| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 35, 22254-22259, August 28, 1998
§,,,
,**, and
From the Yeast GST1 gene, whose product is a
GTP-binding protein structurally related to polypeptide chain
elongation factor-1 Cell-cycle progression is regulated by a variety of genes at the
G1 to S phase transition (1, 2). Among them, the yeast GST1 gene, whose product is a GTP-binding protein
structurally related to
EF1 In eukaryotic protein synthesis, termination codons are directly
recognized by a polypeptide chain releasing factor, eRF1, to release
synthesized polypeptide chain from ribosome, and another releasing
factor, eRF3, is essentially required for the ribosomal binding of
eRF1. Although the molecular entity of eRF3 has remained unknown, the
termination factor appears to act as a GTP-binding protein based on the
analogy of prokaryotic RF3 (10, 11). Recently, it was reported in
S. cerevisiae (12) and Xenopus laevis (13) that
the product of the GST1/SUP35 gene forms a ternary complex
with SUP45, which is another member of omnipotent suppressors to function as eRF1. These findings allowed us to postulate
that the previously identified human GSPT1 may also function as eRF3.
However, our further studies revealed the existence of another GSPT
gene in mammalian cells (14). In the present paper, we have isolated
two mouse GSPT genes, the counterpart of human GSPT1 and a novel member
of the GSPT gene family, GSPT2. The two GSPTs were clearly distinct
from each other in terms of the amino acid sequences, the expression
during cell-cycle progression, and tissue distribution. Analyses using
immunoprecipitation technique and yeast two-hybrid system indicated
that not only GSPT1 but also the novel GSPT2 may form a binary complex
with eRF1 to function as eRF3.
RNA Blot Hybridization Analysis--
Total cellular RNA was
prepared from cells or tissues using the acid guanidinium
thiocyanate-phenol-chloroform method (15). For Northern blotting, 20 µg of RNA was denatured by heating at 65 °C for 5 min in 2.2 M formaldehyde, 50% (v/v) formamide, and size-fractionated
by 1.2% agarose gel containing 2.2 M formaldehyde. The RNA
was transferred directly to nylon membrane filters. Hybridization was
carried out overnight at 42 °C in a solution containing 40% formamide, 5× SSC (1× SSC = 0.15 M NaCl, 15 mM sodium citrate), 3× Denhardt's solution (1×
Denhardt's solution = 0.002% Ficoll, 0.02% bovine serum
albumin, 0.02% polyvinyl pyrrolidone), 50 mM sodium
phosphate (pH 6.8), and 100 µg/ml of heat-denatured salmon sperm DNA.
Filters were washed twice at room temperature in 2× SSC buffer, twice
at 68 °C in 1× SSC buffer for 10 min per wash, and subjected to
autoradiography. The plasmid carrying cDNA sequence for EF1 Preparation and Screening of RACE PCR--
RACE PCR was performed on mouse brain
Marathon-Ready cDNA (CLONTECH, Palo Alto, CA)
using antisense primers specific for GSPT1 and GSPT2 according to the
manufacturer's directions. The resulting PCR products were ligated
into vector pUC18 and sequenced.
Ribonuclease Protection Assay--
Construction of GSPT-specific
cDNAs was performed as follows. For GSPT1-specific cDNA, a
cDNA fragment of GSPT1 corresponding to nucleotide residues
1529-1754 was synthesized by PCR using oligonucleotide primers,
GSPT1-5' (5'-primer) and GSPT1-3' (3'-primer), with pGM19 as a
template. A cDNA product of GSPT2 corresponding to nucleotide
residues 411-544 was also synthesized using primers, GSPT2-5'
(5'-primer) and GSPT2-3' (3'-primer), with pGM1 as a template. For
EF1 RNA Expression Analysis by PCR--
Randomly primed cDNA
prepared from total RNA of various tissues was amplified by PCR using
the sequence-specific primer, G13' (GSPT1) or G23' (GSPT2), and the
common primer, G5'. Conditions of the PCR were held within the range of
quantitative amplification to provide a relative measure of RNA
content in the various samples. The synthetic oligonucleotide used
were: G5'/ATTGAAGAGGAAGAGATTCTTCC; G13'/AAAGTAAGAGAAGGCGGTGTGAAGTAGGCTTTTGCA; and
G23'/TGGGCAGTAGGTTGCGGTCA.
