|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 35, 22395-22401, August 28, 1998
From the Departments of Two complementary DNAs for the organic anion
transporter subtypes oatp2 and oatp3, which transport thyroid hormones
as well as taurocholate, were isolated from a rat retina cDNA
library. The sequence of oatp2 is identical to that recently reported
(Noé, B., Hagenbuch, B., Stieger, B., and Meier, P. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10346-10350),
whereas the sequence of oatp3 is novel. oatp3 consists of 670 amino
acid residues and exhibits a structural architecture common to the
organic anion transporter family, possessing the 12 putative
membrane-spanning segments. Oocytes injected with oatp2 and oatp3 cRNAs
showed taurocholate uptake in a saturable manner. The oatp2 and oatp3
cRNA-injected oocytes also showed significant uptake of both thyroxine
and triiodothyronine. Northern blot and in situ analyses
showed that the oatp2 mRNA was widely expressed in neuronal cells
of the central nervous system, especially in the hippocampus,
cerebellum, and choroid plexus as well as in the retina and liver. The
oatp3 mRNA was highly expressed in the kidney and moderately
abundant in the retina. This suggests that oatp2 and oatp3 are
multifunctional transporters involved in the transport of thyroid
hormones in the brain, retina, liver, and kidney.
A homeostatic system controls the fluid environment in the brain
and keeps its chemical composition relatively constant compared with
that of plasma. One mechanism is the blood-brain barrier, which
selectively transports chemical substances via capillary endothelial
cells (1). A second essential component is the choroid plexus
(blood-cerebrospinal fluid barrier), which secretes or takes up
specific chemical substances (2). Although the presence of specific
transporting mechanisms has long been postulated, little is known about
their molecular identity. Recent molecular biological studies revealed
the organic anion transporter family: the Na+-independent
organic anion-transporting polypeptide oatp1 from rat liver, which
transports bile acid, bromosulfophthalein
(BSP),1 and conjugated and
unconjugated steroid hormones (3, 4); the kidney-specific transporter
OAT-K1, which transports methotrexate in the basolateral membrane of
renal tubules (5); and the prostaglandin transporter (6). Moreover,
physiological studies have suggested the presence of other members of
the organic anion transporter family (7). Noé et al.
(8) have recently reported that a new organic anion transporter subtype
(oatp2) is present in rat brain and liver and that the oatp2-expressed
oocytes transported cardiac glycoside as well as taurocholate. However,
the endogenous substrate of oatp2 and the regional distribution in the
brain have not been revealed.
It has been suggested that thyroid hormones are transported into the
brain via the blood-brain barrier (9) or via the choroid plexus (10).
To reveal this mechanism, we focused on the retina. In the retina, the
retinal pigment epithelium is the unique source of transthyretin
synthesis, and it serves to transport thyroxine (T4) across the
blood-retina barrier (11). According to this functional homology
between the choroid plexus epithelium and the retinal pigment
epithelium, we performed polymerase chain reaction (PCR)-based
screening for an organic anion transporter subtype in the retina.
In this paper, we have isolated and characterized oatp2 and a new
organic anion transporter family subtype (termed oatp3) from rat
retina, and this is the first report identifying the molecules involved
in thyroid hormone transport.
Polymerase Chain Reaction--
The primers used for PCR were two
oligonucleotides made according to the amino acid sequences of
transmembrane segments II and X of rat oatp1 (3), both of which are
highly conserved between oatp1 and OAT-K1 (5); they correspond to amino
acid residues 62-68 (5'-primer) and 540-547 (3'-primer) of oatp1. The sequences of the 5'- and 3'-primers were CGGAATTCAATGGGAGCTTTGAGATTGG and CGGAATTCCAAGTGACTTCTCTTCAGACTT, respectively. The PCR amplification was performed by using a GeneAmpTM DNA amplification
reagent kit according to the following schedule: 94 °C for 1 min,
42 °C for 2 min, and 72 °C for 3 min for 30 cycles, followed by
further incubation for 10 min at 72 °C. An aliquot of the PCR
products was electrophoresed on an agarose gel. The amplified DNA
(~1500 base pairs (bp)) was excised from the gel and subcloned into
pBluescriptII KS(+). By sequencing, one clone (psOATP2), corresponding
to amino acid residues 62-545 of oatp2 (8), was found to show 78.4%
identity to rat oatp1 at the amino acid level.
cDNA Isolation--
A rat retina cDNA library was
constructed from fractions containing >2-kilobase pair cDNAs using
a Functional Characterization of oatp2 and oatp3 in Xenopus
Oocytes--
cRNA was synthesized in vitro using T7 RNA
polymerase in the presence of the cap analogue m7GpppG from
linearized pR8 or pR1. Transcribed cRNA (25 ng) was injected into
defolliculated Xenopus laevis oocytes. Injected oocytes were
cultured for 2~3 days in Barth's medium (88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 0.3 mM CaNO3, 0.41 mM
CaCl2, 0.82 mM MgSO4, and 15 mM Hepes, pH 7.6). The uptake (10 min) of
[3H]taurocholate, [125I]T4, or
3,5,3'-[125I]triiodo-L-thyronine
(T3) (all from NEN Life Science Products) was assayed at
room temperature in 100 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1 mM CaCl2,
10 mM Hepes, and 5 mM Tris-HCl, pH 7.5. The oocytes injected with water were used as a control. Each value represents the mean ± S.E. of at least three experiments in
different oocytes. The statistical significance was tested by unpaired
t-test.
Northern Blot Analysis--
2 µg of poly(A)+ RNAs
from tissues were electrophoresed on 1.0% agarose gel and transferred
to a nylon membrane. Hybridization was performed with a
32P-labeled fragment from the ~900-bp
HincII-NotI fragment of the 3'-noncoding region
for pR8 or the ~900-bp SmaI-SmaI fragment of
the 3'-noncoding region for pR1 in a hybridization buffer containing 50% formamide, 5 × SSC, 5 × Denhardt's solution, and 1%
SDS at 42 °C overnight. The hybridized filter was washed in 0.2 × SSC and 1% SDS at 65 °C and exposed to a film at In Situ Hybridization of oatp2--
For in situ
hybridization of the oatp2 mRNA, the same 3'-noncoding
HincII-NotI fragment of pR8 was subcloned, and a
radiolabeled antisense cRNA was synthesized by T7 RNA polymerase using
cDNA Isolation and Structure of oatp2 and oatp3--
A rat
retina cDNA library was screened by hybridization with the fragment
derived from PCR subclone psOAPT2 under low stringency condition.
