catalytic Subunit of Protein Phosphatase 1 and Activates Its Phosphatase Activity
J. Virol.,
March 15, 2007;
81(6):
2923 - 2929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Garcia, J. Gil, I. Ventoso, S. Guerra, E. Domingo, C. Rivas, and M. Esteban
Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action
Microbiol. Mol. Biol. Rev.,
December 1, 2006;
70(4):
1032 - 1060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Marciniak and D. Ron
Endoplasmic reticulum stress signaling in disease.
Physiol Rev,
October 1, 2006;
86(4):
1133 - 1149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Latreille and L. Larose
Nck in a Complex Containing the Catalytic Subunit of Protein Phosphatase 1 Regulates Eukaryotic Initiation Factor 2{alpha} Signaling and Cell Survival to Endoplasmic Reticulum Stress
J. Biol. Chem.,
September 8, 2006;
281(36):
26633 - 26644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Pasieka, T. Baas, V. S. Carter, S. C. Proll, M. G. Katze, and D. A. Leib
Functional genomic analysis of herpes simplex virus type 1 counteraction of the host innate response.
J. Virol.,
August 1, 2006;
80(15):
7600 - 7612.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ammosova, M. Jerebtsova, M. Beullens, B. Lesage, A. Jackson, F. Kashanchi, W. Southerland, V. R. Gordeuk, M. Bollen, and S. Nekhai
Nuclear Targeting of Protein Phosphatase-1 by HIV-1 Tat Protein
J. Biol. Chem.,
October 28, 2005;
280(43):
36364 - 36371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Mezhir, S. J. Advani, K. D. Smith, T. E. Darga, A. P.W. Poon, H. Schmidt, M. C. Posner, B. Roizman, and R. R. Weichselbaum
Ionizing Radiation Activates Late Herpes Simplex Virus 1 Promoters via the p38 Pathway in Tumors Treated with Oncolytic Viruses
Cancer Res.,
October 15, 2005;
65(20):
9479 - 9484.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Jing and B. He
Characterization of the triplet repeats in the central domain of the {gamma}134{middle dot}5 protein of herpes simplex virus 1
J. Gen. Virol.,
September 1, 2005;
86(9):
2411 - 2419.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Cheng, Z. Feng, and B. He
Herpes Simplex Virus 1 Infection Activates the Endoplasmic Reticulum Resident Kinase PERK and Mediates eIF-2{alpha} Dephosphorylation by the {gamma}134.5 Protein
J. Virol.,
February 1, 2005;
79(3):
1379 - 1388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Taddeo, W. Zhang, F. Lakeman, and B. Roizman
Cells Lacking NF-{kappa}B or in Which NF-{kappa}B Is Not Activated Vary with Respect to Ability To Sustain Herpes Simplex Virus 1 Replication and Are Not Susceptible to Apoptosis Induced by a Replication-Incompetent Mutant Virus
J. Virol.,
November 1, 2004;
78(21):
11615 - 11621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Jing, M. Cerveny, K. Yang, and B. He
Replication of Herpes Simplex Virus 1 Depends on the {gamma}134.5 Functions That Facilitate Virus Response to Interferon and Egress in the Different Stages of Productive Infection
J. Virol.,
July 15, 2004;
78(14):
7653 - 7666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Chee and B. Roizman
Herpes Simplex Virus 1 Gene Products Occlude the Interferon Signaling Pathway at Multiple Sites
J. Virol.,
April 15, 2004;
78(8):
4185 - 4196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kebache, E. Cardin, D. T. Nguyen, E. Chevet, and L. Larose
Nck-1 Antagonizes the Endoplasmic Reticulum Stress-induced Inhibition of Translation
J. Biol. Chem.,
March 5, 2004;
279(10):
9662 - 9671.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Shi, C. Sun, B. He, W. Xiong, X. Shi, D. Yao, and X. Cao
GADD34-PP1c recruited by Smad7 dephosphorylates TGF{beta} type I receptor
J. Cell Biol.,
January 19, 2004;
164(2):
291 - 300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. CEULEMANS and M. BOLLEN
Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button
Physiol Rev,
January 1, 2004;
84(1):
1 - 39.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jousse, S. Oyadomari, I. Novoa, P. Lu, Y. Zhang, H. P. Harding, and D. Ron
Inhibition of a constitutive translation initiation factor 2{alpha} phosphatase, CReP, promotes survival of stressed cells
J. Cell Biol.,
November 24, 2003;
163(4):
767 - 775.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mulvey, J. Poppers, D. Sternberg, and I. Mohr
Regulation of eIF2{alpha} Phosphorylation by Different Functions That Act during Discrete Phases in the Herpes Simplex Virus Type 1 Life Cycle
J. Virol.,
October 15, 2003;
77(20):
10917 - 10928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Cheng, K. Yang, and B. He
Dephosphorylation of eIF-2{alpha} Mediated by the {gamma}134.5 Protein of Herpes Simplex Virus Type 1 Is Required for Viral Response to Interferon but Is Not Sufficient for Efficient Viral Replication
J. Virol.,
September 15, 2003;
77(18):
10154 - 10161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Wakula, M. Beullens, H. Ceulemans, W. Stalmans, and M. Bollen
Degeneracy and Function of the Ubiquitous RVXF Motif That Mediates Binding to Protein Phosphatase-1
J. Biol. Chem.,
May 23, 2003;
278(21):
18817 - 18823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Hung, R. S. Roberson, J. Taft, and D. Y. Wu
Human BAG-1 Proteins Bind to the Cellular Stress Response Protein GADD34 and Interfere with GADD34 Functions
Mol. Cell. Biol.,
May 15, 2003;
23(10):
3477 - 3486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Mao and K. S. Rosenthal
Strain-Dependent Structural Variants of Herpes Simplex Virus Type 1 ICP34.5 Determine Viral Plaque Size, Efficiency of Glycoprotein Processing, and Viral Release and Neuroinvasive Disease Potential
J. Virol.,
March 15, 2003;
77(6):
3409 - 3417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Brush, D. C. Weiser, and S. Shenolikar
Growth Arrest and DNA Damage-Inducible Protein GADD34 Targets Protein Phosphatase 1{alpha} to the Endoplasmic Reticulum and Promotes Dephosphorylation of the {alpha} Subunit of Eukaryotic Translation Initiation Factor 2
Mol. Cell. Biol.,
February 15, 2003;
23(4):
1292 - 1303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jones
Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency
Clin. Microbiol. Rev.,
January 1, 2003;
16(1):
79 - 95.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Kozubowski, H. Panek, A. Rosenthal, A. Bloecher, D. J. DeMarini, and K. Tatchell
A Bni4-Glc7 Phosphatase Complex That Recruits Chitin Synthase to the Site of Bud Emergence
Mol. Biol. Cell,
January 1, 2003;
14(1):
26 - 39.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S.-L. Tan, S. U. Tareen, M. W. Melville, C. M. Blakely, and M. G. Katze
The Direct Binding of the Catalytic Subunit of Protein Phosphatase 1 to the PKR Protein Kinase Is Necessary but Not Sufficient for Inactivation and Disruption of Enzyme Dimer Formation
J. Biol. Chem.,
September 20, 2002;
277(39):
36109 - 36117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Cheng, M.-E. Brett, and B. He
Signals That Dictate Nuclear, Nucleolar, and Cytoplasmic Shuttling of the {gamma}134.5 Protein of Herpes Simplex Virus Type 1
J. Virol.,
August 12, 2002;
76(18):
9434 - 9445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Y. Wu, D. C. Tkachuck, R. S. Roberson, and W. H. Schubach
The Human SNF5/INI1 Protein Facilitates the Function of the Growth Arrest and DNA Damage-inducible Protein (GADD34) and Modulates GADD34-bound Protein Phosphatase-1 Activity
J. Biol. Chem.,
July 26, 2002;
277(31):
27706 - 27715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Williams-Hart, X. Wu, and K. Tatchell