DNA Transfection into COS-7 Cells and
Immunoprecipitation--
Although mouse eRF1 (SUP45
homologue) has not been cloned yet, eRF1 is highly conserved from
Xenopus to human. Thus, human eRF1 (TB3-1), of which
cDNA had been cloned from total RNA of HL60 cells by means of
reverse transcription-PCR based on the sequence described previously
(19) with recent correction (20), was used as a counterpart in the
present assay. COS-7 cells were cultured in Dulbecco's modified
Eagle's medium (Life Technologies, Inc.) containing 10% fetal calf
serum and maintained at 37 °C in 95% air and 5% CO2.
10 µg each of various cDNAs, in which GSPT1, GSPT2, or TB3-1 had
been fused in-frame with the flag epitope sequence of pFlag-CMV-2
expression vector (Eastman Kodak Co.), was added to the cells grown at
a density of approximately 80% confluence per 90-mm dish with
LipofectAMINETM in Opti-MEM I (Life Technologies, Inc.)
according to the standard procedure. After a 76-h culture, the
transfected cells were harvested and then lysed by shaking for 30 min
in 0.5 ml of an extraction buffer consisting of 20 mM
Na-Hepes (pH 7.5), 75 mM NaCl, 1% Nonidet P-40, 15 mM sodium fluoride, 1 mM
Na3VO4, 10 mM
Na4P2O7, 2 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 25 µg/ml of
aprotinin. The lysate was centrifuged at 15,000 × g
for 20 min, and the supernatant was precleared by incubating at 4 °C
for 30 min with 20 µl of anti-mouse IgG agarose beads (50% slurry,
American Qualex Inc.). After removal of the agarose beads, the
supernatant was further incubated at 4 °C for 90 min with 20 µl of
the agarose beads (50% slurry) conjugated with anti-flag tag
monoclonal antibody M2 (Kodak Scientific Imaging Systems). The agarose
beads were washed three times with 1 ml of the extraction buffer, and
proteins were eluted from the beads by adding 40 µl of 2× SDS sample
buffer and heating at 95 °C. An aliquot (15 µl) of the samples was
separated by SDS-polyacrylamide gel electrophoresis (8%
polyacrylamide), and the proteins were transferred to a polyvinylidene
difluoride membrane (Fluorotrans, Pall BioSupport Division). The
membrane, after being shaken in TBS (20 mM Tris-HCl, pH
7.5, and 150 mM NaCl) containing 5% (w/v) bovine serum
albumin, was incubated with rabbit antiserum raised against recombinant
human GSPT1 or TB3-1 at room temperature for 2 h and then further
incubated with 125I-labeled protein A in TBS containing 5%
bovine serum albumin. The radioactivity retained on the membrane was
visualized with the Fuji BAS 2000 bioimaging analyzer.
Yeast Two-hybrid Assay System--
The cDNAs encoding
TB3-1, GSPT1, and GSPT2 were fused in-frame with the GAL4 DNA-binding
and/or transactivation domains using pGBT9 and pGAD424 expression
vectors. A series of deletion and chimeric mutants of GSPTs were
constructed using a PCR-based strategy. PCR products encoding
amino-terminal and carboxyl-terminal truncations of GSPT2 were
subcloned into pGBT9 in-frame with the GAL4 DNA-binding domain. For
chimeric constructs, PCR products encoding amino-terminal regions of
GSPT2 and the carboxyl-terminal region of GSPT1 were fused and
subcloned into pGBT9 in-frame with the GAL4 DNA-binding domain. The
two-hybrid vectors thus obtained were cotransformed into the SFY526
yeast host strain. Transformed colonies were replated on tryptophan-
and leucine-deficient medium. Quantitative Molecular Cloning of Two Closely Related Mouse cDNAs That Are
Homologous to Human GSPT1 Gene--
In the course of investigating the
expression of GSPT1 gene, we noticed there were at least two
transcripts in mouse Swiss 3T3 cells, which were cross-hybridized with
human GSPT1 cDNA probe; one was the same length (2.7 kb) as human
GSPT1 transcript, and the other was approximately 2.6 kb (data not
shown). Because the two transcripts were also found in mouse FM3A
cells, we screened the FM3A cDNA library (approximately 6 × 105 primary recombinants) at reduced stringency with the
human cDNA as a probe. Twelve positive clones were detected and
isolated, and the DNA prepared was subcloned into pUC119 and analyzed
by restriction endonuclease mapping, resulting in two types of the restriction maps.