Twelve clones were isolated and rescued into pBluescript SK(
Molecular Characterization and Tissue Distribution of a New
Organic Anion Transporter Subtype (oatp3) That Transports Thyroid
Hormones and Taurocholate and Comparison with oatp2*
§,¶,
,,,,,, and
Neurophysiology and
Histology and the ¶ First Department of Surgery, Tohoku
University School of Medicine, Sendai 980-8575, Japan, ** Analytical and
Metabolic Research Laboratories, Sankyo Company, Limited, Tokyo
140-8710, Japan, and the Divison of
Nephrology, Vanderbilt University,
Nashville, Tennessee, 37232-2372
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
ZAPII vector (Stratagene) (12), and 8 × 105
independent clones were screened with the 1.5-kilobase pair cDNA fragment of psOATP2. Hybridization was carried out in 25% formamide solution at 42 °C as described (13), and filter washing was performed in a solution containing 2 × SSC and 0.1% SDS at
55 °C. By a series of screenings, 12 hybridization-positive clones
were isolated. Eight of the 12 clones were identified to have the same insert as psOATP2, and the remaining clones were found to show a novel
sequence. In each group, clones pR8 and pR1, both of which contained
the largest insert, were chosen for further analysis. The sequences of
both clones were determined with an ABI PrismTM 377 DNA
sequencer (Perkin-Elmer).
80 °C for
3 h or overnight. Both probes have <48% identity to each other
or to any member of the organic anion transporter family to avoid any cross-hybridization.
-35S-CTP (NEN Life Science Products). The resultant RNAs
were hydrolyzed to make ~150-nucleotide fragments. The brain sections
of male Sprague-Dawley rat were fixed and incubated with radiolabeled probe in the hybridization solution (50% formamide, 2 × SSC, 10 mM Tris-HCl, 1 × Denhardt's solution, 10% dextran
sulfate, and 0.2% SDS) at 55 °C for 6 h, washed subsequently
with 2 × SSC containing 10 mM 
-mercaptoethanol at
50 °C, treated with RNase A, and washed with 0.1 × SSC at
60 °C for 2 h. The sections were dehydrated, exposed to
HyperfilmTM-max (Amersham Pharmacia Biotech) for 14 days, dipped
into Kodak NTB-2 (Eastman Kodak Co.) diluted 1:1 with distilled water,
developed after a 6-week exposure, and counterstained with
hematoxylin-eosin. For specificity control experiment, hybridization was performed in the presence of a 200-fold excess of unlabeled probe
in the hybridization buffer.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
). Eight
of the 12 clones showed restriction patterns corresponding to oatp2
(8), and one representative clone (pR8) was used for further analysis.
pR8 was determined to be composed of ~3.8 kilobase pairs, and the
amino acid sequence of pR8 was identical to that of oatp2 (661 amino
acids with Mr = 73,199.09) (8), except for
several nucleotide differences in the 5'-noncoding region. The
restriction patterns of the remaining four clones were novel, and the
length of each clone was almost identical. Among the four clones, one
clone (pR1), which has the largest insert, showed a nucleotide sequence
that was similar but not identical to any of the organic anion
transporter family cDNAs, including oatp2. The deduced amino acid
sequence of pR1 consists of 670 amino acids (Mr = 74, 643.86), encoding novel organic anion transporter subtype oatp3.
Fig. 1 shows the deduced amino acid
sequence alignment with rat oatp2 and oatp3. oatp2 and oatp3 showed an
identity of 82% at the amino acid level. oatp3 also shows 80% amino
acid identity to rat oatp1 (3), 76.7% to rat kidney OAT-K1 (5), and
33.8% to the rat prostaglandin transporter (6). Hydrophobicity
analyses of oatp3 predicts 12 hydrophobic segments, characteristic of
the organic anion transporter family. For oatp3, four
N-glycosylation sites are predicted, and there are three
potential phosphorylation sites for cAMP-dependent protein
kinase and six potential phosphorylation sites for protein kinase C in
the cytosolic hydrophilic loops (14, 15).
View larger version (56K):
[in a new window]
Fig. 1.
Amino acid comparison of oatp2 and
oatp3. The two sequences are aligned by inserting gaps (-) to
achieve the maximum homology. Exact matches and conservative
substitutions are shown by bars and colons,
respectively. The 12 putative transmembrane segments (I-XII) were
assigned on the basis of hydrophobicity analysis and the sequence
comparison of the other organic anion transporters; the termini of
these segments were tentatively defined. The putative transmembrane
regions are indicated by solid lines.
Triangles, potential N-glycosylation sites;
asterisks, possible phosphorylation sites.
Pharmacological Characterization of oatp2 and oatp3--
Based on
the structural similarity among oatp1, oatp2, and oatp3, we first
examined the uptake of [3H]taurocholate in the oatp2 or
oatp3 cRNA-injected oocytes. The oatp2-cRNA injected oocytes increased
uptake of [3H]taurocholate 18-fold above that of the
water-injected oocytes: 0.11 ± 0.007 versus 0.006 ± 0.001 pmol/oocyte/min at 30 µM
[3H]taurocholate (p < 0.01).
Taurocholate transport followed saturation kinetics with an apparent
Km of 35.2 ± 8.9 µM (Fig.
2a). To characterize the
pharmacological properties of oatp2-mediated taurocholate uptake, we
next examined the effects of other compounds (200 µM) on
[3H]taurocholate (1 µM) uptake.
Taurocholate, cholate, BSP, and 17-estradiol glucuronide
significantly inhibited [3H]taurocholate uptake (data not
shown), whereas p-aminohippuric acid did not. These results
are comparable to those obtained with oatp1 (16) and to those reported
by Noé et al. (8). In addition, T4 and
T3 also significantly inhibited oatp2-mediated
[3H]taurocholate incorporation (data not shown).
|
with gluconate (16.1 ± 0.06%) did not
insignificantly affect T4 uptake (p > 0.1). Thus, T4 transport by oatp2 is independent of
Na+ or Cl in the external medium.
|
Distribution of oatp2 and oatp3 mRNAs-- Relative levels of the oatp2 and oatp3 mRNAs were analyzed by Northern blot hybridization (Fig. 4, a and b). A single ~3.9-kilonucleotide oatp2 mRNA band was found in the brain, retina, and liver (Fig. 4a). No significant hybridization signals were observed in the heart, lung, and kidney. On the other hand, the analysis of oatp3 mRNA yielded two hybridization bands with estimated mRNA sizes of ~2.8 and ~3.9 kilonucleotides in the retina and kidney (Fig. 4b). The oatp3 mRNA expression level was less in the retina. The two different size oatp3 mRNAs are probably derived from the same gene because both bands were seen under high stringency filter washing conditions using the 3'-noncoding region that has <48% identity to any other organic anion transporter family member. A faint single band was also detected in the liver (~3.9 kilonucleotides). No obvious band was seen in other tissues. Identical oatp2 and oatp3 mRNA tissue distributions were also obtained using the rat Multiple tissue NorthernTM blots filter purchased from CLONTECH (data not shown).