Protein Phosphatase Type 1 Regulates Ion Homeostasis in Saccharomyces cerevisiae
Genetics,
April 1, 2002;
160(4):
1423 - 1437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Mao and K. S. Rosenthal
An N-terminal Arginine-rich Cluster and a Proline-Alanine-Threonine Repeat Region Determine the Cellular Localization of the Herpes Simplex Virus Type 1 ICP34.5 Protein and Its Ligand, Protein Phosphatase 1
J. Biol. Chem.,
March 22, 2002;
277(13):
11423 - 11431.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Cassady, M. Gross, G. Y. Gillespie, and B. Roizman
Second-Site Mutation Outside of the US10-12 Domain of {Delta}{gamma}134.5 Herpes Simplex Virus 1 Recombinant Blocks the Shutoff of Protein Synthesis Induced by Activated Protein Kinase R and Partially Restores Neurovirulence
J. Virol.,
February 1, 2002;
76(3):
942 - 949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Connor, D. C. Weiser, S. Li, J. M. Hallenbeck, and S. Shenolikar
Growth Arrest and DNA Damage-Inducible Protein GADD34 Assembles a Novel Signaling Complex Containing Protein Phosphatase 1 and Inhibitor 1
Mol. Cell. Biol.,
October 15, 2001;
21(20):
6841 - 6850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Novoa, H. Zeng, H. P. Harding, and D. Ron
Feedback Inhibition of the Unfolded Protein Response by GADD34-mediated Dephosphorylation of eIF2{alpha}
J. Cell Biol.,
May 21, 2001;
153(5):
1011 - 1022.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Cheng, M. Gross, M.-E. Brett, and B. He
AlaArg Motif in the Carboxyl Terminus of the {gamma}134.5 Protein of Herpes Simplex Virus Type 1 Is Required for the Formation of a High-Molecular-Weight Complex That Dephosphorylates eIF-2{alpha}
J. Virol.,
April 15, 2001;
75(8):
3666 - 3674.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H.P. HARDING, I. NOVOA, A. BERTOLOTTI, H. ZENG, Y. ZHANG, F. URANO, C. JOUSSE, and D. RON
Translational Regulation in the Cellular Response to Biosynthetic Load on the Endoplasmic Reticulum
Cold Spring Harb Symp Quant Biol,
January 1, 2001;
66(0):
499 - 508.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-L. Tan and M. G. Katze
HSV.com: Maneuvering the internetworks of viral neuropathogenesis and evasion of the host defense
PNAS,
May 23, 2000;
97(11):
5684 - 5686.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Ajuh, G. J. Browne, N. A. Hawkes, P. T. W. Cohen, S. G. E. Roberts, and A. I. Lamond
Association of a protein phosphatase 1 activity with the human factor C1 (HCF) complex
Nucleic Acids Res.,
February 1, 2000;
28(3):
678 - 686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. N. Khodarev, S. J. Advani, N. Gupta, B. Roizman, and R. R. Weichselbaum
Accumulation of specific RNAs encoding transcriptional factors and stress response proteins against a background of severe depletion of cellular RNAs in cells infected with herpes simplex virus 1
PNAS,
October 12, 1999;
96(21):
12062 - 12067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Goatley, M. Marron, S. Jacobs, J. Hammond, J. Miskin, C. Abrams, G. Smith, and L. Dixon
Nuclear and nucleolar localization of an African swine fever virus protein, I14L, that is similar to the herpes simplex virus-encoded virulence factor ICP34.5
J. Gen. Virol.,
March 1, 1999;
80(3):
525 - 535.
[Abstract]
|
 |
|

|
 |

|
 |
 
K. U. Kumar, S. P. Srivastava, and R. J. Kaufman
Double-Stranded RNA-Activated Protein Kinase (PKR) Is Negatively Regulated by 60S Ribosomal Subunit Protein L18
Mol. Cell. Biol.,
February 1, 1999;
19(2):
1116 - 1125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Leib, M. A. Machalek, B. R. G. Williams, R. H. Silverman, and H. W. Virgin
From the Cover: Specific phenotypic restoration of an attenuated virus by knockout of a host resistance gene
PNAS,
May 23, 2000;
97(11):
6097 - 6101.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|