|
J Biol Chem, Vol. 273, Issue 33, 20810-20819, August 14, 1998
Sequence-specific Binding of Ku Autoantigen to
Single-stranded DNA*
Heather
Torrance §,
Ward
Giffin¶,
David J.
Rodda ,
Louise
Pope¶, and
Robert J. G.
Haché¶ **
From the Departments of ¶ Medicine and Biochemistry,
Microbiology, and Immunology and the Graduate Program in
Biochemistry, University of Ottawa, Loeb Institute for Medical
Research, Ottawa Civic Hospital, Ottawa, Ontario K1Y 4E9, Canada
 |
ABSTRACT |
Glucocorticoid-induced transcription of mouse
mammary tumor virus is repressed by Ku
antigen/DNA-dependent protein kinase (DNA-PK) through a DNA
sequence element (NRE1) in the viral long terminal repeat. Nuclear
factors binding to the separated single strands of NRE1 have been
identified that may also be important for transcriptional regulation
through this element. We report the separation of the upper-stranded
NRE1 binding activity in Jurkat T cell nuclear extracts into two
components. One component was identified as Ku antigen. The DNA
sequence preference for Ku binding to single-stranded DNA closely
paralleled the sequence requirements of Ku for double-stranded DNA.
Recombinant Ku bound the single, upper strand of NRE1 with an affinity
that was 3-4-fold lower than its affinity for double-stranded NRE1.
Sequence-specific single-stranded Ku binding occurred rapidly
(t1/2 on = 2.0 min) and was exceptionally
stable, with an off rate of t1/2= 68 min. While
Ku70 cross-linked to the upper strand of NRE1 when Ku was bound to
double-stranded and single-stranded DNAs, the Ku80 subunit only
cross-linked to single-stranded NRE1. Intriguingly, addition of
Mg2+ and ATP, the cofactors required for Ku helicase
activity, induced the cross-linking of Ku80 to a double-stranded
NRE1-containing oligonucleotide, without completely unwinding the two
strands.
 |
INTRODUCTION |
Mouse mammary tumor virus is a slow transforming retrovirus that
causes mammary tumors in lactating mice (1, 2). Transcription of
MMTV1 is strongly induced by
steroid hormones through a promoter proximal regulatory region of the
LTR that has been characterized in great detail (3-10). A second
region, at the 5' end of the LTR, mediates tissue-specific expression
and responsiveness to prolactin (11, 12). Recently, it has been
demonstrated that the region of the viral LTR between 420 and 360
contains sequences that act to repress viral transcription in several
cell types, but most notably in T cells (13-20). These sequences
appear to be important for restricting cellular transformation by MMTV
to the mammary gland, as viruses containing deletions encompassing this
region of the LTR induce T cell lymphoma in addition to mammary
carcinoma (19, 21-26).
In preliminary mapping experiments, we identified a 14-base pair
polypurine/polypyrimidine DNA sequence element (NRE1) within the
negative regulatory region of the LTR of the GR strain of MMTV that was
sufficient to repress glucocorticoid hormone-induced MMTV transcription
(20). Subsequently, we demonstrated that this sequence functioned as a
direct, sequence-specific DNA binding site for Ku
autoantigen/ DNA-dependent protein kinase (DNA-PK) (27). Both Ku and
the DNA-PK catalytic subunit (DNA-PKcs) were found to be
required for the transcriptional effects of NRE1 on MMTV expression
(27).
Ku (p70/p80) is an unusual DNA-binding protein that functions as both a
DNA binding subunit and an allosteric activator of the
DNA-PKcs (28). Ku/DNA-PKcs are predominantly
nuclear proteins that are involved in multiple aspects of cellular
homeostasis. In particular, Ku/DNA-PK are required for V(D)J
recombination of immunoglobulin genes and the correct repair of
double-stranded DNA breaks by the nonhomologous DNA break-repair
pathway (29-36). Additionally, Ku/DNA-PK have been implicated in the
regulation of transcription by RNA polymerases I and II (27, 37, 38), DNA replication (39, 40), and control of progression through the cell
cycle (35, 36).
The many activities of Ku appear to depend on its prolific and unique
ability to interact with multiple forms of DNA. Prior to the
identification of Ku as a sequence-specific DNA binding protein, it was
well established that Ku was a DNA end-binding protein that also
recognized DNA nicks and virtually any double to single-stranded
transition in DNA including DNA loops and cruciform structures (28,
41-45). However, unstructured single-stranded DNA was only poorly
recognized by Ku (44-46). Sequence-specific binding to NRE1 is
preferred to DNA end binding (47). Remarkably, Ku bound to
double-stranded DNA also has the ability to translocate along DNA from
its entry point at NRE1 or DNA ends (28, 41, 42). Translocation of Ku
is a process that appears to be facilitated by Mg2+, but
does not require energy (27, 42). Additionally, Ku has also been
identified to be both an ATPase and the human HDH II DNA helicase (46,
48). This helicase activity appears to be somewhat limited, as Ku is
reported to only be effective in unwinding linear double-stranded DNAs
containing extended single-stranded overhangs adjacent to the
double-stranded sequence (46).
Although Ku/DNA-PKcs appear to be required for
NRE1-mediated transcriptional repression (27), nuclear factor
recognition of NRE1 is complex. In addition to the double-stranded
NRE1 binding activity of Ku, we have also observed nuclear factors that
specifically recognized the upper and lower single strands of
NRE1-containing DNAs (20, 49). The identity of these factors and their
role in NRE1-mediated transcriptional regulation is not known. The potential for these strand-specific factors to interact with NRE1 in vivo is particularly intriguing in light of the helicase
activity of Ku (46) and our previous observation that nuclear factor binding to double-stranded NRE1 induces
Mg2+-dependent structural transitions in MMTV
LTR flanking sequences that are sensitive to the single strand-specific
agents, KMnO4 and S1 nuclease (50).
In the present study we have initiated a characterization of the
nuclear factors that bind specifically to the polypurine rich upper
strand of NRE1. A single-stranded oligonucleotide affinity column
separated NRE1 binding activity into two fractions. One of the factors
was purified to homogeneity. Remarkably, this sequence-specific, single-stranded NRE1 binding activity was revealed to be Ku. Both purified Ku and recombinant Ku expressed in insect cells from baculovirus vectors bound specifically and stably to the single, upper
strand of NRE1. While the affinity of Ku for single-stranded NRE1 was
slightly lower than its affinity for the double-stranded element, the
DNA-sequence requirements for binding to the two forms of DNA
overlapped closely. Cross-linking experiments indicated that while only
the 70-kDa subunit of Ku (Ku70) appeared to contact double-stranded
NRE1, Ku binding to the upper, single strand of NRE1 also involved
direct participation of the 80-kDa Ku subunit (Ku80) with the DNA.
Intriguingly, the addition of Mg2+ and/or ATP to a binding
reaction containing double-stranded NRE1 induced contact of Ku80 with
the upper strand of NRE1 without completely unwinding the
oligonucleotide tested. The implication of these findings for the
regulation of MMTV transcription are discussed.
 |
MATERIALS AND METHODS |
Tissue Culture and Antibodies--
Jurkat T cells were cultured
in RPMI 1640 (Life Technologies Inc.) supplemented with 10% fetal
bovine serum and incubated at 37 °C in 5% CO2. The
Spodoptera frugiperda cell line Sf9 was grown in
TMN-FH medium (Invitrogen) at 27 °C. Anti-Ku antibody Ab162 (51) was
generously provided by W. Reeves.
Preparation of NRE1 DNA Affinity Matrices--
To prepare a
single-stranded DNA oligonucleotide affinity column for the
purification of proteins binding to the upper strand of NRE1 (upNRE1),
an 80-mer oligonucleotide containing four copies of the upNRE1 sequence
5'-(ACTGAGAAAGAGAAAGACGA)4-3' was synthesized on a Beckman
Oligo 1000 DNA synthesizer. This oligonucleotide was coupled to
cyanogen bromide-activated Sepharose CL-2B as described previously (52,
53).
For the double-stranded NRE1 affinity chromatography, synthetic
oligonucleotides containing sequences corresponding to upper and lower
NRE1 strands: upMTV = 5'-ACCGGACTGAGAAAGAGAAAGACGAC-3', loMTV = 5'-GTCGTCTTTCTCTTTCTCAGTCCGGT-3' were annealed to form double-stranded MTV, phosphorylated, and ligated to form oligomers which were then coupled to cyanogen bromide-activated Sepharose according to Kadonaga and Tjian (52).
Purification of an Upper-stranded NRE1 Binding
Protein--
Nuclear extracts were prepared from Jurkat T cells as
described by Dignam et al. (54), except that KCl was
substituted for NaCl. 6 mg of crude Jurkat nuclear extract was loaded
onto a 2-ml upMTV-Sepharose column equilibrated to 100 mM
KCl in buffer A (20 mM HEPES, pH 7.9, 20% glycerol, 0.2 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride,
0.5 mM dithiothreitol, 0.1% Nonidet P-40). The column was
washed with 3 column volumes of buffer A in 0.1 M KCl, then eluted with a stepwise gradient of 3 volumes of 0.2, 0.4, 0.6, and 0.8 M KCl in buffer A.