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
This paper presents the characterization and tissue distribution of two cDNA clones encoding rat organic anion transporter subtypes oatp2 and oatp3 isolated from rat retina. The putative amino acid sequence of oatp3 was novel, whereas that of oatp2 was identical as recently reported (8). oatp3 is unique compared with other members of the organic anion transporter family in its tissue distribution.
Both oatp2 and oatp3 appear to be responsible for transporting organic
anions and thyroid hormones for the following reasons. First, the
expression experiments with oatp2 and oatp3 using Xenopus oocytes showed that both oatp2 and oatp3 transport
[3H]taurocholate. oatp2 transports taurocholate with a
Km value similar to that reported (35.2 ± 8.9 versus 34 µM) (8). The oatp3 cRNA-injected
oocytes also transported [3H]taurocholate, but the
apparent Km value was half of that for oatp1- and
oatp2-mediated uptake (8). Second, a series of
cis-inhibition studies on the oatp2-expressing oocytes
showed that the oatp2-mediated uptake of [3H]taurocholate
was markedly inhibited by the addition of taurocholate, cholate, BSP,
or 17-estradiol glucuronide as well as T4 and
T3. The oatp3-mediated taurocholate uptake was also
inhibited by BSP. Third, the oatp2- and oatp3-expressing oocytes
facilitated the uptake of thyroid hormones (T4 and
T3) with simple Michaelis-Menten kinetics, and the apparent
Km values are comparable to each other. Fourth,
Northern blot analysis showed that the oatp2 mRNA is distributed in
the brain, retina, and liver. The oatp3 mRNA is exclusively
expressed in the retina and kidney. On the other hand, the oatp1
mRNA is expressed in the liver, kidney, brain, skeletal muscle, and
colon (3). Finally, in situ hybridization analysis indicated
that the oatp2 mRNA is widely distributed in neuronal cells of many
brain regions as well as in the choroid plexus.
This is the first report identifying the molecules responsive for transporting thyroid hormones across cell membrane. The transport of thyroid hormones across the plasma membrane determines the intracellular concentration of these hormones and hence the activation of the nuclear T3 receptor. The existence of mechanisms regulating the transport of thyroid hormones has been suggested in cerebrocortical neurons (17), astrocytes (18), glial cells (19), hepatocytes (20, 21), erythrocytes (22), and skeletal muscle (23). The following are comparisons of the pharmacological characteristics among oatp2, oatp3, and the known native thyroid hormone transporters.
The Km values for T4 and T3 of oatp2 and oatp3 were similar to those for neural cells (19) and hepatocytes (21), but 10-fold higher than those reported by Chantoux et al. (17) and Blondeau et al. (20). We do not know what accounts for these differences. In our study, the oatp2-mediated uptake of T4 was not dependent on extracellular Na+, whereas the transporting mechanisms of thyroid hormones are heterogeneous in Na+ dependence: Na+-dependent (21), Na+-independent (19, 20, 24) and mixed (18, 23). In addition, it has been reported that oocytes injected with rat liver poly(A)+ RNA showed Na+-dependent uptake of T4 and T3 (25); however, the functional fraction size is different from that of the oatp2 or oatp3 mRNA. Therefore, the molecules responsible for transporting thyroid hormones are suggested to be heterogeneous.
The uptake of thyroid hormones in the native tissues appears to be inhibited by a variety of structurally unrelated drugs, including non-bile acid cholephils such as BSP, nonsteroidal anti-inflammatory drugs (20, 24), diphenylhydantoin (26), and propranolol (27). In our study, the oatp2-mediated uptake of taurocholate was inhibited by some of these compounds, but no oatp3-mediated uptake was found for tryptophan, phenylalanine, tyrosine, and indomethacin. In the oatp1-expressing mammalian cells, T4 did not exhibit a cis-inhibitory effect for BSP uptake (28). Thus, further investigations will be required to understand the role and functions of the other members of the organic anion transporter family.
The oatp2 mRNA is distributed exclusively in the brain, retina, and liver. In the central nervous system, most of the nuclear T3 is derived from local T4 deiodination (29). However, most of the intracellular T3 in the liver and muscle is derived from plasma (30). Accordingly, the abundant expression of the oatp2 mRNA in the brain and liver implies that this molecule should regulate the availability of thyroid hormone in these tissues. Thyroid hormones also play an essential role in neural function of the mammalian central nervous system, particularly during a critical period of its development (31, 32). The absence of thyroid hormone causes serious damages to structural development and organization of the brain (especially the hippocampus and cerebellum), including biochemical maturation, and leads to irreversible mental retardation (33).
In the hippocampus, the oatp2 mRNA is predominantly expressed in the pyramidal cells of CA1-4 and in the granule cells of the dentate gyrus. In the cerebellum, the oatp2 mRNA is highly expressed in Purkinje cells. The prominent expression of the oatp2 mRNA in these thyroid hormone-sensitive neurons further suggests that oatp2 may play a critical role in neuronal development and maintaining cell function.
oatp2 mRNA was also moderately distributed in the choroid plexus. This is consistent with the notion that thyroid hormones are transported into the brain via the blood-brain barrier (9) or via the choroid plexus (10). In situ hybridization of rat oatp1 revealed that rat oatp1 mRNA is also expressed in the choroid plexus (34). Although the probe for rat oatp1 (positions 2031-2090) is 80~95% identical among organic anion transporter family members, the probe only detected signals in the choroid plexus. In our experiments, to avoid the nonspecific signals, we used the 900-bp 3'-noncoding region that has <48% identity to any organic anion transporter family. Thus, it seems likely that at least two organic anion transporter family subtypes are coexpressed in the choroid plexus: oatp1, which mediates BSP uptake that is not inhibited by T4 (28); and oatp2, which transports thyroid hormones.
Noé et al. (8) also showed that the oatp2 mRNA is
highly expressed in the brain, liver, and kidney. However, in our
experiment, no oatp2 expression was detected in the kidney. This
discrepancy in the Northern blot analysis may be also attributed to the
different nucleotide regions of the probe. We used the 3'-noncoding
region of oatp2 that has <48% identity to oatp1, OAT-K1, and oatp3.