Department of Physiological Chemistry,
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(EF1), was first described to be essential
for the G1 to S phase
transition (GSPT) of the cell cycle, and the product was
recently reported to function as a polypeptide chain release factor 3 (eRF3) in yeast. Although we previously cloned a human homologue
(renamed as GSPT1) of the yeast gene, it has remained to be determined whether GSPT1 also functions as eRF3 or if another GSPT may have such a
function in mammalian cells. In the present study, we isolated two
mouse GSPT genes, the counterpart of human GSPT1 and a novel member of
the GSPT gene family, GSPT2. Both the mouse GSPTs had a two-domain
structure characterized as an amino-terminal no-homologous region
(approximately 200 amino acids) and a carboxyl-terminal conserved
eukaryotic elongation factor-1-like domain (428 amino acids).
Messenger RNAs of the two GSPTs could be detected in all mouse tissues
surveyed, although the level of GSPT2 message appeared to be relatively
abundant in the brain. The mouse GSPT1 was expressed in a
proliferation-dependent manner in Swiss 3T3 cells, whereas the expression of GSPT2 was constant during the cell-cycle progression. Immunoprecipitation assays in COS-7 cells expressing flag
epitope-tagged proteins demonstrated that not only GSPT1 but also GSPT2
was capable of interacting with eRF1. Such interaction between GSPT2
and eRF1 was also confirmed by yeast two-hybrid analysis. Taken
together, these data indicated that the novel GSPT2 may interact with
eRF1 to function as eRF3 in mammalian cells.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
,1 was first isolated
based on the ability to complement a temperature-sensitive gst1 mutation of Saccharomyces cerevisiae (3).
Gst1 is a cdc-like mutant whose execution point
is distal to the mating factor-sensitive step. In this mutant, DNA
synthesis was substantially arrested at the nonpermissive temperature.
It thus appeared that the GST1 gene product play an
essential role at the G1 to S phase transition in the yeast
cell cycle. On the other hand, SUP35 (SUP2) was
cloned by another group investigating omnipotent suppressor mutant of S. cerevisiae, and the gene turned out to be identical to
GST1 (4). Omnipotent suppressor is a class of nonsense
suppressors that is recessive and effective toward all three types of
nonsense codons (5). Mutations in the GST1/SUP35 gene were
shown to increase the level of translational ambiguity (6-8),
suggesting that this gene product may also function as a positive
regulator of translational accuracy in yeast. We previously cloned a
human homologue (renamed as GSPT1) of the yeast gene and reported that there is a functional conservation of the gene from yeast to human; GSPT1 could complement the gst1 mutation of S. cerevisiae (9). However, the relationship between the yeast
cell-cycle control and translational regulation by the
GST1/SUP35 gene product has remained to be determined.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(PAN7) was a gift from Dr. Y. Kaziro (Tokyo Institute of Technology,
Yokohama, Japan) and was used as the hybridization probe.
gt10 cDNA
Library--
Poly(A)+ RNA was separated from total
cellular RNA by oligo(dT)-cellulose column chromatography. Construction
of gt10 cDNA library was described previously (9). Briefly,
Poly(A)+ RNA isolated from FM3A cells was converted into
double-stranded cDNA by the RNase H method of Gubler and Hoffman
(16). Resultant double-stranded cDNA was blunt-ended by T4 DNA
polymerase, treated with EcoRI methylase, ligated synthetic
EcoRI linkers, and finally digested with EcoRI.
The linker-ligated cDNA thus prepared was passed through a
Sepharose CL-4B column to remove linker fragments and then inserted
into phage gt10 and packaged in vitro using Gigapack Gold
(Vector Cloning System, San Diego, CA). Thus prepared bacteriophage
particles were grown on Escherichia coli C600 Hfl. A total
of 6 × 105 independent recombinant plaques was
screened by the plaque-hybridization method (17). Hybridization was
performed overnight at 42 °C in a solution containing 50%
formamide, 5× SSC, 1× Denhardt's solution, and heat-denatured salmon
sperm DNA. Filters were washed as described above and subjected to
autoradiography.
-specific cDNA, a cDNA fragment of EF1 corresponding to nucleotide residues 1529-1754 was synthesized by PCR using oligonucleotide primers, EF-5' (5'-primer) and EF-3' (3'-primer) with
pAN7 as a template. The three cDNA products were digested with
PstI plus XhoI, HindIII plus
KpnI, and EcoRI plus XhoI,
respectively, and then subcloned into pBlueScript(SK
) vector under
the control of T7 RNA polymerase promoter in the antisense orientation,
resulting in pBSG1, pBSG2, and pBSE. pBSG1 was digested with
BamHI to produce a 270-nucleotide cRNA. pBSG2 was digested
with EcoRI to produce a cRNA of 159 nucleotides. pBSE was
digested with BamHI to produce a 270-nucleotide cRNA. cRNA
synthesis was performed using the protocol of the manufacturer (Ambion)
in the presence of [32P]UTP and T7 RNA polymerase,
followed by exhaustive DNase I digestion. Labeled transcripts were
subsequently purified by polyacrylamide gel electrophoresis. Briefly,
after electrophoresis on 8 M urea, 5% polyacrylamide, the
probe was cut off from the gel using the autoradiogram as a template.
The gel slice was then incubated at 37 °C for 3 h in a solution
containing 0.5 M ammonium acetate, 0.2% SDS, and 1 mM EDTA. The RNA was recovered by ethanol precipitation. Protection experiments were performed essentially as described (18).
Briefly, total RNA (10 µg) was hybridized to 5 × 105 cpm of pBSG1 or pBSG2 cRNA at 42 °C for 16 h in
a solution consisting of 80% formamide, 1 mM EDTA, 0.1 M sodium citrate (pH 6.4), and 0.3 M sodium
acetate (pH 6.4). The hybridization mixture was then digested with
RNase A and T1 at 37 °C for 30 min. After proteinase K digestion and
ethanol precipitation, samples were run on a 8 M urea, 5%
polyacrylamide gel. The radioactivity was measured with a Fuji
BAS 2000 bioimaging analyzer. The synthetic oligonucleotide used were:
GSPT1-5'/AACTGCAGCAGGAACCATCTGC; GSPT1-3'/TTCTCGAGAGGTTTGTCAATGG; GSPT2-5'/GGAAGCTTAAAGAAGTGAGTGA; GSPT2-3'/TTGGTACCTGATGGTATGGCCA; EF-5'/AAGAATTCTCAAGCCTGGC; and EF-3'/TTCTCGAGCAGTGAAGCCA.
-galactosidase assays
were carried out as described previously (21). In brief, densities of
cell culture grown at 30 °C in SD medium lacking leucine and
tryptophan were measured by optical density at 600 nm, and the cells
were harvested by centrifugation, resuspended in 0.1 ml of Z buffer (82 mM sodium phosphate, pH 7.0, 10 mM KCl, and 1 mM MgSO4), and permeabilized by freezing in
liquid nitrogen and thawing at 37 °C. After cells were diluted with
0.7 ml of Z buffer containing 40 mM -mercaptoethanol,
reactions were started by adding 0.16 ml of
o-nitrophenyl--D-galactopyranoside (4 mg/ml in Z buffer), incubated at 30 °C for 10 min to 10 h, stopped by adding 0.4 ml of 1 M Na2CO3, then
assayed by measurement of A420. -galactosidase activity was calculated in Miller units (22) as
1,000 × (A420/A600) × culture volume (milliliter) × reaction time (min).
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
Differential Expression of GSPT1 and GSPT2 in Mouse Tissues and Cell Lines-- To investigate the relationship between the present two mouse GSPT genes, their expressions were analyzed by an RNase protection assay with specific riboprobes (cRNA) constructed to the coding regions of the carboxyl-terminal GSPT1 and amino-terminal GSPT2. As shown in Fig. 2A, there was a marked increase in GSPT1 transcript at 5 h upon stimulation of Swiss 3T3 cells with 5% fetal bovine serum, which was followed by a gradual decrease. In contrast, GSPT2 transcript did not fluctuate over the 25-h period after the serum stimulation. Similar results were obtained in the cells stimulated with phorbol ester (Fig. 2B). Thus, GSPT1 gene appeared to be inducible in response to growth stimulation, whereas GSPT2 is constantly expressed not dependent on the stimulation in the fibroblastic cells. We also examined the tissue distribution of GSPT1 and GSPT2 mRNAs in mouse. Both GSPT1 and GSPT2 were expressed in all tissues tested, though GSPT2 transcript was relatively enriched in the brain (Fig. 3). The same results were obtained upon analysis by the RNase protection assay (data not shown).
|
|
Interaction of GSPT Gene Products with eRF1-- Recent studies in yeast (12) and X. laevis (13) have shown that Sup35p can interact with Sup45p (eRF1) to function as a polypeptide chain releasing factor, eRF3, in protein synthesis. To extend this notion to mammalian cells and assess the implication of the two mouse GSPT gene products in the termination reaction of protein synthesis, the association of GSPT1 and GSPT2 with eRF1 was investigated by immunoprecipitation assays in COS-7 cells expressing flag epitope-tagged proteins. The sequence of a flag monoclonal-antibody epitope was attached to the open reading frames of GSPT1, GSPT2, and eRF1 cDNAs to produce proteins that were composed of the flag epitope fused to the amino termini of the gene products. The expression vectors composed of the flag-tagged cDNAs under the control of CMV promoter were transiently transfected into COS-7 cells, and the cell extracts were immunoprecipitated with anti-flag monoclonal antibody. As shown in Fig. 4, an endogenous 54-kDa peptide, which was recognized by anti-TB3-1 (eRF1) antiserum, could be co-immunoprecipitated with the flag-tagged GSPT1 or GSPT2 (Panel B, lanes 1 and 2). On the other hand, several anti-GSPT antiserum-reactive peptides of approximately 90 kDa were observed upon immunoprecipitation of the flag-tagged TB3-1 (Panel A, lane 3).
|
-galactosidase reporter was assayed quantitatively by the standard
procedure (21). As shown in Fig.
5A, there was strong
interaction between the full-length mouse GSPT2 (1-632) and the human
eRF1. Significant interaction between GSPT1 and eRF1 was also
detectable if the more sensitive yeast strain Y190 was used instead of
SFY526 (data not shown).
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
In the present study, we have identified a novel member of the GSPT gene family, GSPT2, which may function as the polypeptide chain release factor, eRF3, in the termination of mammalian protein synthesis. This is the first demonstration showing the heterogeneity of GSPT- (or eRF3-) related genes in eukaryotic cells. Mouse GSPT1 and GSPT2 genes were clearly distinct from each other in terms of their amino acid sequences (especially in their amino termini) expression during cell-cycle progression, and tissue distribution. In contrast to GSPT1, the expression of the novel GSPT2 gene was constant during the cell-cycle progression of 3T3 cells and was relatively abundant in mouse brain. Our previous study on the chromosome mapping of the GSPT1 gene suggested the existence of a homologous gene on the X chromosome (14), which may represent the locus of human GSPT2 gene.
As has been reported previously, the yeast GST1/SUP35 gene
product consists of two domains, the amino- and carboxyl-terminal ones
(Fig. 5). The amino-terminal domain consisting of 257 amino acid
residues is unique for the yeast GST1/SUP35 and is also
reported to be essential for the inheritance of the
[psi+] phenotype (26, 27). On the other hand,
the carboxyl-terminal domain (428 amino acids) is similar to EF1 and
essential for the translation termination (28). Recently, Jean-Jean
et al. (23) reported that the 5'-end of the open reading
frame of human GSPT1 gene is longer than previously reported by 138 codons, indicating that the length of the amino-terminal domain (209 amino acids) of human GSPT1 is now close to that of the yeast
GST1/SUP35 gene product. The two mouse GSPTs also had the
amino-terminal domain consisting of approximately 200 amino acids.
Thus, eukaryotic GSPT gene products appeared to be characterized as at
least the two-domain structure, a unique amino-terminal region and the
conserved EF1-like carboxyl-terminal domain.
A striking difference between mouse GSPT1 and GSPT2 is observed in the amino-terminal region, though their carboxyl-terminal domains are highly homologous in the primary structure. In the present study, interaction of eRF1 with the GSPT gene products was assessed using co-immunoprecipitation and yeast two-hybrid assays. The results indicated that both GSPT1 and GSPT2 were able to bind eRF1. When the amino-terminal region of GSPT2 was deleted, the interaction was impaired. In addition, the carboxyl-terminal region of GSPT2 was also required for the interaction; GSPT2 deleted with the carboxyl-terminal 205 amino acids failed to bind eRF1. Thus, the data presented here clearly demonstrated that the GSPT2 gene product interacts with eRF1 directly and that at least two distinct regions of GSPT2 are required for its binding to eRF1.
In the present study, we demonstrated significant interaction between GSPT gene products and eRF1. However, there was no obvious difference in the eRF1 binding properties between the two GSPTs. In prokaryotic cells, two release factors, RF1 and RF2, which correspond to eRF1, catalyze the termination reaction at UAA and UAG codons and UAA and UGA codons, respectively (29). In addition, a nonessential factor, RF3, appears primarily to function as an enhancer predominantly for the RF2-mediated termination at UGA codon (30, 31). In eukaryotic cells, however, only eRF1 has been identified as the peptidyl release factor for the three termination codons, and both eRF1 and eRF3 appear to be essential and required to form a functional release factor complex (32 33). However, we cannot totally rule out the possibility that a RF2-like termination factor(s) other than eRF1 may exist and interact efficiently with either of the GSPT gene products in eukaryotic cells. This notion might be supported by the findings that several genes related to eRF1/SUP45 were present in human genome (34).
In a previous study (9), we reported that human GSPT1 is capable of complementing the temperature-sensitive growth of the yeast gst1 mutant, though the exact role of the yeast GST1/SUP35 gene product in the regulation of cell-cycle progression has remained unknown. This suggests that in mammalian cells either of the GSPT genes may participate in the regulation of cell cycle. Given that mouse GSPT1 gene expression is up-regulated at the G1 to S phase transition, in which GSPT2 gene expression is constant, GSPT1 might interact with a protein(s) other than eRF1-like factor, which regulates cell-cycle progression. The GST1 gene, which exists in a single copy in yeast, might duplicate in evolution to generate functionally specialized GSPT genes (GSPT1 and GSPT2) in mammals. These possibilities concerning the presence of a novel interaction molecule(s) to GSPT gene products and the relationship between translation termination and cell-cycle regulation are currently under investigation in our laboratory.
| |
FOOTNOTES |
|---|
* This work was supported in part by research grants from the Research for the Future Program of the Japan Society for the Promotion of Science (JSPS-RFTF 96L00505), the Scientific Research Fund of the Ministry of Education, Science, Sports, and Culture of Japan, and Taisho Pharmaceutical Co., Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AB003502, AB003503.
§ To whom correspondence should be addressed: Tel.: 81-3-3812-2111, Ext. 4754; Fax: 81-3-3815-9604; E-mail: hoshino{at}mol.f.u-tokyo.ac.jp.
Present address: Institute for Molecular and Cellular Biology,
Osaka University, 1-3 Yamada-oka, Suita, Osaka 565, Japan.
** Present address: Ui Laboratory, Institute of Physical and Chemical Research, Hirosawa 2-1, Wako-shi 351-01, Japan.
The abbreviations used are:
EF1, elongation
factor 1; GST or GSPT, a GTP-binding protein appearing to be
essential for the G1 to S phase transition of the cell
cycle EF and RF, elongation and release factors involved in protein
synthesis, respectivelyPCR, polymerase chain reactionRACE, rapid
amplification of cDNA endskb, kilobase(s).
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Funakoshi, Y. Doi, N. Hosoda, N. Uchida, M. Osawa, I. Shimada, M. Tsujimoto, T. Suzuki, T. Katada, and S.-i. Hoshino Mechanism of mRNA deadenylation: evidence for a molecular interplay between translation termination factor eRF3 and mRNA deadenylases Genes & Dev., December 1, 2007; 21(23): 3135 - 3148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Fang, M. Menon, W. Kapelle, O. Bogacheva, O. Bogachev, E. Houde, S. Browne, P. Sathyanarayana, and D. M. Wojchowski EPO modulation of cell-cycle regulatory genes, and cell division, in primary bone marrow erythroblasts Blood, October 1, 2007; 110(7): 2361 - 2370. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Chauvin, S. Salhi, and O. Jean-Jean Human Eukaryotic Release Factor 3a Depletion Causes Cell Cycle Arrest at G1 Phase through Inhibition of the mTOR Pathway Mol. Cell. Biol., August 15, 2007; 27(16): 5619 - 5629. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kodama, K. Ito, and Y. Nakamura The role of N-terminal domain of translational release factor eRF3 for the control of functionality and stability in S. cerevisiae Genes Cells, May 1, 2007; 12(5): 639 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Krzewska, M. Tanaka, S. G. Burston, and R. Melki Biochemical and Functional Analysis of the Assembly of Full-length Sup35p and Its Prion-forming Domain J. Biol. Chem., January 19, 2007; 282(3): 1679 - 1686. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Szodoray, P. Alex, M. B. Frank, M. Turner, S. Turner, N. Knowlton, C. Cadwell, I. Dozmorov, Y. Tang, P. C. Wilson, et al. A genome-scale assessment of peripheral blood B-cell molecular homeostasis in patients with rheumatoid arthritis Rheumatology, December 1, 2006; 45(12): 1466 - 1476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Kashima, A. Yamashita, N. Izumi, N. Kataoka, R. Morishita, S. Hoshino, M. Ohno, G. Dreyfuss, and S. Ohno Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay Genes & Dev., February 1, 2006; 20(3): 355 - 367. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chauvin, S. Salhi, C. Le Goff, W. Viranaicken, D. Diop, and O. Jean-Jean Involvement of Human Release Factors eRF3a and eRF3b in Translation Termination and Regulation of the Termination Complex Formation Mol. Cell. Biol., July 15, 2005; 25(14): 5801 - 5811. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Malta-Vacas, C Aires, P Costa, A R Conde, S Ramos, A P Martins, C Monteiro, and M Brito Differential expression of the eukaryotic release factor 3 (eRF3/GSPT1) according to gastric cancer histological types J. Clin. Pathol., June 1, 2005; 58(6): 621 - 625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kobayashi, Y. Funakoshi, S.-i. Hoshino, and T. Katada The GTP-binding Release Factor eRF3 as a Key Mediator Coupling Translation Termination to mRNA Decay J. Biol. Chem., October 29, 2004; 279(44): 45693 - 45700. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Janzen and A. P. Geballe The effect of eukaryotic release factor depletion on translation termination in human cell lines Nucleic Acids Res., August 23, 2004; 32(15): 4491 - 4502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M Wasserman and J. N Topper Adaptation of the endothelium to fluid flow: in vitro analyses of gene expression and in vivo implications Vascular Medicine, February 1, 2004; 9(1): 35 - 45. [Abstract] [PDF]
|
|
|
|
|
|
N. Hosoda, T. Kobayashi, N. Uchida, Y. Funakoshi, Y. Kikuchi, S. Hoshino, and T. Katada Translation Termination Factor eRF3 Mediates mRNA Decay through the Regulation of Deadenylation J. Biol. Chem., October 3, 2003; 278(40): 38287 - 38291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Hegde, S. M. Srinivasula, P. Datta, M. Madesh, R. Wassell, Z. Zhang, N. Cheong, J. Nejmeh, T. Fernandes-Alnemri, S.-i. Hoshino, et al. The Polypeptide Chain-releasing Factor GSPT1/eRF3 Is Proteolytically Processed into an IAP-binding Protein J. Biol. Chem., October 3, 2003; 278(40): 38699 - 38706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Uchida, S.-i. Hoshino, H. Imataka, N. Sonenberg, and T. Katada A Novel Role of the Mammalian GSPT/eRF3 Associating with Poly(A)-binding Protein in Cap/Poly(A)-dependent Translation J. Biol. Chem., December 20, 2002; 277(52): 50286 - 50292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Janzen, L. Frolova, and A. P. Geballe Inhibition of Translation Termination Mediated by an Interaction of Eukaryotic Release Factor 1 with a Nascent Peptidyl-tRNA Mol. Cell. Biol., December 15, 2002; 22(24): 8562 - 8570. [Abstract] [Full Text] [PDF] < |