Double-stranded NRE1 affinity chromatography was accomplished by
combining and diluting the 0.2 M KCl fractions from the
upNRE1 column in buffer A to 0.1 M KCl and loading the
sample onto a 1-ml double-stranded sMTV affinity column equilibrated to
0.1 M KCl with buffer A. The column was washed with 3 column volumes of buffer A, then eluted with a stepwise gradient of 3 volumes of 0.3, 0.5, and 1.0 M KCl in buffer A. To analyze
the protein content of individual fractions, samples were fractionated
on 10% SDS-polyacrylamide gels, and the proteins were visualized by
silver staining (Bio-Rad).
Electrophoretic Mobility Shift Analysis of Binding to
NRE1--
All oligonucleotides employed in electrophoretic mobility
shift assays were labeled at their 5' ends with
-[32P]ATP using T4 polynucleotide kinase.
The labeled oligonucleotides employed in these experiments included the
double-stranded MTV oligonucleotide, the upper and lower single strands
of the MTV. Single-stranded oligonucleotides encoding the upper strands
of the NRE1 element in the C3H strain of MMTV, the c-Myc plasmacytoma repressor element, an NRE1-like transcriptional repressor in the HTLV
LTR, an octamer motif and a heat shock response element, that have been
previously described (47), were also employed in some assays.
Oligonucleotide affinity column fractions were assayed for NRE1 binding
activity by electrophoretic mobility shift assays (EMSA) using the
23-base pair double-stranded MTV oligonucleotide or the 23 nucleotide
single, upper strand of MTV. Both probes were labeled. Protein samples
were incubated for 20 min at 20 °C in Buffer B (0.6× Buffer A
containing 60 mM KCl and 2 µg of bovine serum albumin),
and 2-20 ng of labeled specific probe and 100 ng to 1 µg of highly
sheared calf thymus DNA. For experiments examining binding to
single-stranded oligonucleotides, the calf thymus DNA was denatured by
heating to 95 °C for 5 min and rapidly cooled on ice immediately
prior to the binding assays. Electrophoresis was performed on native
4% polyacrylamide gels in 0.5× Tris-borate-EDTA for 1.5 h at 150 V. Following electrophoresis, the gels were dried and exposed on
NEF496 film (Dupont). In some experiments, antibodies were
preincubated with the protein samples for 30 min prior to the addition
of DNA to the binding reactions.
All experiments examining the DNA binding of recombinant Ku were
performed under the binding conditions described above. Determination of the Kd of Ku binding to the upper strand of NRE1
was performed exactly as described previously for double-stranded Ku
binding (47). EMSA was performed with a constant amount of recombinant
Ku incubated with an increasing concentration of upMTV in a volume of
20 µl. The concentration of upMTV oligonucleotide was determined by
spectrophotometry. The concentration of bound upMTV was calculated from
the fraction of total upMTV as determined by phosphorimage analysis.
Kd was determined by Scatchard analysis in three
independent trials and is expressed as the mean ± S.E.
Kinetic analysis of recombinant Ku binding to the upper strand of NRE1
was also performed essentially as described previously (49). The on
rate was determined by EMSAs in which binding reactions were allowed to
progress for 1 to 60 min prior to electrophoresis. The percentage of
equilibrium binding was determined by phosphorimage analysis and
plotted as mean ± S.E. The half-time (t1/2) of
initial binding was calculated using linear regression of the data in the linear range. The off rate was determined by EMSAs in which NRE1
binding was allowed to equilibrate for 30 min and was subsequently monitored over a 24-h period following the addition of 200 ng of
unlabeled upMTV competitor DNA. The percentage of initial binding was
determined by phosphorimage analysis and plotted as mean ± S.E.
Half-time (t1/2) of binding was calculated using
logarithmic regression of the data.
Footprinting of Protein Binding to Single-stranded DNA--
Two
reagents, KMnO4 and DNase I, were used to footprint
protein-DNA interactions over the MMTV LTR. 5-10 ng of a fragment from
421 to 106 of the MMTV promoter radiolabeled on the upper strand or
lower strands was mixed with 100 ng of calf thymus DNA, heat denatured
at 95 °C for 5 min, then rapidly cooled on ice. Binding was
performed in buffer B with crude nuclear extracts and purified factors
as described for 20 min at 20 °C. Treatment with 4 mM
KMnO4 was for 1 min as described previously (20, 49). Treatment with DNase I was performed for 1 min in the presence of 4 mM MgCl2. DNase I treatment was stopped by
adding SDS to 0.1% and Na2EDTA to 10 mM.
Footprints were visualized following electrophoresis of the samples on
DNA sequence gels. Cleavage was positioned relative to guanine and
thymidine sequencing reactions.
Production of Recombinant Ku--
Sf9 cells were infected
with baculovirus vectors encoding Ku-80 and histidine-tagged Ku-70 as
described previously (55). Ku heterodimer was purified over
nickel-nitrilotriacetic acid Sepharose® 6B (Novagen) as
described previously (47, 55). As Ku-70 is only poorly soluble in
Sf9 cells as a monomer, effectively only the Ku heterodimer is
obtained. The purity of the recombinant preparation and the Ku-70/Ku-80
ratio was verified by silver staining of SDS-polyacrylamide gels as
shown previously (47).
UV Cross-linking--
The upper strand of NRE1 was labeled by
extension of a 6-nucleotide primer (5'-AACTGA-3') hybridized to the
loMTV with Klenow fragment in the presence of
[ -32P]dATP to produce a double-stranded MMTV oligo
radiolabeled throughout NRE1, on the upper strand. Denaturation of the
double-stranded fragment mixed with 1 µg of calf thymus DNA in buffer
A was accomplished by heating at 95 °C for 5 min, followed by rapid
cooling on ice. Binding was performed in buffer B under conditions
identical to those employed for EMSA and used comparable amounts of
Jurkat purified or recombinant Ku. 10 mM MgCl2
and 4 mM ATP were added as indicated. Cross-linking was
performed in a Stratalinker 1800 (Stratagene) for 12 min at 4 °C.
Protein DNA complexes were resolved on 10% SDS-polyacrylamide gels
 |
RESULTS |
Nuclear Factor Binding to the Separated Upper and Lower Strands of
the MMTV LTR--
We have previously demonstrated in EMSA and in
single-stranded DNA footprinting experiments with the thymidine
specific reagent KMnO4, that nuclear factors in human
Jurkat T Cell nuclear extracts bound to both the upper and lower single
strands of the MMTV LTR over NRE1 (20). In the KMnO4
footprinting, however, nuclear factor binding to the upper strand of
NRE1 was reflected only by the protection of a single thymidine
adjacent to the polypurine sequence.
To increase our understanding of the interaction of nuclear factors
with the separated single strands of the MMTV LTR in and around NRE1,
we examined nuclear factor binding by single-stranded DNase I
protection footprinting (Fig. 1). An LTR
fragment extending from 421 to 364 was labeled at the 5' end of the
upper strand or the 3' end of the lower strand. Strand separation was
accomplished as we have previously described for single-stranded
KMnO4 footprinting (20). Under these conditions, the
strands from the LTR fragment remain single-stranded for the duration
of the binding and footprinting reactions.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 1.
Single-stranded DNase I footprinting of the
binding of factors in Jurkat nuclear extracts to the upper and lower
strands of the MMTV LTR around NRE1. MMTV LTR DNA fragments ( 421
to 106) 32P-labeled on the lower (panel A,
lower) or upper strand (panel B,
upper) were treated as follows. Guanine sequencing tracks
generated by chemical cleavage are shown in lanes 1 and
3. The result of DNase I cleavage of the double-stranded
MMTV fragments (Ds) in the absence of nuclear extract are
shown in lanes 2. The cleavage of the same fragments by
DNase I when single-stranded (Ss) and following
preincubation with binding buffer without added nuclear extract is
shown in lanes 4. The cleavage of the single-stranded MMTV
fragments with DNase I following incubation with 7 µg of Jurkat
nuclear extract is shown in lanes 5. The position and
sequence of NRE1 ( 394/ 381) on each DNA strand is summarized to the
right of each panel. The region protected from DNase I
digestion is highlighted by the bar to the right
of each panel. The dashed portion of the
bar in panel B indicates areas of partial
protection.
|
|
DNase I is considered a double-stranded endonuclease. However, the
majority of DNA contacts made by DNase I occur on the DNA strand that
is cleaved and all contacts occur on the same face of the DNA (56-58).
Further, DNase I cleaves DNA asymmetrically on only one strand in the
presence of Mg2+ (59) and has been observed to cleave
single-stranded DNA (60).
The DNase I cleavage patterns in the absence of nuclear extract were
markedly different for the double-stranded and single-stranded MMTV LTR
fragments (Fig. 1, A and B, lanes 2 and 4). In general, cleavage of the single-stranded DNAs by
DNase I occurred at both fewer and different sites. For example, the
region over NRE1 on the lower, single strand, of the MMTV DNA fragment
was strikingly sensitive to DNase I when single-stranded, but poorly
cleaved on double-stranded DNA.