On the other hand, Noé et al. (8) used nucleotides
1-360, which has >80% identity to oatp1 (82%) and OAT-K1 (87%). In
their report, the size of the major band in the kidney was smaller than
that in the brain. It is possible that their probe cross-hybridized to
the other member of the organic anion transporter family,
e.g. oatp3 or OAT-K1. In addition, since the probes for
oatp3 clearly hybridized to the kidney mRNA, the mRNAs used
were not degenerate in our study. The same result was obtained using
the rat multiple-tissue Northern filter. In both cases, mRNA
qualities were confirmed by -actin (data not shown). Based on our
results, we suggest that the oatp2 mRNA is not expressed in the
kidney as much as shown for oatp2 (8).
The oatp3 mRNA is exclusively distributed in the kidney. Most of the T4 secreted from the thyroid is deiodinated in peripheral tissues. The liver and kidney are the major peripheral organs producing T3 from T4 (35). Thus, the specific expression of oatp3 mRNA in the kidney suggests an essential role for oatp3 in transporting thyroid hormones from the circulation to the deiodination sites in the kidney.
Individuals with Refetoff's syndrome, characterized by resistance to thyroid hormone, exhibit reduced clinical and biochemical activities of thyroid hormone action relative to the circulating hormone level (36). Several pathophysiological mechanisms have been suggested to account for the thyroid hormone resistance seen in Refetoff's syndrome patients. One possible mechanism is reduced hormone availability to tissues due to impaired thyroid hormone entry into cells (36). Accordingly, functional and genetic investigations of oatp2 and oatp3 may also help us to understand the etiology of such disorders and to aid in clinical diagnosis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Kazuo Nunoki and Akira Kobayashi for critical reading of the manuscript and Satoshi Sai for photographic assistance.
| |
FOOTNOTES |
|---|
* This work was supported in part by research grants from the Ministry of Education, Science, and Culture of Japan, the Yamanouchi Foundation for Research on Metabolic Disorders, the Mochida Memorial Foundation for Medical and Pharmaceutical Research, and the Inamori Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U95011 and AF041105.
§ Recipient of a long-term fellowship from Human Frontier Science Program Organization. To whom correspondence should be addressed: Dept. of Neurophysiology, Tohoku University School of Medicine, 2-1 Seiryo-cho, Aoba-ku, Sendai 980-8575, Japan. Tel.: 81-22-717-8153; Fax: 81-22-717-8154; E-mail: takaabe{at}mail.cc.tohoku.ac.jp.
The abbreviations used are: BSP, bromosulfophthalein; T4, thyroxineT3, 3,5,3'-triiodo-L-thyroninePCR, polymerase chain reactionbp, base pair(s).
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
-
Brightman, M. W.,
and Reese, T. S.
(1969)
J. Cell Biol.
40,
648-677
[Abstract/Free Full Text] -
Cserr, H. F.
(1971)
Physiol. Rev.
51,
273-311
[Free Full Text] -
Jacquemin, E.,
Hagenbuch, B.,
Stieger, B.,
Wolkoff, A. W.,
and Meier, P. J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
133-137
[Abstract/Free Full Text] -
Bossuyt, X.,
Müller, M.,
Hagenbuch, B.,
and Meier, P. J.
(1996)
J. Pharmacol. Exp. Ther.
276,
891-896
[Abstract/Free Full Text] -
Saito, H.,
Masuda, S.,
and Inui, K.
(1996)
J. Biol. Chem.
271,
20719-20725
[Abstract/Free Full Text] -
Kanai, N.,
Lu, R.,
Satriano, J. A.,
Bao, Y.,
Wolkoff, A. W.,
and Schuster, V. L.
(1995)
Science
268,
866-869
[Abstract/Free Full Text] - Hortz, J. A., Honscha, W., and Petzinger, E. (1996) Biochim. Biophys. Acta 1300, 114-118[Medline] [Order article via Infotrieve]
-
Noé, B.,
Hagenbuch, B.,
Stieger, B.,
and Meier, P. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
10346-10350
[Abstract/Free Full Text] -
Pardridge, W. M.
(1979)
Endocrinology
105,
605-612
[Abstract/Free Full Text] -
Southwell, B. R.,
Duan, W.,
Alcorn, D.,
Brack, C.,
Richardson, S. J.,
Köhrle, J.,
and Schreiber, G.
(1993)
Endocrinology
133,
2116-2126
[Abstract/Free Full Text] -
Cavallaro, T.,
Martone, R. L.,
Dwork, A. J.,
Schon, E. A.,
and Herbert, J.
(1990)
Invest. Ophthalmol. Visual Sci.
31,
497-501
[Abstract/Free Full Text] -
Abe, T.,
Sugihara, H.,
Nawa, H.,
Shigemoto, R.,
Mizuno, N.,
and Nakanishi, S.
(1992)
J. Biol. Chem.
267,
13361-13368
[Abstract/Free Full Text] - Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Kemp, B. E., and Pearson, R. B. (1990) Trends Biol. Sci. 15, 342-346[CrossRef]
-
Kennelly, P. J.,
and Krebs, E. G.
(1991)
J. Biol. Chem.
266,
15555-15558
[Free Full Text] - Kullak-Ublick, G.-A., Hagenbuch, B., Stieger, B., Wolkoff, A. W., and Meier, P. J. (1994) Hepatology 20, 411-416[CrossRef][Medline] [Order article via Infotrieve]
- Chantoux, F., Blondeau, J.-P., and Francon, J. (1995) J. Neurochem. 65, 2549-2554[Medline] [Order article via Infotrieve]
- Beslin, A., Chantoux, F., Blondeau, J.-P., and Francon, J. (1995) Endocrinology 136, 5385-5390[Abstract]
- Francon, J., Chantoux, F., and Blondeau, J.-P. (1989) J. Neurochem. 53, 1456-1463[Medline] [Order article via Infotrieve]
-
Blondeau, J.-P.,
Osty, J.,
and Francon, J.
(1988)
J. Biol. Chem.
263,
2685-2692
[Abstract/Free Full Text] - Krenning, E., Docter, R., Bernard, B., Visser, T., and Hennemann, G. (1981) Biochim. Biophys. Acta 676, 314-320[Medline] [Order article via Infotrieve]
-
Osty, J.,
Jego, L.,
Francon, J.,
and Blondeau, J.-P.
(1988)
Endocrinology
123,
2303-2311
[Abstract/Free Full Text] - Centanni, M., and Robbins, J. (1987) J. Clin. Invest. 80, 1068-1072
-
Topliss, D. J.,
Kolliniatis, E.,
Barlow, J. W.,
Lim, C.-F.,
and Stockigt, J. R.
(1989)
Endocrinology
124,
980-986
[Abstract/Free Full Text] -
Docter, R.,
Friesema, E. C. H.,
van Stralen, P. G. J.,
Krenning, E. P.,
Everts, M. E.,
Visser, T. J.,
and Hennemann, G.
(1997)
Endocrinology
138,
1841-1846
[Abstract/Free Full Text] -
Gingrich, S. A.,
Smith, P. J.,
Shapiro, L. E.,
and Surks, M. I.
(1985)
Endocrinology
116,
2306-2313
[Abstract/Free Full Text] - Krenning, E. P., Docter, R., Bernard, B., Visser, T., and Hennemann, G. (1982) FEBS Lett. 140, 229-233[CrossRef][Medline] [Order article via Infotrieve]
-
Kanai, N.,
Lu, R.,
Bao, Y.,
Wolkoff, A. W.,
and Schuster, V. L.
(1996)
Am. J. Physiol.
270,
F319-F325
[Abstract/Free Full Text] -
Crantz, F. R.,
Silvia, J. E.,
and Larsen, P. R.
(1982)
Endocrinology
110,
367-375
[Abstract/Free Full Text] - van Doorn, J., van der Heide, D., and Roelfsema, F. (1983) J. Clin. Invest. 72, 1778-1792
- Vincent, J., Legrand, C., Rabié, A., and Legrand, J. (1982-1983) J. Physiol. (Paris) 78, 729-738[Medline] [Order article via Infotrieve]
- Dussault, J. H., and Ruel, J. (1987) Annu. Rev. Physiol. 49, 321-334[CrossRef][Medline] [Order article via Infotrieve]
-
Porterfield, S. P.,
and Hendrich, C. E.
(1993)
Endocr. Rev.
14,
94-106
[Abstract/Free Full Text] -
Angeletti, R. H.,
Novikoff, P. M.,
Juvvadi, S. R.,
Fritschy, J.-M.,
Meier, P. J.,
and Wolkoff, A. W.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
283-286
[Abstract/Free Full Text] - Berry, M. J., Banu, L., and Larsen, P. R. (1991) Nature 349, 438-440[CrossRef][Medline] [Order article via Infotrieve]
-
Refetoff, S.,
Weiss, R. E.,
and Usala, S. J.
(1993)
Endocr. Rev.
14,
348-399
[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. R. James, J. A. Franklyn, B. J. Reaves, V. E. Smith, S. Y. Chan, T. G. Barrett, M. D. Kilby, and C. J. McCabe Monocarboxylate Transporter 8 in Neuronal Cell Growth Endocrinology, April 1, 2009; 150(4): 1961 - 1969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. K. Pacyniak, X. Cheng, M. L. Cunningham, K. Crofton, C. D. Klaassen, and G. L. Guo The Flame Retardants, Polybrominated Diphenyl Ethers, Are Pregnane X Receptor Activators Toxicol. Sci., May 1, 2007; 97(1): 94 - 102. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Ding, K. Lichti, I. Kim, F. J. Gonzalez, and J. L. Staudinger Regulation of Constitutive Androstane Receptor and Its Target Genes by Fasting, cAMP, Hepatocyte Nuclear Factor {alpha}, and the Coactivator Peroxisome Proliferator-activated Receptor {gamma} Coactivator-1{alpha} J. Biol. Chem., September 8, 2006; 281(36): 26540 - 26551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont Selenium, the Thyroid, and the Endocrine System Endocr. Rev., December 1, 2005; 26(7): 944 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lowes, D. Sykes, C. M. Breen, L. J. Ragone, and D. S. Miller Multiple Components of 2,4-Dichlorophenoxyacetic Acid Uptake by Rat Choroid Plexus J. Pharmacol. Exp. Ther., October 1, 2005; 315(1): 136 - 143. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Cheng, J. Maher, C. Chen, and C. D. Klaassen TISSUE DISTRIBUTION AND ONTOGENY OF MOUSE ORGANIC ANION TRANSPORTING POLYPEPTIDES (OATPS) Drug Metab. Dispos., July 1, 2005; 33(7): 1062 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Reed, A. Purohit, L. W. L. Woo, S. P. Newman, and B. V. L. Potter Steroid Sulfatase: Molecular Biology, Regulation, and Inhibition Endocr. Rev., April 1, 2005; 26(2): 171 - 202. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wong, L. D. Lehman-McKeeman, M. F. Grubb, S. J. Grossman, V. M. Bhaskaran, E. G. Solon, H. S. L. Shen, R. J. Gerson, B. D. Car, B. Zhao, et al. Increased Hepatobiliary Clearance of Unconjugated Thyroxine Determines DMP 904-Induced Alterations in Thyroid Hormone Homeostasis in Rats Toxicol. Sci., April 1, 2005; 84(2): 232 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Shoji, H. Suzuki, H. Kusuhara, Y. Watanabe, S. Sakamoto, and Y. Sugiyama ATP-dependent transport of organic anions into isolated basolateral membrane vesicles from rat intestine Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G749 - G756. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tohyama, H. Kusuhara, and Y. Sugiyama Involvement of Multispecific Organic Anion Transporter, Oatp14 (Slc21a14), in the Transport of Thyroxine across the Blood-Brain Barrier Endocrinology, September 1, 2004; 145(9): 4384 - 4391. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sykes, D. H. Sweet, S. Lowes, S. K. Nigam, J. B. Pritchard, and D. S. Miller Organic anion transport in choroid plexus from wild-type and organic anion transporter 3 (Slc22a8)-null mice Am J Physiol Renal Physiol, May 1, 2004; 286(5): F972 - F978. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Mikkaichi, T. Suzuki, T. Onogawa, M. Tanemoto, H. Mizutamari, M. Okada, T. Chaki, S. Masuda, T. Tokui, N. Eto, et al. Isolation and characterization of a digoxin transporter and its rat homologue expressed in the kidney PNAS, March 9, 2004; 101(10): 3569 - 3574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hasannejad, M. Takeda, K. Taki, H. J. Shin, E. Babu, P. Jutabha, S. Khamdang, M. Aleboyeh, M. L. Onozato, A. Tojo, et al. Interactions of Human Organic Anion Transporters with Diuretics J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 1021 - 1029. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ito, K. Yamaguchi, H. Tomita, T. Suzuki, T. Onogawa, T. Sato, H. Mizutamari, T. Mikkaichi, T. Nishio, T. Suzuki, et al. Distribution of Rat Organic Anion Transporting Polypeptide-E (oatp-E) in the Rat Eye Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4877 - 4884. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sugiyama, H. Kusuhara, H. Taniguchi, S. Ishikawa, Y. Nozaki, H. Aburatani, and Y. Sugiyama Functional Characterization of Rat Brain-specific Organic Anion Transporter (Oatp14) at the Blood-Brain Barrier: HIGH AFFINITY TRANSPORTER FOR THYROXINE J. Biol. Chem., October 31, 2003; 278(44): 43489 - 43495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Beery, P. Middel, A. Bahn, H. S. Willenberg, Y. Hagos, H. Koepsell, S. R. Bornstein, G. A. Muller, G. Burckhardt, and J. Steffgen Molecular Evidence of Organic Ion Transporters in the Rat Adrenal Cortex with Adrenocorticotropin-Regulated Zonal Expression Endocrinology, October 1, 2003; 144(10): 4519 - 4526. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Suzuki, T. Onogawa, N. Asano, H. Mizutamari, T. Mikkaichi, M. Tanemoto, M. Abe, F. Satoh, M. Unno, K. Nunoki, et al. Identification and Characterization of Novel Rat and Human Gonad-Specific Organic Anion Transporters Mol. Endocrinol., July 1, 2003; 17(7): 1203 - 1215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Trauner and J. L. Boyer Bile Salt Transporters: Molecular Characterization, Function, and Regulation Physiol Rev, April 1, 2003; 83(2): 633 - 671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. Sweet, L. M. S. Chan, R. Walden, X.-P. Yang, D. S. Miller, and J. B. Pritchard Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient Am J Physiol Renal Physiol, April 1, 2003; 284(4): F763 - F769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ohtsuki, T. Takizawa, H. Takanaga, N. Terasaki, T. Kitazawa, M. Sasaki, T. Abe, K.-i. Hosoya, and T. Terasaki In Vitro Study of the Functional Expression of Organic Anion Transporting Polypeptide 3 at Rat Choroid Plexus Epithelial Cells and Its Involvement in the Cerebrospinal Fluid-to-Blood Transport of Estrone-3-Sulfate Mol. Pharmacol., March 1, 2003; 63(3): 532 - 537. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Leazer and C. D. Klaassen The Presence of Xenobiotic Transporters in Rat Placenta Drug Metab. Dispos., February 1, 2003; 31(2): 153 - 167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. B. Goralski, G. Lou, M. T. Prowse, V. Gorboulev, C. Volk, H. Koepsell, and D. S. Sitar The Cation Transporters rOCT1 and rOCT2 Interact with Bicarbonate but Play Only a Minor Role for Amantadine Uptake into Rat Renal Proximal Tubules J. Pharmacol. Exp. Ther., December 1, 2002; 303(3): 959 - 968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Peeters, E. C. H. Friesema, R. Docter, G. Hennemann, and T. J. Visser Effects of thyroid state on the expression of hepatic thyroid hormone transporters in rats Am J Physiol Endocrinol Metab, December 1, 2002; 283(6): E1232 - E1238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Khamdang, M. Takeda, R. Noshiro, S. Narikawa, A. Enomoto, N. Anzai, P. Piyachaturawat, and H. Endou Interactions of Human Organic Anion Transporters and Human Organic Cation Transporters with Nonsteroidal Anti-Inflammatory Drugs J. Pharmacol. Exp. Ther., November 1, 2002; 303(2): 534 - 539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Pizzagalli, B. Hagenbuch, B. Stieger, U. Klenk, G. Folkers, and P. J. Meier Identification of a Novel Human Organic Anion Transporting Polypeptide as a High Affinity Thyroxine Transporter Mol. Endocrinol., October 1, 2002; 16(10): 2283 - 2296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kato, K. Kuge, H. Kusuhara, P. J. Meier, and Y. Sugiyama Gender Difference in the Urinary Excretion of Organic Anions in Rats J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 483 - 489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Takeda, S. Khamdang, S. Narikawa, H. Kimura, M. Hosoyamada, S. H. Cha, T. Sekine, and H. Endou Characterization of Methotrexate Transport and Its Drug Interactions with Human Organic Anion Transporters J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 666 - 671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. Sweet, D. S. Miller, J. B. Pritchard, Y. Fujiwara, D. R. Beier, and S. K. Nigam Impaired Organic Anion Transport in Kidney and Choroid Plexus of Organic Anion Transporter 3 (Oat3 (Slc22a8)) Knockout Mice J. Biol. Chem., July 19, 2002; 277(30): 26934 - 26943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Enomoto, M. Takeda, M. Shimoda, S. Narikawa, Y. Kobayashi, Y. Kobayashi, T. Yamamoto, T. Sekine, S. H. Cha, T. Niwa, et al. Interaction of Human Organic Anion Transporters 2 and 4 with Organic Anion Transport Inhibitors J. Pharmacol. Exp. Ther., June 1, 2002; 301(3): 797 - 802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Guo, J. Staudinger, K. Ogura, and C. D. Klaassen Induction of Rat Organic Anion Transporting Polypeptide 2 by Pregnenolone-16alpha -carbonitrile Is via Interaction with Pregnane X Receptor Mol. Pharmacol., April 1, 2002; 61(4): 832 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Cai, W. Wang, C. J. Soroka, N. Ballatori, and J. L. Boyer An evolutionarily ancient Oatp: insights into conserved functional domains of these proteins Am J Physiol Gastrointest Liver Physiol, April 1, 2002; 282(4): G702 - G710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Guo, D. R. Johnson, and C. D. Klaassen Postnatal Expression and Induction by Pregnenolone-16alpha -Carbonitrile of the Organic Anion-Transporting Polypeptide 2 in Rat Liver Drug Metab. Dispos., March 1, 2002; 30(3): 283 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ito, K. Yamaguchi, T. Onogawa, M. Unno, T. Suzuki, T. Nishio, T. Suzuki, H. Sasano, T. Abe, and M. Tamai Distribution of Organic Anion-Transporting Polypeptide 2 (oatp2) and oatp3 in the Rat Retina Invest. Ophthalmol. Vis. Sci., March 1, 2002; 43(3): 858 - 863. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yamada, M. Yoshikawa, S. Kanda, Y. Kato, Y. Nakajima, S. Ishizaka, and Y. Tsunoda In Vitro Differentiation of Embryonic Stem Cells into Hepatocyte-Like Cells Identified by Cellular Uptake of Indocyanine Green Stem Cells, March 1, 2002; 20(2): 146 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sugiyama, H. Kusuhara, Y. Shitara, T. Abe, and Y. Sugiyama Effect of 17beta -Estradiol-D-17beta -Glucuronide on the Rat Organic Anion Transporting Polypeptide 2-Mediated Transport Differs Depending on Substrates Drug Metab. Dispos., February 1, 2002; 30(2): 220 - 223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Gao, A. Wenzel, C. Grimm, S. R. Vavricka, D. Benke, P. J. Meier, and C. E. Reme Localization of Organic Anion Transport Protein 2 in the Apical Region of Rat Retinal Pigment Epithelium Invest. Ophthalmol. Vis. Sci., February 1, 2002; 43(2): 510 - 514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. A. R. Neves, R. R. Cavalieri, L. A. Simeoni, D. G. Gardner, J. D. Baxter, B. F. Scharschmidt, N. Lomri, and R. C. J. Ribeiro Thyroid Hormone Export Varies among Primary Cells and Appears to Differ from Hormone Uptake Endocrinology, February 1, 2002; 143(2): 476 - 483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Guo, S. Choudhuri, and C. D. Klaassen Induction Profile of Rat Organic Anion Transporting Polypeptide 2 (oatp2) by Prototypical Drug-Metabolizing Enzyme Inducers That Activate Gene Expression through Ligand-Activated Transcription Factor Pathways J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 206 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Gui, P. R. Dobner, and R. E. Carraway Endogenous neurotensin facilitates enterohepatic bile acid circulation by enhancing intestinal uptake in rats Am J Physiol Gastrointest Liver Physiol, December 1, 2001; 281(6): G1413 - G1422. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Lee, S. Dallas, M. Hong, and R. Bendayan Drug Transporters in the Central Nervous System: Brain Barriers and Brain Parenchyma Considerations Pharmacol. Rev., December 1, 2001; 53(4): 569 - 596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chillaron, R. Roca, A. Valencia, A. Zorzano, and M. Palacin Heteromeric amino acid transporters: biochemistry, genetics, and physiology Am J Physiol Renal Physiol, December 1, 2001; 281(6): F995 - F1018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Staudinger, Y. Liu, A. Madan, S. Habeebu, and C. D. Klaassen Coordinate Regulation of Xenobiotic and Bile Acid Homeostasis by Pregnane X Receptor Drug Metab. Dispos., November 1, 2001; 29(11): 1467 - 1472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Guo and C. D. Klaassen Protein Kinase C Suppresses Rat Organic Anion Transporting Polypeptide 1- and 2-Mediated Uptake J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 551 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Takeuchi, S. Masuda, H. Saito, T. Abe, and K.-i. Inui Multispecific Substrate Recognition of Kidney-Specific Organic Anion Transporters OAT-K1 and OAT-K2 J. Pharmacol. Exp. Ther., October 1, 2001; 299(1): 261 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. H. Friesema, R. Docter, E. P. C. M. Moerings, F. Verrey, E. P. Krenning, G. Hennemann, and T. J. Visser Thyroid Hormone Transport by the Heterodimeric Human System L Amino Acid Transporter Endocrinology, October 1, 2001; 142(10): 4339 - 4348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hennemann, R. Docter, E. C. H. Friesema, M. de Jong, E. P. Krenning, and T. J. Visser Plasma Membrane Transport of Thyroid Hormones and Its Role in Thyroid Hormone Metabolism and Bioavailability Endocr. Rev., August 1, 2001; 22(4): 451 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Nakai, R. Nakagomi, Y. Furuta, T. Tokui, T. Abe, T. Ikeda, and K. Nishimura Human Liver-Specific Organic Anion Transporter, LST-1, Mediates Uptake of Pravastatin by Human Hepatocytes J. Pharmacol. Exp. Ther., June 1, 2001; 297(3): 861 - 867. [Abstract] [Full Text]
|
|
|
|
|
|
K. Fujiwara, H. Adachi, T. Nishio, M. Unno, T. Tokui, M. Okabe, T. Onogawa, T. Suzuki, N. Asano, M. Tanemoto, et al. Identification of Thyroid Hormone Transporters in Humans: Different Molecules Are Involved in a Tissue-Specific Manner Endocrinology, May 1, 2001; 142(5): 2005 - 2012. [Abstract] [Full Text]
|
|
|
|
|
|
Y.-H. Han, Y. Kato, Y. Watanabe, K. Terao, Y. Asoh, and Y. Sugiyama Carrier-Mediated Hepatobiliary Transport of a Novel Antifolate, N-[4-[(2,4-Diamminopteridine-6-yl)methyl]-3,4-dihydro-2H-1,4-benzothiazin-7-yl]carbonyl-L-Homoglutamic Acid, in Rats Drug Metab. Dispos., April 1, 2001; 29(4): 394 - 400. [Abstract] [Full Text]
|
|
|
|
|
|
J. W. A. Ritchie, C. J. F. Collingwood, and P. M. Taylor Effect of hypothyroidism on pathways for iodothyronine and tryptophan uptake into rat adipocytes Am J Physiol Endocrinol Metab, February 1, 2001; 280(2): E254 - E259. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Buettner, J. W. Harney, and P. R. Larsen The Role of Selenocysteine 133 in Catalysis by the Human Type 2 Iodothyronine Deiodinase Endocrinology, December 1, 2000; 141(12): 4606 - 4612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. C. Walters, A. L. Craddock, H. Fusegawa, M. C. Willingham, and P. A. Dawson Expression, transport properties, and chromosomal location of organic anion transporter subtype 3 Am J Physiol Gastrointest Liver Physiol, December 1, 2000; 279(6): G1188 - G1200. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wada, M. Tsuda, T. Sekine, S. H. Cha, M. Kimura, Y. Kanai, and H. Endou Rat Multispecific Organic Anion Transporter 1 (rOAT1) Transports Zidovudine, Acyclovir, and Other Antiviral Nucleoside Analogs J. Pharmacol. Exp. Ther., September 1, 2000; 294(3): 844 - 849. [Abstract] [Full Text]
|
|
|
|
|
|
L. Li, P. J. Meier, and N. Ballatori Oatp2 Mediates Bidirectional Organic Solute Transport: A Role for Intracellular Glutathione Mol. Pharmacol., August 1, 2000; 58(2): 335 - 340. [Abstract] [Full Text]
|
|
|
|
|
|