Incubation of the lower single strand with 7 µg of Jurkat nuclear
extract prior to DNase I digestion led to complete protection of the
strong DNase I cleavage sites over NRE1 (Fig. 1A, lane 5). Further, as the most sensitive sequences in the fragment were protected, a more extensive DNase I cleavage pattern over the rest of
the DNA was observed. The protection on the lower, single-strand ( 400/ 375), corresponded approximately to the boundaries of
protection that we had previously observed with Jurkat nuclear extract
on double-stranded DNA (20).
DNase I footprinting of upper-stranded LTR binding (Fig. 1B,
lane 5), showed a central core of protection between 405
and 384 that was bordered on each side by regions of partial
protection. This was similar to, but broader than, the footprint
observed on the upper strand of double-stranded LTR DNA ( 402/ 380)
with Jurkat nuclear extract (20). Further, only one of the three Ts
within the central core of DNase I protection on the upper, single
strand were protected from modification with KMnO4
(20).
Upper-stranded NRE1 Binding Activity Contains Two
Components--
To begin to characterize the single-stranded NRE1
binding factors, Jurkat nuclear extract was fractionated by
oligonucleotide affinity chromatography. We prepared an upper strand
NRE1 oligonucleotide affinity column by coupling a synthetic
single-stranded 80-mer containing four copies of the upNRE1 sequence to
cyanogen bromide-activated Sepharose. Previously, this coupling
procedure has been used successfully to prepare a single-stranded
oligonucleotide affinity column for the purification of polypyrimidine
tract binding protein, which binds to a single-stranded polypyrimidine
tracts of DNA (53).
Unexpectedly, passage of Jurkat T cell nuclear extract over the upNRE1
column separated the upNRE1 binding activity into two components (Fig.
2). The first component eluted at 0.2 M KCl (Fig. 2A, lanes 7 and
8). The second component, which comprised approximately 80%
of the total upper-stranded NRE1 binding activity and bound strongly to
the upper strand of the NRE1-containing oligonucleotide upMTV in EMSAs,
was unable to bind the upNRE1-Sepharose column prepared by cyanogen
bromide coupling. The presence of NRE1 binding activity in the
flow-through fractions was not due to overloading of the column, as
when these fractions were pooled and passed through the column a second
time, no additional upMTV binding activity was
retained.2 Subsequently, we
found that an upNRE1 affinity matrix, prepared by linking a
biotinylated oligonucleotide to streptavidin agarose beads, retains
this second component,2 suggesting that modification of the
bases along upNRE1 by cyanogen bromide interfered with the binding of
this factor to the original column. Further, characterization of this
factor will be presented elsewhere.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 2.
Elution of NRE1 binding activity in
crude Jurkat nuclear extract from an upper-stranded NRE1
oligonucleotide affinity column. A, EMSA of column
fractions eluted with a stepwise (0.1-0.8 M) KCl gradient
using 32P-labeled upMTV as the probe. Lane 1 (C) is a control incubation with the nuclear extract loaded
on the column. Lanes 2-4 show the binding activity in the
extract that flowed through the column without binding. Lanes
5-17 show the upMTV binding activity in 0.1 to 0.8 M
KCl fractions as indicated above the autoradiograph. B,
silver- stained SDS-polyacrylamide gel electrophoresis gel of the 0.2 M KCl eluant shown in lane 7 in A.
The migration of molecular mass standards (kDa) is shown to the
left. Two bands, p70 and p80, that migrated at positions
close to those observed previously for Ku70 and Ku80 (20), are
identified on the right.
|
|
Silver staining of an SDS-polyacrylamide gel of the 0.2 M
fraction showed that the upNRE1 column had efficiently purified the
upper-stranded NRE1 binding activity into three major components of 70, 85, and 110 kDa (Fig. 2B).
Interestingly, the mobility of the 70- and 85-kDa species were similar
to the SDS-polyacrylamide gel electrophoresis staining pattern of the
Ku antigen that we had purified previously as a double-stranded NRE1
binding protein (27). This prompted us to determine how Ku had
fractionated over the upNRE1 affinity column (Fig.
3). First, we determined that the 0.2 M KCl fraction contained almost all of the double-stranded
NRE1 binding activity present in the crude extract, in addition to
upper-stranded NRE1 binding activity (Fig. 3A, lane
3). In contrast, little double-stranded NRE1 binding activity was
observed in the flow-through from the column (lane 2), and
no double-stranded binding activity was detected in other column
fractions.2 Second, addition of the Ku-specific antibody
162 to binding reactions containing the upMTV single-stranded
oligonucleotide retarded the mobility of the complex formed with the
0.2 M KCl fraction (Fig. 3B, lanes 3 and 4), but had no discernible effect on the mobility of the
upMTV binding activity in the flow-through fraction (lanes 1 and 2). In contrast, addition of a monoclonal antibody specific for the glucocorticoid receptor had no effect on upMTV binding.2 These data implicated Ku as the upper-stranded
NRE1 binding component that eluted from the upNRE1 column in the 0.2 M KCl fraction. It also excluded Ku as the second
upper-stranded NRE1 binding factor.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 3.
The upNRE1 binding factor in the 0.2 M KCl fraction of the upper-stranded NRE1 oligonucleotide
affinity column is immunologically related to Ku antigen. A,
EMSAs of the binding to double-stranded NRE1 oligonucleotide
double-stranded MTV (dsMTV) of crude Jurkat nuclear extract
(C, lane 1), the flow-through from the upNRE1
affinity column represented in lane 2 from Fig.
2A (lane 2), and the fraction eluting from the
upMTV affinity column with 0.2 M KCl represented in
lane 7 from Fig. 2A (lane 3).
B, EMSA of the binding to the upper strand of NRE1
oligonucleotide upMTV of the flow-through from the upNRE1 affinity
column represented in lane 2 from Fig. 2A
(lanes 1 and 2), and the fraction eluting from
the upNRE1 affinity column with 0.2 M KCl represented in
lane 7 from Fig. 2A (lanes 3 and 4).
Preincubation in the presence (+) or absence ( ) of anti-Ku
antibody Ab162 is indicated above the lanes. C,
silver-stained SDS-polyacrylamide gel of the fraction containing
double-stranded NRE1 binding factors sequentially purified over upMTV
and double-stranded MTV (dsMTV) oligonucleotide affinity
columns. The migration of molecular mass standards (kDa) is shown to
the left.
|
|
Subsequent passage of the 0.2 M KCl fraction over the
double-stranded NRE1 oligonucleotide affinity column that we have
described previously, purified the 70- and 80-kDa Ku heterodimer to
near homogeneity (Fig. 3C). Thus, these experiments also
demonstrate a simple, two-step, protocol for the purification of Ku
antigen from Jurkat T cell crude nuclear extracts that we expect will also allow the rapid and efficient purification of Ku from other sources. In our hands this protocol yielded approximately 30 µg of Ku
from 40 liters of cultured Jurkat cells.
Purified Ku Protects NRE1 in Single-stranded DNA Footprinting
Assays--
As crude Jurkat nuclear extracts fractionated into two
upper-stranded NRE1 binding activities it was important to determine the contribution of Ku to footprints on the upper strand of the MMTV
LTR obtained with crude extracts. We used KMnO4 and DNase I
to examine the binding of purified Ku to the same single-stranded DNA
fragment from the upper strand of the MMTV LTR described above in
experiments with crude nuclear extracts (Fig.
4).

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 4.
Single-stranded DNA-footprinting analysis of
interaction of purified Ku with the upper strand of the 421 to 106
MMTV LTR fragment. A, footprinting with 4 mM KMnO4. Lane 1, guanine sequencing
track generated by chemical cleavage; lane 2,
KMnO4 modification pattern of single-stranded DNA
preincubated in the absence of purified Ku; lanes 3 and
4, KMnO4 modification pattern of single-stranded
DNA incubated with purified Ku. The specifically protected T residue
immediately adjacent to NRE1 is indicated by the arrowhead. Protection
of the two Ts at the 5' DNA end of the fragment is indicated by the
solid bar. B, DNase I footprinting. Lanes 1 and
4, guanine sequencing tracks generated by chemical cleavage;
lanes 2 and 3, DNase I digestion pattern of
single-stranded DNA preincubated in the absence of purified Ku and
digested with 8 and 2 units of DNase I, respectively; lanes
5 and 6, DNase I digestion pattern of single-stranded
DNA incubated with purified Ku and digested with 2 and 8 units of DNase
I. To the left the sequence of the MMTV LTR around NRE1 is
illustrated and the position of NRE1 on the gel is indicated. The
solid line highlights the region of near complete protection
while the dashed extensions indicate regions of partial
protection.
|
|
Incubation of this fragment with unfractionated Jurkat extract leads to
the protection of the thymidine at 395 from KMnO4 at the
5' end of NRE1 (20). The same residue was protected from KMnO4 modification by the purified Ku preparation (Fig.
4A). The use of purified Ku in these experiments, however,
also resulted in protections that were not observed with the crude
extract. First, the subsequent thymidine in the LTR, at 399, was more than 50% protected from KMnO4 modification, extending the
5' boundary of protection with KMnO4 closer to that
obtained with DNase I. Second, under the binding conditions of this
experiment, the Ts at the 5' end of the LTR fragment were also
protected from KMnO4 modification. Thus it appears that Ku
may also have some preference for binding to single-stranded DNA ends,
in addition to its well known propensity for binding to double-stranded
DNA ends.
In experiments with DNase I (Fig. 4B), the protection of
sequences extending 5' from NRE1 by the purified Ku preparation was very similar to that observed with crude extracts, with the boundaries of protection mapping within 1-2 nucleotides in the two instances. With DNase I, however, no protection over the 5' end of the fragment was observed at the concentration of Ku employed. One possibility was
that Ku interacted with DNA ends in a way that was not readily detectable with DNase I. Alternatively, these results may reflect the
preference of Ku for NRE1 over DNA-ends that is also seen with
double-stranded DNAs (27, 47).
In contrast, the DNase I footprint with the purified fraction was
extended in the 3' direction compared with that observed with the crude
extract (compare with Fig. 1B). Notably strong protection
was observed to the very end of the polypurine stretch at 381. In
addition, partial protection extended an additional 20 nucleotides in
the 3' direction to 357. Together, these experiments demonstrate that
the purified Ku specifically protected sequences on the upper, single
strand of the MMTV LTR centered over the polypurine NRE1 element.
Properties of the Sequence-specific Binding of Recombinant Ku to
the Upper Strand of NRE1--
To confirm that no factors in the
purified preparation in addition to Ku participated in binding to the
upper strand of NRE1, we examined the ability of recombinant Ku
expressed in insect cells and purified to near homogeneity, to bind
specifically to the upper-strand of NRE1 (Fig.
5A). In this EMSA experiment,
the incubation of recombinant Ku with either the double or upMTV
oligonucleotides in the presence of the appropriate nonspecific
competitor DNAs resulted in single shifted complexes of equal mobility.
Binding was specific to the upper strand of NRE1, as no complex was
observed with the complementary lower single-stranded NRE1
oligonucleotide.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
Binding of recombinant Ku to NRE1-containing
oligonucleotides and related sequences. A,
32P-labeled double-stranded (ds, lane
1) MTV oligonucleotide or the upper (up, lane
2) or lower (lo, lane 3) single strands were
incubated with recombinant Ku purified from baculovirus infected
Sf9 cells and analyzed for DNA binding by EMSA. B,
sequence alignment of the single-stranded oligonucleotides tested for
sequence-specific Ku binding in C. The sequence of the GR
MMTV LTR NRE1-containing oligonucleotide is shown at the top
in uppercase. The sequence of oligonucleotides encoding the
upper strands of the C3H MMTV LTR NRE1 element (16), the c-Myc
plasmacytoma repressor element (88), the NRE1-like response element in
the U5 HTLV LTR (67) are listed immediately below, with
matching nucleotides listed in uppercase and mismatches
displayed in lowercase. At the bottom are shown
the sequences of the single strands of oligonucleotides encoding an
octamer motif (65) and heat shock response element (HSE)
(62) with the best similarity to the upper strand of NRE1, which are
shown in uppercase. Double-stranded versions of the octamer
motif and heat shock protein response element have been shown not to
support direct Ku binding in covalently closed microcircles (47).
C, EMSA of Ku binding to single-stranded oligonucleotides.
Recombinant Ku was incubated with 32P-labeled
single-stranded oligonucleotides encoding the upper-stranded NRE1
sequence from the GR strain of MMTV (lane 1), the
corresponding region from the C3H strain of MMTV (lane 2),
the c-Myc plasmacytoma repressor element (PRE) sequence
(lane 3), a proposed Ku binding site in the U5 region of the
HTLV LTR (lane 4), an octamer motif (lane 5) and
the proposed Ku binding site overlapping with a heat shock response
element (lane 6). Specific binding was analyzed by
EMSA.
|
|
Several sequence-specific double-stranded Ku binding sites have been
proposed based on the results of EMSA and DNA footprinting experiments
with linear DNA fragments (37, 45, 61-68). Recently, we demonstrated
that only the subset of sequences with a obvious homology to NRE1,
appear to serve as direct double-stranded DNA binding sites for Ku on
covalently closed circular DNA (27, 47). To begin to probe the sequence
requirements for sequence-specific single-stranded DNA binding by Ku,
we compared the binding of recombinant Ku to the upper-strand of NRE1
from the LTR of GR MMTV strain to binding to the polypurine-rich
strands of several of oligonucleotides that we have previously assessed
for direct recognition by Ku in double-stranded DNA microcircles (Fig.
5, B and C).
The binding of Ku to single-stranded, linear oligonucleotides closely
paralleled our previous results with double-stranded DNA microcircles.
First, Ku displayed the highest affinity for the NRE1-containing
oligonucleotide from the GR strain of MMTV (Fig. 5C,
lane 1). However, the 3 oligonucleotides encoding
polypurine-rich sequences similar to NRE1 were also bound by Ku, albeit
with what appeared to be, over the course of several experiments, a
consistently 2-3-fold decrease in affinity (lanes 2-4). This result
suggested that the substitutions in these NRE1-like sequences had a
small, but reproducible, effect on their ability to be recognized by Ku. Further, the results obtained for the C3H MMTV LTR NRE1 element exactly parallels the difference in binding that we previously reported
for the binding of Ku to double-stranded NRE1-containing DNA
microcircles (47). By contrast, single-stranded oligonucleotides containing two sequences that we have previously shown not to be
directly recognized by Ku under our binding conditions when double-stranded (47), also failed to be bound appreciably by Ku in our
single-stranded EMSA experiments (lanes 5 and 6),
even in the presence of a 5-fold higher concentration of recombinant Ku.3
To determine the affinity of Ku binding to the single, upper strand, of
NRE1 under our binding conditions, we used EMSA to perform Scatchard
analyses of the binding of a constant amount of recombinant Ku to an
increasing concentration of the upMTV oligonucleotide (Fig.
6). Averaging of three independent
experiments yielded a Kd of 3.5 ± 1.3 nM for sequence-specific single-stranded Ku binding. This
result indicates that the affinity of recombinant Ku for
single-stranded NRE1 was approximately 4-fold lower than the 0.84 ± 0.24 nM Kd that we have previously
reported for the direct binding of recombinant Ku to double-stranded
NRE1 under the same binding conditions. This lower value for the
affinity of Ku for single-stranded NRE1 is consistent with our
observation that the DNA ends in highly sheared calf thymus DNA begins
to compete Ku binding to upMTV at lower concentrations than it does double-stranded NRE1 binding.3 This is also consistent with
our early results with crude Jurkat T cell nuclear extracts where we
reported that the double-stranded MTV oligonucleotide competed
3-5-fold more effectively for double-stranded NRE1 binding than did
the upMTV sequence (20). However, competition of upMTV binding by DNA
ends still requires a greater than 100-fold molar excess of DNA
ends.3

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
Determination of the dissociation constant
for Ku binding to the upper strand of NRE1. A, EMSA
with increasing amounts of 32P-labeled upMTV
oligonucleotide incubated with a constant 1-µl amount of recombinant
Ku. The concentrations of upMTV probe added to each incubation are
listed above the lanes. B, bound and free DNAs separated by
EMSA in panel A were quantified by PhosphorImager and the
Kd for recombinant Ku binding to the upper strand of
NRE1 was determined by Scatchard analysis. One representative Scatchard
plot is displayed, together with the Kd (±S.E.)
calculated from three independent repetitions of the assay.
|
|
Ku binding to DNA ends has previously been described to be extremely
stable when compared with the norm for transcription factor binding to
DNA sequences (42, 69). Therefore, to complete our analysis of the
single-stranded NRE1 binding properties of Ku we examined the kinetics
with which recombinant Ku bound to the upNRE1 oligonucleotide (Fig.
7). The binding of Ku to upMTV occurred
rapidly, with a t1/2 = 2 min (Fig. 7, A
and B). This is comparable to the fastest rates that have
been reported for transcription factor DNA binding in vitro.
In contrast, the off rate of Ku from upMTV following the equilibration
of binding was unusually slow, with a t1/2 of 68 min
(Fig. 7, C and D). These data suggest, that Ku
can rapidly access the single, upper strand of NRE1. However, once
binding has occurred, Ku may remain stably associated with the
upper strand of NRE1 for an extended period of time.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 7.
Analysis of the kinetics of Ku binding to the
upper-strand of NRE1. A and B, on rate for
recombinant Ku binding to the upper strand of NRE1 was determined by
EMSA following incubation of recombinant Ku with
32P-labeled upMTV oligonucleotide for times increasing from
1 to 60 min. Panel A shows one example of the EMSA, while
panel B shows a plot of the percent maximum Ku binding
(±S.E.) for three independent experiments as a function of the time
allowed for binding, quantified by PhosphorImager. The inset
shows the initial rate of binding plotted on an expanded time scale.
C and D, off rate for recombinant Ku from the
upMTV oligonucleotide. Following a 30-min preincubation of Ku with
32P-labeled upMTV, 200 ng of unlabeled upMTV were added to
each incubation, and the loss of Ku from the 32P-labeled
upMTV was monitored over a 24-h period by EMSA. Panel C
shows one example of the EMSA, while panel D shows a plot of
the percent Ku binding (±S.E.) compared with the initial binding of Ku
prior to the addition of competitor DNA, as a function of time after
addition of the cold upMTV oligonucleotide for three independent
experiments, quantified by PhosphorImager. Note that the time component
is plotted on a logarithmic scale.
|
|
Upper-stranded NRE1 Binding Promotes the Contact of Ku80 with
DNA--
In DNA cross-linking assays with crude nuclear extracts,
performed both before and after EMSA, we have shown that distinct nuclear factors are UV cross-linked to the upper strand of NRE1 when it
was presented as double-stranded DNA or as single-stranded DNA (20,
50). A 45-kDa protein-DNA complex formed on the lower strand of NRE1,
but only when the DNA was single-stranded (20, 50). While a factor in
crude nuclear extracts migrating at 80 kDa cross-linked to
double-stranded NRE1, two factors migrating at 80 and 95 kDa
cross-linked to upNRE1. Further, while the total amount of
cross-linking obtained varied considerably between nuclear extracts
prepared from different cell types, the ratio of the 80 and 95 kDa
bands was the same in all instances (20). Ku binds both of these forms
of NRE1 and the Ku70 and Ku80 subunits cross-linked to DNA would be
expected to yield protein-DNA products with mobilities similar to the
protein DNA products obtained with the crude extracts. Therefore, these
results suggested the possibility that the two Ku subunits
differentially contacted the double-stranded NRE1 and the single upper
strand. More interesting given the DNA helicase activity of Ku (46),
addition of Mg+2/ATP to the binding assay in other
experiments resulted in the cross-linking of both the 80- and 95-kDa
factors to the double-stranded oligonucleotide.
To investigate the contact of Ku70 and Ku80 with double- and
single-stranded NRE1-containing oligonucleotides, we performed protein-DNA cross-linking experiments with the purified recombinant Ku
(Fig. 8). First, under standard binding
conditions in the absence of Mg2+ and ATP, a single, 80-kDa
DNA-protein complex marked the cross-linking of Ku70 to the
double-stranded NRE1-containing oligonucleotide (lane 2). In
contrast, a second complex of 90-95 kDa indicated the cross-linking of
Ku80 in addition to Ku70 to the upper strand of NRE1 (lane
1). Interestingly, upon addition of Mg2+, the higher
mobility, 90-95-kDa Ku80-DNA complex became detectable with
double-stranded oligonucleotide (lane 3). In the presence of
both Mg2+ and ATP the ratio of Ku70/Ku80 cross-linking
decreased to that observed on the upper, single-stranded NRE1
oligonucleotide (lane 4). Similar results were obtained with
Ku purified from Jurkat cells.3 Together, these results
suggested that the binding of Ku to double- and single-stranded
NRE1-containing DNAs was mediated through distinct regions of the
heterodimer. Further, they indicated that the presence of
Mg2+/ATP changed the nature of the Ku-NRE1 interaction on
double-stranded DNA.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 8.
Cross-linking of recombinant Ku to
NRE1-containing oligonucleotides. Purified recombinant Ku was
incubated with the single-upper strand (up, lane
1) of the NRE1-containing oligonucleotide MTV or the
double-stranded oligonucleotide labeled with 32P on the
upper strand (lanes 2-4) in the absence or presence of 10 mM MgCl2 or 4 mM ATP as indicated.
Following UV cross-linking the protein-DNA complexes were separated on
a 10% SDS-polyacrylamide gel and visualized by autoradiography.
|
|
 |
DISCUSSION |
Fractionation of a Jurkat nuclear extract over consecutive single-
and double-stranded NRE1 oligonucleotide affinity columns has revealed
Ku antigen to be one of two factors with the ability to bind
specifically and with high affinity to the single upper strand of NRE1.
Ku binding to single-stranded NRE1 was rapid and occurred with an
affinity only slightly lower than binding to double-stranded NRE1.
Further, once bound to the upper strand of NRE1, Ku remained stably
associated with the DNA for long periods of time. Our results also
suggest that Ku may bind with at least a small degree of selectivity to
single-stranded DNA ends. These results add two new dimensions to the
DNA binding activities of a protein that may be the most versatile DNA
binding protein characterized to date. They have implications for the
regulation of transcription through NRE1, understanding the molecular
basis for the induction of structural transitions in NRE1 flanking DNA,
and offer a potential explanation of the need for an extended
single-stranded DNA extension for Ku helicase activity.
DNase I footprinting experiments with single-stranded DNA fragments
demonstrated that nuclear factor binding to both the upper and lower
strands of the MMTV LTR protected very similar regions centered
approximately over the polypurine/polypyrimidine NRE1 core. On both
strands, the protection observed overlapped extensively with the
protection from DNase I that occurs on double-stranded DNA. These
results suggest it unlikely that the double- and single-stranded binding factors could simultaneously occupy NRE1, unless the
double-stranded DNA binding factor also accounted for at least some of
the single-stranded binding. Several examples of sequence-specific
binding proteins that bind both double-stranded DNA and one of the two
single strands have been identified (70-73). In these cases,
single-stranded DNA binding has been perceived as either a direct
mechanism of DNA recognition or the end point of initial recognition of
a double-stranded template. Competitive binding of different factors to
the double- and single-stranded forms of a single element has also been
observed (74-78).
Fractionation of Jurkat nuclear extract over an upper-stranded NRE1
oligonucleotide affinity column separated the upper-stranded binding
activity into two components that yielded EMSA complexes. Analysis of
the upNRE1 binding factor that eluted from the upNRE1 column in the 0.2 M KCl fraction identified it as immunologically related to
Ku antigen. Both purified Ku and recombinant Ku purified from insect
cells bound specifically to both double-stranded NRE1 and to the single
upper strand. These results establish Ku as a protein that recognizes
its response element with high affinity in both double- and
single-stranded configurations. Further, the DNA helicase activity of
Ku (46) suggests an obvious mechanism for the introduction and
maintenance of strand separation around NRE1 that would promote the
open DNA conformation needed for the binding of the factor which
recognizes the lower strand of NRE1.
Although the second upper-strand NRE1 binding factor that occurred in
the flow through of the upNRE1 oligonucleotide column appeared to bind
strongly and specifically to upNRE1 in EMSAs, the complete reproduction
of the footprints on the upper strand of NRE1 by Ku alone makes it
unclear as to the potential of this second factor to interact with NRE1
in unfractionated extracts. The binding of purified Ku to the upper
strand of the MMTV over NRE1 encompassed and even extended somewhat the
footprints obtained with crude nuclear extracts (20, 50). Thus, the
KMnO4 footprint was extended 5' to include the partial
protection of the T at 399. With DNase I, the area of strong
protection extended 3' to 381 to completely protect the polypurine
stretch of NRE1. A comprehensive understanding of the interrelationship
of the interaction of Ku and this second factor with the upper strand of NRE1 will require reconstitution of binding with completely purified
factors.
Although Ku has been demonstrated to bind DNA loops, cruciforms and
other structures (28, 41-45, 79-82), to date it has been reported to
bind only single-stranded unstructured DNA with low affinity (44-46,
81). Our KMnO4 footprinting results also suggest that Ku
may be able to bind to free single-stranded DNA ends. As Ku binding to
single-stranded DNA ends was not verified by DNase I footprinting, it
would appear that Ku bound only very weakly, albeit with at least some
specificity, to the single-stranded DNA ends. However, it is clear from
our EMSA experiments in which large excesses of highly sheared
single-stranded calf thymus DNA were routinely included, that
single-stranded NRE1 binding (Kd = 3.5 ± 1.3 nM) was strongly preferred to sequence-independent single-stranded DNA binding, including DNA end binding. Nonetheless, this single-stranded DNA end binding activity may be important for the
DNA helicase activity of Ku. Otherwise, given the high affinity of Ku
binding to double-stranded DNA ends, it is difficult to explain the
requirement for an extended single-stranded overhang for
double-stranded DNA to be unwound by Ku (46). One intriguing possibility is that the binding of Ku to the upper strand of NRE1, or
to the point of strand separation that exists in the known helicase
templates, recruits a second molecule of Ku to the end of the
single-stranded overhang. Ku is known to form DNA-dependent dimers and Ku helicase activity has to date been observed only under
conditions where dimers can form (46, 81, 83, 84).
One issue that is not resolved by our experiments is whether, when
presented with the single upper strand of the MMTV LTR, Ku binds
directly to NRE1 or accumulates over NRE1 from alternative entry points
as a result of translocation. Ku translocates efficiently from DNA ends
and NRE1 on double-stranded DNA in the presence of Mg2+
(27, 41). It is also suspected to accumulate following translocation over some double-stranded sequences to which it does not bind directly
(47). While not conclusive, the present evidence favors direct binding
to the single, upper strand, of NRE1. For example, the binding
reactions in our single-stranded footprinting experiments were
performed in the absence of Mg2+, and KMnO4
footprinting was accomplished in the complete absence of
Mg2+. Moreover, with the exception of the weak interaction
that we observed with single-stranded DNA ends, we have not detected
evidence of higher order Ku-DNA complexes with single-stranded DNA that resemble the multimeric Ku-DNA complexes that are readily observed on
double-stranded DNA (41, 42).
Under normal circumstances in the cell, Ku is most likely to initiate
its interaction with NRE1 by binding to the double-stranded LTR DNA, as
despite detailed study, no obvious strand separation has been detected
in MMTV LTR chromatin (85, 86). Although the sequence preferences for
double- and single-stranded NRE1 binding appeared to be very similar,
under the same DNA binding conditions, the affinity for single-stranded
NRE1 (Kd = 3.5 ± 1.3 nM), was
3-4-fold lower than the affinity of Ku binding to double-stranded NRE
(Kd = 0.84 ± 0.24 nM) (47). Despite the decreased affinity, the kinetics of binding of recombinant Ku to single-stranded NRE1 (t1/2 on = 2 min,
t1/2 off = 68 min) appear to be highly similar
to the kinetics of the binding of the Ku in Jurkat nuclear extracts to
double-stranded NRE1 (49).
Recent reports indicate that multiple subdomains within Ku have the
potential to mediate DNA end binding. In particular, it appears that
either the amino or carboxyl terminus of Ku70 can pair with the
carboxyl terminus of Ku80 to bind double-stranded DNA ends (79-82).
One intriguing feature of double-stranded NRE1 binding by Ku is that in
the absence of Mg2+/ATP, only Ku70 appears to be in
intimate contact with the DNA. Further, Ku70 only appears to contact
the upper strand of NRE1 directly. Whether this contact is mediated by
the NH2 or COOH terminus of Ku70 is not yet known. However,
upon addition of Mg2+/ATP, a change occurs in the
interaction of Ku with NRE1 that is reflected by the cross-linking of
Ku80 in addition to Ku70 to the upper strand of the double-stranded
sequence. Thus the dynamics of Ku DNA binding appear to reflect a
differential participation of individual DNA binding subdomains of Ku
with the upper strand of NRE1.
While the cross-linking of Ku70/80 to double-stranded NRE1 in the
presence of Mg2+/ATP mirrors the cross-linking of the two
Ku subunits to the single, upper strand of NRE1, we have been unable to
detect complete unwinding of the two strands of blunt-ended
NRE1-containing oligonucleotides in DNA helicase assays performed with
either purified Ku or crude nuclear extracts.3 However, the
contact of Ku80 with double-stranded NRE1 does correlate with the
destabilization of the double-helix in sequences flanking NRE1 that is
reflected by the induction of sensitivity to modification by
KMnO4 and cleavage by S1 nuclease (50). Whether this
destabilization is sufficient to allow the binding of the other
single-stranded binding factors to NRE1 remains to be demonstrated.
Together, our results to date suggest that the interaction of Ku with
NRE1 occurs in two steps; initial contact of Ku70, followed by a
Mg2+-dependent structural transition that leads
to the contact of Ku80 with DNA. Interestingly, there is a recent
report (81) that indicates that Ku70 alone has helicase activity.
The importance of the single-stranded NRE1 binding factors for the
regulation of MMTV transcription by Ku/DNA-PK remains to be
demonstrated. However, two results raise the expectation that these
factors will also be required for the repression of MMTV transcription
through NRE1. Previously, we have demonstrated that a truncated NRE1
element, which supports double-stranded nuclear factor binding only, is
unable to repress transcription from the MMTV promoter proximal
regulatory region, even when present in multiple copies (20). Results,
to be submitted elsewhere,4
demonstrate that this truncated element is indeed a direct internal double-stranded DNA binding site for Ku. In contrast, there is no
detectable binding to the upper, single strand of this element by any
factor including Ku.
Last, it has recently been shown that the XRCC4 gene product
facilitates the DNA end binding activity of Ku and the recruitment of
DNA-PKcs to DNA (87). It will be interesting to determine whether this factor also participates in the binding of Ku/DNA-PK to
NRE1. Interestingly, with a predicted molecular mass of 38 kDa, XRCC4
is a candidate for the lower-stranded NRE1 binding factor which in
cross-linking experiments yields a DNA-protein complex that migrates at
45 kDa.
 |
ACKNOWLEDGEMENTS |
We thank Y. Lefebvre, G. Préfontaine,
and C. Schild-Poulter for their critical commentary on the manuscript
and S. Ginsberg for help in preparing the figures.
 |
FOOTNOTES |
*
This work was supported by an operating grant Medical
Research Council of Canada (to R. J. G. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by studentships from the Natural Science and Engineering
Council of Canada and the Government of Ontario.
**
Scholar of the Medical Research Council of Canada and the Cancer
Research Society Inc. To whom correspondence should be addressed: Depts. of Medicine and Biochemistry, Ottawa Civic Hospital, University of Ottawa, 1053 Carling Ave., Ottawa, Ontario K1Y 4E9, Canada. Tel.:
613-798-5555 (ext. 6283); Fax: 613-761-5036; E-mail:
hache{at}civich.ottawa.on.ca.
The abbreviations used are:
MMTV, mouse mammary
tumor virus; MTV, 398 to 377 oligonucleotide from MMTV LTR; LTR, long terminal repeat; NRE1, MMTV negative regulatory element 1; DNA-PK, DNA-dependent protein kinase; DNA-PKcs, DNA-dependent protein kinase catalytic subunitup, upper
strandlo, lower strandEMSA, electrophoretic mobility shift assayKu70, 70-kDa Ku subunitKu80, 80-kDa Ku subunitHTLV, human T-cell
leukemia virus.
2
H. Torrance, W. Giffin, D. J. Rodda, L. Pope, and R. J. G. Haché, unpublished
observations.
3
W. Giffin, H. Torrance, D. J. Rodda, L. Pope, and R. J. G. Haché, unpublished
observation.
4
W. Giffin, H. Torrance, D. J. Rodda, L. Pope, and R. J. G. Haché, manuscript in
preparation.
 |
REFERENCES |
-
Nusse, R.
(1988)
Trends Genet.
4,
291-295[CrossRef][Medline]
[Order article via Infotrieve]
-
van Lohuizen, M.,
and Berns, A.
(1990)
Biochim. Biophys. Acta
1032,
213-235[Medline]
[Order article via Infotrieve]
-
Cato, A. C.,
Miksicek, R.,
Schütz, G.,
Arnemann, J.,
and Beato, M.
(1986)
EMBO J.
5,
2237-2240[Medline]
[Order article via Infotrieve]
-
Chalepakis, B.,
Arnemann, J.,
Slater, E.,
Brüller, H.-J.,
Gross, B.,
and Beato, M.
(1988)
Cell
53,
371-382[CrossRef][Medline]
[Order article via Infotrieve]
-
Pina, B.,
Haché, R. J.,
Arnemann, J.,
Chalepakis, G.,
Slater, E. P.,
and Beato, M.
(1990)
Mol. Cell Biol.
10,
625-633[Abstract/Free Full Text]
-
Brüggemeier, U.,
Kalff, M.,
Franke, S.,
Scheidereit, C.,
and Beato, M.
(1991)
Cell
64,
565-572[CrossRef][Medline]
[Order article via Infotrieve]
-
Archer, T. K.,
Lefebvre, P.,
Wolford, R. G.,
and Hager, G. L.
(1992)
Science
255,
1573-1576[Abstract/Free Full Text]
-
Archer, T. K.,
Lee, H. L.,
Cordingley, M. G.,
Mymryk, J. S.,
Fragoso, G.,
Berard, D. S.,
and Hager, G. L.
(1994)
Mol. Endocrinol.
8,
568-576[Abstract/Free Full Text]
-
Kusk, P.,
Carlson, K. E.,
Warren, B. S.,
and Hager, G. L.
(1995)
Mol. Endocrinol.
9,
1180-1192[Abstract/Free Full Text]
-
Chavez, S.,
and Beato, M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2885-2890[Abstract/Free Full Text]
-
Mink, S.,
Hartig, E.,
Jennewein, P.,
Doppler, W.,
and Cato, A. C. B.
(1992)
Mol. Cell. Biol.
12,
4906-4918[Abstract/Free Full Text]
-
Kusk, P.,
John, S.,
Fragoso, G.,
Michelotti, J.,
and Hager, G. L.
(1996)
J. Biol. Chem.
271,
31269-31276[Abstract/Free Full Text]
-
Morley, K. L.,
Toohey, M. G.,
and Peterson, D. O.
(1987)
Nucleic Acids Res.
15,
6973-6989[Abstract/Free Full Text]
-
Stewart, T. A.,
Hollingshead, P. G.,
and Pitts, S. L.
(1988)
Mol. Cell. Biol.
8,
473-479[Abstract/Free Full Text]
-
Mink, S.,
Ponta, H.,
and Cato, A. C.
(1990)
Nucleic Acids Res.
18,
2017-2024[Abstract/Free Full Text]
-
Lee, J. W.,
Moffitt, P. G.,
Morley, K. L.,
and Peterson, D. O.
(1991)
J. Biol. Chem.
266,
24101-24108[Abstract/Free Full Text]
-
Gouilleux, F.,
Sola, B.,
Couette, B.,
and Richard-Foy, H.
(1991)
Nucleic Acids Res.
19,
1563-1576[Abstract/Free Full Text]
-
Lefebvre, P.,
Berard, D. S.,
Cordingley, M. G.,
and Hager, G. L.
(1991)
Mol. Cell. Biol.
11,
2529-2537[Abstract/Free Full Text]
-
Yanagawa, S. I.,
Kakimi, K.,
Tanaka, H.,
Murakami, A.,
Nakagawa, Y.,
Kubo, Y.,
Yamada, Y.,
Hiai, H.,
Kuribayashi, K.,
Masuda, T.,
and Ishimoto, A.
(1993)
J. Virol.
67,
112-118[Abstract/Free Full Text]
-
Giffin, W.,
Torrance, H.,
Saffran, H.,
MacLeod, H. L.,
and Haché, R. J. G.
(1994)
J. Biol. Chem.
269,
1449-1459[Abstract/Free Full Text]
-
Dudley, J. P.,
Arfsten, A.,
Hsu, C.-L. L.,
Kozak, C.,
and Risser, R.
(1986)
J. Virol.
57,
385-388[Abstract/Free Full Text]
-
Ball, J. K.,
Diggelmann, H.,
Dekaban, G. A.,
Grossi, G. F.,
Semmler, R.,
Waight, P. A.,
and Fletcher, R. F.
(1988)
J. Virol.
62,
2985-2993[Abstract/Free Full Text]
-
Hsu, C. L.,
Fabritius, C.,
and Dudley, J.
(1988)
J. Virol.
62,
4644-4652[Abstract/Free Full Text]
-
Theunissen, H. J.,
Paardekooper, M.,
Maduro, L. J.,
Michalides, R. J.,
and Nusse, R.
(1989)
J. Virol.
63,
3466-3471[Abstract/Free Full Text]
-
van Ooyen, A.,
and Racevskis, J.
(1990)
J. Virol.
64,
4043-4050[Abstract/Free Full Text]
-
Yanagawa, S.,
Murakami, A.,
and Tanaka, H.
(1990)
J. Virol.
64,
2474-2483[Abstract/Free Full Text]
-
Giffin, W.,
Torrance, H.,
Rodda, D. J.,
Préfontaine, G. G.,
Pope, L.,
and Haché, R. J. G.
(1996)
Nature
380,
265-268[CrossRef][Medline]
[Order article via Infotrieve]
-
Gottlieb, T. M.,
and Jackson, S. P.
(1993)
Cell
72,
131-142[CrossRef][Medline]
[Order article via Infotrieve]
-
Taccioli, G. E.,
Gottlieb, T. M.,
Blunt, T.,
Priestley, A.,
Demengeot, J.,
Mizuta, R.,
Lehmann, A. R.,
Alt, F. W.,
Jackson, S. P.,
and Jeggo, P. A.
(1994)
Science
265,
1442-1445[Abstract/Free Full Text]
-
Smider, V.,
Rathmell, W. K.,
Lieber, M. R.,
and Chu, G.
(1994)
Science
266,
288-292[Abstract/Free Full Text]
-
Blunt, T.,
Finnie, N. J.,
Taccioli, G. E.,
Smith, G. C. M.,
Demengeot, J.,
Gottlieb, T. M.,
Mizuta, R.,
Varghese, A. J.,
Alt, F. W.,
Jeggo, P. A.,
and Jackson, S. P.
(1995)
Cell
80,
813-823[CrossRef][Medline]
[Order article via Infotrieve]
-
Kirchgessner, C. U.,
Patil, C. K.,
Evans, J. W.,
Cuomo, C. A.,
Fried, L. M.,
Carter, T.,
Oettinger, M. A.,
and Brown, J. M.
(1995)
Science
267,
1178-1183[Abstract/Free Full Text]
-
Lees-Miller, S. P.,
Godbout, R.,
Chan, D. W.,
Weinfeld, M.,
Day, R. S.,
Barron, G. M.,
and Allalunis-Turner, J.
(1995)
Science
267,
1183-1185[Abstract/Free Full Text]
-
Zhu, C. M.,
Bogue, M. A.,
Lim, D. S.,
Hasty, P.,
and Roth, D. B.
(1996)
Cell
86,
379-389[CrossRef][Medline]
[Order article via Infotrieve]
-
Nussenzweig, A.,
Chen, C. H.,
Soares, V. D.,
Sanchez, M.,
Sokol, K.,
Nussenzweig, M. C.,
and Li, G. C.
(1996)
Nature
382,
551-555[CrossRef][Medline]
[Order article via Infotrieve]
-
Ouyang, H., A., N.,
Kurimasa, A.,
Soares, V. C.,
Li, X.,
Cordon-Cardo, C.,
Li, W.-h.,
Cheong, N.,
Nussenzweig, M.,
Iliakis, G.,
Chen, D. J.,
and Li, G. C.
(1997)
J. Exp. Med.
186,
921-929[Abstract/Free Full Text]
-
Kuhn, A.,
Gottlieb, T. M.,
Jackson, S. P.,
and Grummt, I.
(1995)
Genes & Dev.
9,
193-203[Abstract/Free Full Text]
-
Dvir, A.,
Stein, L. Y.,
Calore, B. L.,
and Dynan, W. S.
(1993)
J. Biol. Chem.
268,
10440-10447[Abstract/Free Full Text]
-
Pan, Z. Q.,
Amin, A. A.,
Gibbs, E.,
Niu, H. W.,
and Hurwitz, J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
8343-8347[Abstract/Free Full Text]
-
Brush, G. S.,
Anderson, C. W.,
and Kelly, T. J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
12520-12524[Abstract/Free Full Text]
-
de Vries, E.,
van Driel, W.,
Bergsma, W. G.,
Arnberg, A. C.,
and van der Vliet, P. C.
(1989)
J. Mol. Biol.
208,
65-78[CrossRef][Medline]
[Order article via Infotrieve]
-
Paillard, S.,
and Strauss, F.
(1991)
Nucleic Acids Res.
19,
5619-5624[Abstract/Free Full Text]
-
Griffith, A. J.,
Blier, P. R.,
Mimori, T.,
and Hardin, J. A.
(1992)
J. Biol. Chem.
267,
331-338[Abstract/Free Full Text]
-
Blier, P. R.,
Griffith, A. J.,
Craft, J.,
and Hardin, J. A.
(1993)
J. Biol. Chem.
268,
7594-7601[Abstract/Free Full Text]
-
Falzon, M.,
Fewell, J. W.,
and Kuff, E. L.
(1993)
J. Biol. Chem.
268,
10546-10552[Abstract/Free Full Text]
-
Tuteja, N.,
Tuteja, R.,
Ochem, A.,
Taneja, P.,
Huang, N. W.,
Simoncsits, A.,
Susic, S.,
Rahman, K.,
Marusic, L.,
Chen, J.,
Zhang, J.,
Wang, S.,
Pongor, S.,
and Falaschi, A.
(1994)
EMBO J.
13,
4991-5001[Medline]
[Order article via Infotrieve]
-
Giffin, W.,
Kwast-Welfeld, J.,
Rodda, D. J.,
Préfontaine, G. G.,
Traykova-Andonova, M.,
Zhang, Y.,
Weigel, N. L.,
Lefebvre, Y. A.,
and Haché, R. J. G.
(1997)
J. Biol. Chem.
272,
5647-5658[Abstract/Free Full Text]
-
Cao, Q. P.,
Pitt, S.,
Leszyk, J.,
and Baril, E. F.
(1994)
Biochemistry
33,
8548-8557[CrossRef][Medline]
[Order article via Infotrieve]
-
Rodda, D. J.,
Giffin, W.,
and Haché, R. J. G.
(1995)
Biochem. Biophys. Res. Commun.
209,
379-384[CrossRef][Medline]
[Order article via Infotrieve]
-
Giffin, W.,
and Haché, R. J. G.
(1995)
DNA Cell Biol.
14,
1025-1035[Medline]
[Order article via Infotrieve]
-
Reeves, W. H.
(1992)
Rheum. Dis. Clinic. N. Am.
18,
391-415[Medline]
[Order article via Infotrieve]
-
Kadanaga, J.,
and Tjian, R.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
5889-5893[Abstract/Free Full Text]
-
Jansen-Durr, P.,
Boshart, M.,
Lupp, B.,
Bosserhoff, A.,
Frank, R. W.,
and Shutz, G.
(1992)
Nucleic Acids Res.
20,
1243-1249[Abstract/Free Full Text]
-
Dignam, J.,
Lebovitz, R.,
and Roeder, R.
(1983)
Nucleic Acids Res.
11,
1475-1489[Abstract/Free Full Text]
-
Ono, M.,
Tucker, P. W.,
and Capra, J. D.
(1994)
Nucleic Acids Res.
22,
3918-3924[Abstract/Free Full Text]
-
Suck, D.,
and Oefner, C.
(1986)
Nature
312,
620-625[CrossRef]
-
Suck, D.,
Lahm, A.,
and Oefner, C.
(1988)
Nature
332,
464-468[CrossRef][Medline]
[Order article via Infotrieve]
-
Weston, S. A.,
Lahm, A.,
and Suck, D.
(1992)
J. Mol. Biol.
226,
1237-1256[CrossRef][Medline]
[Order article via Infotrieve]
-
Moore, S.
(1981)
in
The Enzymes (Boyer, P. D., ed), 3rd Ed., Vol. 14, pp. 281-296, Academic Press, New York
-
Laskowski, M.
(1971)
Enzymes
4,
289-311
-
Genersch, E.,
Eckerskorn, C.,
Lottspeich, F.,
Herzog, C.,
Kuhn, K.,
and Poschl, E.
(1995)
EMBO J.
14,
791-800[Medline]
[Order article via Infotrieve]
-
Kim, M. H.,
and Peterson, D. O.
(1995)
J. Virol.
69,
4717-4726[Abstract]
-
Knuth, M. W.,
Gunderson, S. I.,
Thompson, N. E.,
Strasheim, L. A.,
and Burgess, R. R.
(1990)
J. Biol. Chem.
265,
17911-17920[Abstract/Free Full Text]
-
Liu, E. S.,
and Lee, A. S.
(1991)
Nucleic Acids Res.
19,
5425-5431[Abstract/Free Full Text]
-
May, G.,
Sutton, C.,
and Gould, H.
(1991)
J. Biol. Chem.
266,
3052-3059[Abstract/Free Full Text]
-
Messier, H.,
Fuller, T.,
Mangal, S.,
Brickner, H.,
Igarashi, S.,
Gaikwad, J.,
Fotedar, R.,
and Fotedar, A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2685-2689[Abstract/Free Full Text]
-
Okumura, K.,
Takagi, S.,
Sakaguchi, G.,
Naito, K.,
Minoura-Tada, N.,
Kobayashi, H.,
Mimori, T.,
Hinuma, Y.,
and Igarashi, H.
(1994)
FEBS Lett.
356,
94-100[CrossRef][Medline]
[Order article via Infotrieve]
-
DiCroce, P. A.,
and Krontiris, T. G.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10137-10141[Abstract/Free Full Text]
-
Gerstle, J. T.,
and Fried, M. G.
(1993)
Electrophoresis
14,
725-731[CrossRef][Medline]
[Order article via Infotrieve]
-
Mccormick, L.,
Roller, R. J.,
and Roizman.
(1992)
J. Virol.
66,
3435-3447[Abstract/Free Full Text]
-
Mukherjee, R.
(1993)
Nucleic Acids Res.
21,
2655-2661[Abstract/Free Full Text]
-
Tanuma, Y.,
Nakabayashi, H.,
Esumi, M.,
and Endo, H.
(1995)
Mol. Cell. Biol.
15,
517-523[Abstract]
-
Cogan, J. G.,
Sun, S.,
Stoflet, E. S.,
Schmidt, L. J.,
Getz, M. J.,
and Strauch, A. R.
(1995)
J. Biol. Chem.
270,
11310-11321[Abstract/Free Full Text]
-
Nordstrom, L. A.,
Dean, D. M.,
and Sanders, M. M.
(1993)
J. Biol. Chem.
268,
13193-13202[Abstract/Free Full Text]
-
Altiok, S.,
and Groner, B.
(1993)
Mol. Cell. Biol.
13,
7303-7310[Abstract/Free Full Text]
-
Sun, S. Q.,
Stoflet, E. S.,
Cogan, J. G.,
Strauch, A. R.,
and Getz, M. J.
(1995)
Mol. Cell. Biol.
15,
2429-2436[Abstract]
-
Sakatsume, O.,
Tsutsui, H.,
Wang, Y.,
Gao, H.,
Tang, X.,
Yamauchi, T.,
Murata, T.,
Itakura, K.,
and Yokoyama, K. K.
(1996)
J. Biol. Chem.
271,
31322-31333[Abstract/Free Full Text]
-
Kelm, R. J., Jr.,
Sun, S.,
Strauch, A. R.,
and Getz, M. J.
(1996)
J. Biol. Chem.
271,
24278-24285[Abstract/Free Full Text]
-
Romero, F.,
Dargemont, C.,
Pozo, F.,
Reeves, W. H.,
Camonis, J.,
Gisselbrecht, S.,
and Fischer, S.
(1996)
Mol. Cell. Biol.
16,
37-44[Abstract]
-
Jin, S.,
and Weaver, D. T.
(1997)
EMBO J.
16,
6874-6885[CrossRef][Medline]
[Order article via Infotrieve]
-
Ochem, A. E.,
Skopac, D.,
Costa, M.,
Rabilloud, T.,
Vuillard, L.,
Simoncsits, A.,
Giacca, M.,
and Falaschi, A.
(1997)
J. Biol. Chem.
272,
29919-29926[Abstract/Free Full Text]
-
Wang, J.,
Dong, X.,
Myung, K.,
Hendrickson, E. A.,
and Reeves, W. H.
(1998)
J. Biol. Chem.
273,
842-848[Abstract/Free Full Text]
-
Bliss, T. M.,
and Lane, D. P.
(1997)
J. Biol. Chem.
272,
5765-5773[Abstract/Free Full Text]
-
Cary, R. B.,
Peterson, S. R.,
Wang, J. T.,
Bear, D. G.,
Bradbury, E. M.,
and Chen, D. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
4267-4272[Abstract/Free Full Text]
-
Richard-Foy, H.,
and Hager, G. L.
(1987)
EMBO J.
6,
2321-2328[Medline]
[Order article via Infotrieve]
-
Truss, M.,
Bartsch, J.,
Schelbert, A.,
Haché, R. J. G.,
and Beato, M.
(1995)
EMBO J.
14,
1737-1751[Medline]
[Order article via Infotrieve]
-
Leber, R.,
Wise, T. W.,
Mizuta, R.,
and Meek, K.
(1998)
J. Biol. Chem.
273,
1794-1801[Abstract/Free Full Text]
-
Kakkis, E.,
and Calame, K.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
7031-7035[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Zhang, B. Schlott, M. Gorlach, and F. Grosse
DNA-dependent protein kinase (DNA-PK) phosphorylates nuclear DNA helicase II/RNA helicase A and hnRNP proteins in an RNA-dependent manner
Nucleic Acids Res.,
January 2, 2004;
32(1):
1 - 10.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C. Li, F. He, X. Shao, M. Urano, L. Shen, D. Kim, M. Borrelli, S. A. Leibel, P. H. Gutin, and C. C. Ling
Adenovirus-mediated Heat-activated Antisense Ku70 Expression Radiosensitizes Tumor Cells in Vitro and in Vivo
Cancer Res.,
June 15, 2003;
63(12):
3268 - 3274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bianchi and T. de Lange
Ku Binds Telomeric DNA in Vitro
J. Biol. Chem.,
July 23, 1999;
274(30):
21223 - 21227.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yoo, A. Kimzey, and W. S. Dynan
Photocross-linking of an Oriented DNA Repair Complex. Ku BOUND AT A SINGLE DNA END
J. Biol. Chem.,
July 9, 1999;
274(28):
20034 - 20039.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Giffin, W. Gong, C. Schild-Poulter, and R. J. G. Hache
Ku Antigen-DNA Conformation Determines the Activation of DNA-Dependent Protein Kinase and DNA Sequence-Directed Repression of Mouse Mammary Tumor Virus Transcription
Mol. Cell. Biol.,
June 1, 1999;
19(6):
4065 - 4078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Ruiz, D. Matheos, G. B. Price, and M. Zannis-Hadjopoulos
OBA/Ku86: DNA Binding Specificity and Involvement in Mammalian DNA Replication
Mol. Biol. Cell,
March 1, 1999;
10(3):
567 - 580.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Giampuzzi, G. Botti, M. Di Duca, L. Arata, G. Ghiggeri, R. Gusmano, R. Ravazzolo, and A. Di Donato
Lysyl Oxidase Activates the Transcription Activity of Human Collagene III Promoter. POSSIBLE INVOLVEMENT OF Ku ANTIGEN
J. Biol. Chem.,
November 10, 2000;
275(46):
36341 - 36349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Uliel, P. Weisman-Shomer, H. Oren-Jazan, T. Newcomb, L. A. Loeb, and M. Fry
Human Ku Antigen Tightly Binds and Stabilizes a Tetrahelical Form of the Fragile X Syndrome d(CGG)n Expanded Sequence
J. Biol. Chem.,
October 13, 2000;
275(42):
33134 - 33141.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|