R. A. M. H. Van Aubel, R. Masereeuw, and F. G. M. Russel Molecular pharmacology of renal organic anion transporters Am J Physiol Renal Physiol, August 1, 2000; 279(2): F216 - F232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. B. Rosso, A. O. Caceres, A. M. E. de Duffard, R. O. Duffard, and S. Quiroga 2,4-Dichlorophenoxyacetic Acid Disrupts the Cytoskeleton and Disorganizes the Golgi Apparatus of Cultured Neurons Toxicol. Sci., July 1, 2000; 56(1): 133 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Takeuchi, S. Masuda, H. Saito, Y. Hashimoto, and K.-i. Inui Trans-Stimulation Effects of Folic Acid Derivatives on Methotrexate Transport by Rat Renal Organic Anion Transporter, OAT-K1 J. Pharmacol. Exp. Ther., June 1, 2000; 293(3): 1034 - 1039. [Abstract] [Full Text]
|
|
|
|
|
|
H. Kouzuki, H. Suzuki, B. Stieger, P. J. Meier, and Y. Sugiyama Characterization of the Transport Properties of Organic Anion Transporting Polypeptide 1 (oatp1) and Na+/Taurocholate Cotransporting Polypeptide (Ntcp): Comparative Studies on the Inhibitory Effect of their Possible Substrates in Hepatocytes and cDNA-Transfected COS-7 Cells J. Pharmacol. Exp. Ther., February 1, 2000; 292(2): 505 - 511. [Abstract] [Full Text]
|
|
|
|
|
|
J. S. Glavy, S. M. Wu, P. J. Wang, G. A. Orr, and A. W. Wolkoff Down-regulation by Extracellular ATP of Rat Hepatocyte Organic Anion Transport Is Mediated by Serine Phosphorylation of Oatp1 J. Biol. Chem., January 14, 2000; 275(2): 1479 - 1484. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Konig, Y. Cui, A. T. Nies, and D. Keppler A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane Am J Physiol Gastrointest Liver Physiol, January 1, 2000; 278(1): G156 - G164. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Hsiang, Y. Zhu, Z. Wang, Y. Wu, V. Sasseville, W.-P. Yang, and T. G. Kirchgessner A Novel Human Hepatic Organic Anion Transporting Polypeptide (OATP2). IDENTIFICATION OF A LIVER-SPECIFIC HUMAN ORGANIC ANION TRANSPORTING POLYPEPTIDE AND IDENTIFICATION OF RAT AND HUMAN HYDROXYMETHYLGLUTARYL-CoA REDUCTASE INHIBITOR TRANSPORTERS J. Biol. Chem., December 24, 1999; 274(52): 37161 - 37168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Gao, B. Stieger, B. Noé, J.-M. Fritschy, and P. J. Meier Localization of the Organic Anion Transporting Polypeptide 2 (Oatp2) in Capillary Endothelium and Choroid Plexus Epithelium of Rat Brain J. Histochem. Cytochem., October 1, 1999; 47(10): 1255 - 1264. [Abstract] [Full Text]
|
|
|
|
|
|
J. E. van Montfoort, B. Hagenbuch, K. E. Fattinger, M. Müller, G. M. M. Groothuis, D. K. F. Meijer, and P. J. Meier Polyspecific Organic Anion Transporting Polypeptides Mediate Hepatic Uptake of Amphipathic Type II Organic Cations J. Pharmacol. Exp. Ther., October 1, 1999; 291(1): 147 - 152. [Abstract] [Full Text]
|
|
|
|
|
|
B. S. Chan, J. A. Satriano, and V. L. Schuster Mapping the Substrate Binding Site of the Prostaglandin Transporter PGT by Cysteine Scanning Mutagenesis J. Biol. Chem., September 3, 1999; 274(36): 25564 - 25570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Akhteruzzaman, Y. Kato, H. Kouzuki, H. Suzuki, A. Hisaka, B. Stieger, P. J. Meier, and Y. Sugiyama Carrier-Mediated Hepatic Uptake of Peptidic Endothelin Antagonists in Rats J. Pharmacol. Exp. Ther., September 1, 1999; 290(3): 1107 - 1115. [Abstract] [Full Text]
|
|
|
|
|
|
T. Cihlar, D. C. Lin, J. B. Pritchard, M. D. Fuller, D. B. Mendel, and D. H. Sweet The Antiviral Nucleotide Analogs Cidofovir and Adefovir Are Novel Substrates for Human and Rat Renal Organic Anion Transporter 1 Mol. Pharmacol., September 1, 1999; 56(3): 570 - 580. [Abstract] [Full Text]
|
|
|
|
 |
|
 N. Strazielle and J.-F. Ghersi-Egea Demonstration of a Coupled Metabolism-Efflux Process at the Choroid Plexus as a Mechanism of Brain Protection Toward Xenobiotics J. Neurosci., August 1, 1999; 19(15): 6275 - 6289. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-i. Nishino, H. Suzuki, D. Sugiyama, T. Kitazawa, K. Ito, M. Hanano, and Y. Sugiyama Transepithelial Transport of Organic Anions across the Choroid Plexus: Possible Involvement of Organic Anion Transporter and Multidrug Resistance-Associated Protein J. Pharmacol. Exp. Ther., July 1, 1999; 290(1): 289 - 294. [Abstract] [Full Text]
|
|
|
|
|
|
T. Abe, M. Kakyo, T. Tokui, R. Nakagomi, T. Nishio, D. Nakai, H. Nomura, M. Unno, M. Suzuki, T. Naitoh, et al. Identification of a Novel Gene Family Encoding Human Liver-specific Organic Anion Transporter LST-1 J. Biol. Chem., June 11, 1999; 274(24): 17159 - 17163. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Brent Thyroid hormone action: down novel paths Focus on "Thyroid hormone induces activation of mitogen-activated protein kinase in cultured cells" Am J Physiol Cell Physiol, May 1, 1999; 276(5): C1012 - C1013. [Full Text] [PDF]
|
|
|
|
|
|
U. Eckhardt, A. Schroeder, B. Stieger, M. Hochli, L. Landmann, R. Tynes, P. J. Meier, and B. Hagenbuch Polyspecific substrate uptake by the hepatic organic anion transporter Oatp1 in stably transfected CHO cells Am J Physiol Gastrointest Liver Physiol, April 1, 1999; 276(4): G1037 - G1042. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Masuda, K. Ibaramoto, A. Takeuchi, H. Saito, Y. Hashimoto, and K.-I. Inui Cloning and Functional Characterization of a New Multispecific Organic Anion Transporter, OAT-K2, in Rat Kidney Mol. Pharmacol., April 1, 1999; 55(4): 743 - 752. [Abstract] [Full Text]
|
|
|
|
|
|
J. Konig, Y. Cui, A. T. Nies, and D. Keppler Localization and Genomic Organization of a New Hepatocellular Organic Anion Transporting Polypeptide J. Biol. Chem., July 21, 2000; 275(30): 23161 - 23168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kawaji, C. Schonbach, Y. Matsuo, J. Kawai, Y. Okazaki, Y. Hayashizaki, and H. Matsuda Exploration of Novel Motifs Derived from Mouse cDNA Sequences Genome Res., March 1, 2002; 12(3): 367 - 378. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |