INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

Cryopreservation provides an excellent way of preserving living cells and storing them and has found wide application in medicine, agriculture, and food technology. However, the processes of freezing and thawing cause severe stress to cells and can lead to loss of viability. There is, therefore, a need to understand the molecular mechanisms that underlie freeze-thaw damage and how cells survive it or respond to prevent it. A number of hypotheses have been proposed to explain the damage caused by freezing and thawing; these are based on an analysis of the physical and chemical changes that occur. For example, cells are known to be damaged by physical changes associated with ice nucleation and dehydration (1). They can also be affected by accompanying changes in intracellular osmolarity and pH which lead to aggregation of macromolecules (2) and denaturation of proteins (3, 4). Oxidative damage has also been considered to be a factor since an oxidative burst has been predicted to occur during thawing (5), and this would lead to the generation of reactive oxygen species (ROS)¹ and oxidative damage to cellular components. This is supported by the observation that antioxidant defense systems of reptiles are activated by freezing stress (5) and that overexpression of superoxide dismutase enhances the freezing tolerance of transgenic Alfalfa (6). Moreover we have shown that yeast cells can become more resistant to freeze-thaw damage following treatment with a dose of hydrogen peroxide that causes cells to adapt to further peroxide stress (7). Here we examine the extent to which oxidative damage occurs during freezing and thawing of cells and directly demonstrate the generation of ROS.

ROS are generated as an unavoidable side reaction in living systems that rely on oxygen as the terminal electron acceptor during energy generation. One primary product of electron leakage from the respiratory chain is the superoxide anion (O₂) generated by the one-electron reduction of O₂ (8, 9). This can also be formed from other enzymatic systems including xanthine oxidase or NADPH oxidase (8). The superoxide anion disturbs the redox balance of cells by reducing and releasing metal ions from metal ion-clustered proteins or is converted to other ROS including the peroxy radical (HO₂) or H₂O₂ (10, 11). Reduced metal ions and H₂O₂ undergo the Fenton reaction generating one of the most reactive ROS, the hydroxyl radical (^·OH). These ROS damage cells by reacting with many cellular molecules including proteins, lipids, and DNA (12, 13). The generation of ROS is accelerated as an oxidative burst following ischemia and reoxygenation since this stimulates the conversion of dehydrogenases to oxidases and the introduction of excess O₂ in the cell cytoplasm (14). Freezing and thawing may form an analogous situation since cells are isolated from O₂ following freezing and are re-oxygenated during thawing. This may be augmented by the attendant dehydration and rehydration processes that result from the balancing of vapor pressure between intra- and extracellular ice systems during freezing and thawing (1).

Cells contain various enzymatic and non-enzymatic systems for detoxifying ROS (15-17). One main defense system is provided by superoxide dismutases that convert O₂ to H₂O₂ (18, 19) which is then disproportionated to water by catalases or peroxidases (20). Yeast has two types of superoxide dismutase (SOD). The Cu,Zn-SOD encoded by the SOD1 gene is located in the cytoplasm; its level is constitutively high (about 1% of soluble protein in the cell) during fermentation and respiration (19). The Mn-SOD encoded by SOD2 is located in the mitochondrial matrix, and from a low level in fermentative cells it is induced during respiration (19) or starvation (21). Other systems found in yeast include the cytoplasmic catalase encoded by CTT1, the peroxisomal catalase encoded by CTA1 (20), and the glutathione-based systems including glutathione itself and various peroxidases (22).

Here we have exploited the availability of mutations affecting oxidative stress response systems in the yeast Saccharomyces cerevisiae to characterize the nature and extent of oxidative stress encountered by cells during freezing and thawing. The mutations used included those in CTA1, CTT1, SOD1, SOD2, and YAP1 which encodes a transcriptional activator required for stress-induced expression of several oxidative defense genes (13, 23), GSH1 which encodes -glutamylcysteine synthetase, and GLR1 encoding glutathione reductase (22). Cu,Zn-SOD and Mn-SOD were found to be involved in the recovery of cells from freeze-thaw injury, and this enabled an indication of the nature of the major species causing oxidative stress damage and where this damage occurred in the cells. The role of SODs in the process was further analyzed using mutations affecting mitochondrial activity, and the free radicals generated during freeze-thaw injury in wild-type and sod mutants have been detected and characterized using electron paramagnetic resonance (EPR) spectroscopy.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

Strains and Culture Condition-- 190 Yeast strains used are described in Table I. The rho⁰ respiratory-deficient strains, 1783rho⁰ and KS105rho⁰, were generated by treating 1783 and KS105 with ethidium bromide (24). The gsh1 deletion mutant, JL-3, which was provided by J.-C. Lee (this laboratory) was isogenic to the wild-type strain, CY4 (25, 26). Strains deleted for the various antioxidant genes were made using the cta1::URA3 and ctt1::URA3 deletion plasmids donated by A. Hartig (Vienna) and the yap1::HIS3 deletion plasmid donated by W. S. Moye-Rowley (23).

Plasmid Construction and Yeast Transformation-- Molecular techniques were carried out as described (28, 29). The SOD1 gene was isolated by polymerase chain reaction amplification of total yeast DNA with specific oligonucleotides (TCTCTCGCTGAACTTGTCCTTACC and GTGTTCCCTTTCTTGGTGTCTGTC), and from this a SacI/StuI cut fragment containing 722 bp of upstream untranslated region and 872 bp of coding and downstream untranslated region was cloned into the SacI/SmaI cut pRS425 vector (30). The plasmid pYEUMn (21) containing the intact SOD2 gene in YEp13 was used for overexpression. The intact CTT1 gene donated by H. Ruis was recloned into the BamHI/ClaI site of the pRS426 vector (30). The SOD2::lacZ fusion construct containing 558 bp of upstream untranslated region of SOD2 and 235 bp of coding sequence has been described (21). Yeast transformation was performed using the lithium acetate method (31). Integrative plasmids were linearized by cleavage at the StuI site within the URA3 gene prior to transformation. Correct single copy integration was checked by Southern blot analysis (data not shown). Transformants of sod1 mutant strain were maintained anaerobically as described above.

-Galactosidase Assays-- Assays for -galactosidase were carried out using o-nitrophenyl--D-galactose (ONPG) as substrate as described previously (32). Specific activity is expressed as nanomoles of ONPG hydrolyzed per min¹ mg¹ protein. Protein concentrations were measured by the Bio-Rad assay method as indicated by the manufacturer. All determinations were the average of three independent experiments.

Freezing and Thawing Conditions-- Cells were harvested by centrifugation and washed in 0.1 M sodium phosphate buffer (pH 7.0) and suspended to an A₆₀₀ of 3 in the same buffer. Aliquots (0.3 ml) of cells were transferred into thin-walled 1.5-ml polycarbonate tubes (Greiner Labortechnik) and frozen at 20 °C for times indicated and then thawed at 4 °C for 40 min as described previously (7). Survival was determined by diluting cells into YEPD medium at room temperature and plating on YEPD plates. Data were determined in triplicate and the two-sample t test was done where appropriate. Cells were grown at 30 °C for 2 days before colony counting. Anaerobic freezing was performed as above except that the buffer used for freezing was deoxygenated by sparging with argon for 4 h before use.

Assay for Resistance to Paraquat (1,1-Dimethyl-4,4'-bipyridilium; Methyl Viologen)-- Cells cultured for 1 day were harvested and diluted to an A₆₀₀ of 0.1 in fresh YEPD medium. 5 µl of each diluted culture was spotted onto YEPD plates containing either 0.1 or 0.2 mM paraquat and subsequently incubated at 30 °C for the required length of time to visualize phenotypic difference.

MnCl₂ Pretreatment-- Cells were grown to an A₆₀₀ of 1 in YEPD medium at 30 °C under the low aeration culture condition. MnCl₂ was added to the culture to a final concentration of either 2 or 4 mM, and cells were cultured for 30 min before being subjected to the freeze-thaw process. MnCl₂ was removed by washing cells twice before freezing.

EPR Spectroscopy-- Cells at exponential growth phase (A₆₀₀ = 1) were harvested and washed in 0.1 M sodium phosphate buffer (pH 7.0). Cell density was determined by measuring optical density and by colony counting. Cells were then suspended to approximately 2×10⁹ cells/ml in 500 µl of the same buffer containing spin trap agents, either 50 mM -phenyl-N-tert-butylnitrone (PBN) or 100 mM 5,5-dimethyl-1-pyrroline-N-oxide (DMPO). Samples were frozen at 20 °C for 2 h and thawed as described above. Thawed samples were then either transferred to an EPR flat cell or extracted into toluene. Toluene extracts were bubbled with argon in cylindrical cells for 10 min prior to EPR measurement. The increase in amplitude with time of the EPR signal of the radicals was measured and expressed in arbitrary units per about 10⁹ cells. All EPR spectra were obtained with a Bruker EMX X-band spectrometer using field modulation 100.00 kHz and either a standard rectangular (ER 4102 ST) or cylindrical (ER 4103 TM) cavity. Typical EPR spectrometer settings were as follows: gain 2 × 10⁶ (DMPO) or 5 × 10⁶ (PBN), modulation amplitude 0.2 mT (DMPO) or 0.1 mT (PBN), conversion time 81 ms, time constant 81 ms (DMPO) or 163 ms (PBN), sweep time 83 s, center field 347.5 mT, field scan 8 mT, power 31 milliwatts (DMPO) or 50 milliwatts (PBN), frequency 9.722 GHz, temperature 294 K, with 8 scans averaged.

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Freeze-Thaw Injury Is Most Extensive in Mutants with Defective Cytoplasmic Cu,Zn-SOD-- We have previously shown that H₂O₂ pretreatment could induce freeze-thaw tolerance of yeast cells (7). Since such treatment induces cells to adapt to oxidative stress, this indicated that ROS generated during freezing and thawing may cause lethal damage to the cell. To test this hypothesis, and determine which oxidative stress response systems are involved in protecting cells from freeze-thaw damage, the tolerance of a range of mutants affected in various aspects of the oxidative stress response was examined. The mutants examined included those with null mutations in YAP1, GSH1, GLR1, CTA1, CTT1, SOD1, and SOD2, as well as the sod1 sod2 double mutant. YAP1 encodes a transcriptional activator of several genes involved in oxidative stress and detoxification of toxic compounds (13). GSH1 and GLR1 are responsible for producing and regenerating, respectively, the important antioxidant glutathione (22). CTA1 encodes the peroxisomal catalase A and CTT1 the yeast cytosolic catalase which scavenge H₂O₂ (20), whereas the SOD1 and SOD2 gene products are the superoxide dismutases that scavenge O₂ (18, 19). The freeze-thaw tolerance of each mutant was compared with its isogenic wild type after growth to the post-diauxic shift phase (48 h in YEPD) since wild-type cells have been shown to be more resistant in this phase (7). The mutants affected in the SOD genes showed a much greater sensitivity to freeze-thaw stress than their isogenic wild-type strain 1783, whereas the freeze-thaw sensitivity of the other oxidative stress mutants was much less affected relative to their wild-type strain CY4 (Fig. 1). This sensitivity was very apparent in the sod1 and sod1 sod2 double-mutant strains although the sod2, gsh1, and glr1 mutants were slightly more sensitive than their isogenic wild-type strains. Since the SOD1 gene product is located in the cytoplasm, this indicates that freeze-thaw damage to cells involves superoxide radicals rather than H₂O₂ or compounds for which glutathione-based defense systems are important and that prevention of the damage to cells is more dependent on the cytoplasmic Cu,Zn-SOD than the mitochondrial Mn-SOD.

View larger version (18K): [in this window] [in a new window]   Fig. 1.   Freeze-thaw resistance of oxidative mutants. Strains were grown on YEPD medium for 2 days, and freeze-thaw tolerance was determined by measuring viability after exposure to 20 °C. CY4 is the wild-type strain of CY7 (glr1), JL3 (gsh1), JY29 (yap1), JCA1 (cta1), and JCT1 (ctt1). 1783 is the wild-type strain of KS105 (sod1), JS001(sod1 sod2), and JS002 (sod2). Percentage survival is expressed relative to the culture viability immediately prior to freezing (%). Data shown are from triplicates from a representative experiment. Error bars represent the standard error of the measurements. Experiments were repeated at least 3 times with similar results.

View larger version (20K): [in this window] [in a new window]   Fig. 2.   MnCl2 pretreatment of the sod1 mutant rescues freeze-thaw sensitivity. Cells of strain 1783 and KS105 at early exponential growth phase (A600 of 1) were pretreated with either 2 or 4 mM MnCl2 for 30 min at 30°C prior to the freeze-thaw process. Freeze-thaw tolerance was determined by measuring viability after exposure to 20 °C. Percentage survival is expressed relative to the culture viability immediately prior to freezing (%). Data shown are means of triplicate experiments. Error bars represent the standard error of the means.

View larger version (22K): [in this window] [in a new window]   Fig. 3.   Overexpression of SOD1, SOD2, or CTT1 in the sod1 mutant. A, transformants were grown on SD medium for 2 days, and freeze-thaw tolerance was determined by measuring viability after exposure to 20 °C. Percentage survival is expressed relative to the culture viability immediately prior to freezing (%). Data shown are means of triplicate experiments. Error bars represent the standard error of the means (p value obtained for the double transformants was 0.022). Experiments were repeated at least twice. B, the resistance to paraquat of a 1-day culture of each transformant was determined by spotting 5 µl of each diluted fraction (A600 = 0.1) onto YEPD plates containing 0.2 mM paraquat. Experiments were repeated at least three times with similar results. A YEPD control plate showed similar growth of all strains in the absence of paraquat.

Superoxide Dismutase Is Required during the Freeze-Thaw Process-- To investigate whether freeze-thaw stress sensitivity of the sod mutants was due to the accumulated oxidative damage affecting cellular integrity, or to generation of O₂ during the freeze-thaw process, the sod mutants and the wild-type strain were grown under high or low aeration culture conditions, and changes in freeze-thaw tolerance of the cells were followed. If the freeze-thaw sensitivity of the sod mutants was due to the accumulated damage, then high aeration culture would decrease freezing tolerance by increased generation of ROS, and low aeration would do the opposite. Under low aeration conditions the wild-type strain and the sod mutants (except for the double-mutant) showed decreased freeze-thaw tolerance, whereas under high aeration all strains except for the double mutant showed an increase in freeze-thaw tolerance (Fig. 4). This indicated that the freeze-thaw sensitivity of the sod mutants was probably not due to the accumulation of oxidative damage during growth but was due to the lack of superoxide dismutase activity during the freeze-thaw process. High aeration may increase freeze-thaw tolerance by inducing the remaining superoxide dismutase activity in each of the singly mutant strains since this protection was not observed in the sod1 sod2 double mutant. This is addressed later. The general result led us to test the effect of the oxidative burst induced by the freeze-thaw process on cell survival.

View larger version (13K): [in this window] [in a new window]   Fig. 4.   The effect of aeration condition during culture on freeze-thaw stress resistance. Freeze-thaw tolerance of cells grown in YEPD under low (8/10 ml, ), medium (3/10 ml, ), and high (40/250 ml, ) aeration conditions was determined at each growth phase by measuring viability after exposure to 20 °C. A, wild-type 1783 strain; B, KS105 sod1 mutant; C, JS002 sod2 mutant; D, JS001 sod1 sod2 double mutant. Percentage survival is expressed relative to the culture viability immediately prior to freezing (%). Data shown are from triplicate measurements from a representative experiment. Error bars represent the standard error of the measurements. Experiments were repeated 3 times with similar results.

The Presence of Oxygen during Freeze-thaw Is Necessary for Damage to Cells-- Since the sensitivity of the sod mutants was probably due to decreased superoxide dismutase activity during the freeze-thaw process itself, we tested whether an oxygen-dependent oxidative burst occurs during the freezing and thawing. The generation of ROS, specifically O₂, is proportional to the amount of O₂ available, and the electrons leaked from the respiratory chain or other enzymatic reactions since the generation of O₂ is a first-order reaction with respect to the concentration of O₂ or the electrons leaked (37). Hence, we predicted that restricting the availability of O₂ should decrease generation of O₂, and this should rescue the sod mutant cells from damage if an oxidative burst occurs during the freeze-thaw process. We observed that freezing and thawing the cells anaerobically rescued the sod1 mutant which showed a similar level of freeze-thaw tolerance to that of the wild-type strain (Fig. 5A). This indicated that the freeze-thaw sensitivity of sod mutants is due to O₂ generated during an oxidative burst caused by the freeze-thaw process and raised the question of the mechanism by which O₂ is generated in cells during this process.

View larger version (20K): [in this window] [in a new window]   Fig. 5.   Oxygen and functional mitochondria are involved in freeze-thaw damage. The effects of oxygen in the freezing buffer or of mitochondrial activity on the freeze-thaw tolerance were tested by freezing and thawing cells aerobically or anaerobically in buffer deoxygenated with argon (A). Open symbols represent aerobic conditions and closed symbols anaerobic conditions. Circles indicate the KS105 sod1 mutant and squares the wild-type 1783. B, using respiratory-deficient (Rho0) cells. Open symbols represent grande strains and closed symbols the isogenic petite; the strains are as indicated above. Percentage survival is expressed relative to the culture viability immediately prior to freezing (%). Data shown are from triplicate measurements from a representative experiment. Error bars represent the standard error of the measurements. Experiments were repeated twice with similar results.

O₂ Is Generated Mainly from the Mitochondrial Respiratory Chain during the Oxidative Burst Caused by the Freeze-Thaw Process-- We investigated which cellular system is the main source of electrons to reduce O₂ supplied during the oxidative burst. Blocking or removing of cellular sources of electron leakage should also rescue cells from freeze-thaw damage. To see if the mitochondrial electron transport chain is the major site of electron leakage, we generated respiratory-incompetent strains (Rho⁰) of the wild-type and sod1 mutant strains since electron leakage from the mitochondria does not occur in a Rho⁰ petite (38). Once the sod1 mutant strain was made petite, it completely recovered freeze-thaw tolerance (Fig. 5B) indicating that the mitochondrial electron transport chain is the major site of electron leakage during the freeze-thaw process.

A Complementary Relationship Exists between Cytoplasmic Cu,Zn-SOD and Mitochondrial Mn-SOD-- The major site of electron leakage during the freeze-thaw process appears to be the mitochondrial electron transport chain. Since high aeration during culture induced freeze-thaw tolerance in the sod1 and sod2 mutants but not in the sod1 sod2 double mutant (Fig. 4), we assumed that a superoxide dismutase induced by the high aeration culture condition may complement the absence of its counterpart. Hence, we integrated into a wild-type strain a SOD2::lacZ reporter construct and determined the expression of SOD2 under low and high aeration conditions. The expression of SOD2::lacZ increased more than 2-fold by the high aeration condition (Fig. 6) indicating that an increase of SOD2 expression under high aeration may contribute to the increased freeze-thaw tolerance of the sod1 mutant. As indicated earlier, transforming the sod1 mutant with a high copy plasmid containing SOD2 conferred freeze-thaw tolerance on the mutant (Fig. 3A) as well as resistance to paraquat (Fig. 3B). These results also indicated that SOD2 overexpression protected cells from freeze-thaw and oxidative damage, and there is therefore an ability of mitochondrial Mn-SOD to compensate for a lack of the cytoplasmic Cu,Zn-SOD despite the difference in their cellular location.

View larger version (19K): [in this window] [in a new window]   Fig. 6.   SOD2::lacZ expression during culture under high or low aeration conditions. The levels of SOD2 expression in the 1783 wild-type strain were determined under high (40/250 ml, ) or low (8/10 ml, ) aeration conditions. Data shown are means of triplicate experiments. Error bars represent the standard error of the means. Open symbols represent A600 of culture.

Characterization of Radical Signals Generated by Freeze-Thaw Stress-- The data presented above clearly implicate O₂, or species arising from this radical, as damaging agents in freeze-thaw injury. In order to confirm the generation of radical intermediates during this process, EPR spectroscopy using the spin traps DMPO and PBN was employed, since this can directly detect radical species. Inclusion of DMPO in cell cultures subjected to a standard freeze-thaw cycle resulted in the detection of radical signals from both the sod1 sod2 and the sod1 mutant (Fig. 7; left) but not from the sod2 mutant or the wild-type cells subject to an identical treatment; no signals were observed in non-frozen control samples from any of these cells. The hyperfine coupling constant of the observed signal (a(N) = a(H) 1.49 mT) identifies this signal as being due to the species DMPO-OH. This species is known to arise via a number of different pathways including direct trapping of ^·OH, via trapping of O₂ and subsequent rapid decay of the DMPO-OOH adduct, as well as oxidation of the spin trap and subsequent hydration of the radical cation (37). Although the exact pathway that gives rise to this species cannot be ascertained with certainty from the available data, these results are in accord with the generation of free radical species in both the sod1 mutant and sod1 sod2 double mutant. Similar pathways may occur in the sod2 mutant or wild-type cells during freeze-thaw cycles, but the free radical burden is reduced by the Cu,Zn-SOD to low levels. There was no evidence for any type of cell producing detectable free radicals in the absence of freezing.

View larger version (41K): [in this window] [in a new window]   Fig. 7.   Generation of free radicals during freezing and thawing. Left, EPR spectra were observed on incubation of wild-type and mutant strains (109 in 500 µl) with the spin trap DMPO (100 mM) before (A) or after (B-E) a single freeze-thaw cycle (see "Experimental Procedures" for further details). A, 1783 wild-type strain not subjected to freezing and thawing; B, wild-type cells after freeze-thaw cycle; C, KS105 sod1 mutant after freeze-thaw cycle; D, JS002 sod2 mutant after freeze-thaw cycle; E, JS001 sod1 sod2 double mutant after freeze-thaw cycle. Signals in C and E are indicated by  assigned to DMPO-OH arising from either direct trapping of ·OH, decomposition of DMPO-OOH or oxidation of the spin trap (see text for further details). Fluctuation in the base line in each case is due to the broad metal ion absorptions. Right, same as left except using the spin trap PBN (50 mM). A,1783 wild-type strain not subjected to freezing and thawing; B, wild-type cells after freeze-thaw cycle; C, KS105 sod1 mutant after freeze-thaw cycle; D, JS002 sod2 mutant after freeze-thaw cycle; E, JS001 sod1 sod2 double mutant after freeze-thaw cycle. Signals indicated by  are assigned to a PBN spin trap adduct arising from trapping of a secondary radical (see text for further details); signals indicated by  are assigned to an oxidation product of the spin trap. Fluctuation in the base line in each case due to the broad metal ion absorptions.

	DISCUSSION

Top Abstract Introduction Procedures Results Discussion References

The results of this study show the involvement of Cu,Zn-SOD and Mn-SOD in the freeze-thaw stress survival of yeast cells. They confirm in a more direct way that oxidative stress is a cause of lethal damage to cells, as has been suggested in other systems (5, 6), and further show that the main damage in aerobic systems occurs in the cytoplasmic compartment and results from generation of O₂. Of all the genes involved in oxidative stress defense systems tested including GSH1, GLR1, YAP1, CTA1, CTT1, SOD1, and SOD2 the SOD genes, which scavenge mainly superoxides, were found to be more involved in the defense against the damage caused by freeze-thaw stress. GLR1, and GSH1, which regulate glutathione metabolism, are less involved during the freeze-thaw process since the deletion of these genes did not significantly affect freeze-thaw tolerance nor did overexpression of GSH1 or extracellular provision of glutathione (data not shown). The result with the yap1 mutant was surprising since yap1 mutants are sensitive to most other forms stress tested (13, 23, 40). The deletion of CTA1 or CTT1 did not affect freeze-thaw tolerance of yeast cells, indicating that H₂O₂ is not generated extensively or that absence of catalases can be compensated by other peroxidases in the cell (11). Taken together, these results highlight that the rapid removal of O₂ is the most important step for the oxidative defense of cells during freeze-thaw stress. These results need to be considered in the light of the fact that sod1 deletion strains have pleiotropic behavior with respect to gene regulation and other aspects of their physiology such as decreased invertase production, changes in the cell division cycle (19), and changes in divalent ions and metal ion homeostasis (50). However, the demonstration that the effects of the sod1 mutation can be reversed by removal of oxygen, the finding that MnCl₂ treatment also improves the freezing tolerance of the wild-type as well as of the sod1 mutant, and the direct demonstration of free radicals in cells following freezing and thawing indicate that oxidative damage due to free radical generation is a major component of freeze-thaw damage.

Since the sod1 mutant showed higher sensitivity to freeze-thaw stress than the sod2 mutant, it seems likely that the main lethal damage occurs in the cytoplasm. Where then does the O₂ originate? The reactivity of O₂ depends on its environment since it is relatively stable in a hydrophobic environment and can therefore continue to cause damage while it rapidly disappears in a hydrophilic environment (41); it is relatively less reactive than other ROS such as HO₂ or ^·OH in aqueous systems (11). Hence, whereas the oxidative damage during freeze-thaw stress may be initiated by O₂, it is not likely that all the subsequent effects in the cell are due directly to O₂, and some cell damage will also result from the secondary ROS which are formed spontaneously from O₂. Spontaneous disproportionation of O₂ into HO₂ (pK_a = 4.8) or H₂O₂ can occur, particularly at low pH (42, 43). Since we showed that O₂ appears to be generated largely by the mitochondrial respiratory chain, these disproportionation reactions may be possible due to a low pH maintained near the mitochondrial membrane by the proton gradient. Moreover, there are drastic changes in intracellular pH and osmolarity during freezing and thawing, which form an acidic intracellular environment (44).

The EPR spectroscopy showed that free radical species are generated by the freeze-thaw process and were consistent with O₂ formation initiating oxidative stress during the process. Although the use of the spin trap agent, DMPO, showed the presence of a signal from ^·OH in the sod1 and the sod1 sod2 double-mutant strains, this signal probably resulted from the spontaneous decomposition of DMPO-OOH adduct to DMPO-OH since O₂ is very unstable even after adduct formation. This has been seen when DMPO was used to detect the radical signals after menadione treatment (45). The spontaneous disproportionation of O₂ into H₂O₂ and subsequent generation of ^·OH by the Fenton reaction is unlikely since overexpression of CTT1 did not rescue the sod1 mutant from freeze-thaw stress or from oxidative stress caused by paraquat, indicating that in the absence of Cu,Zn-SOD spontaneous dismutation of O₂ into H₂O₂ does not occur efficiently. The use of another spin trap agent PBN, which has a broad spectrum for radicals, showed significant generation of two different radical signals in the sod1 mutant strain and the sod1 sod2 double mutant strain but less in the sod2 mutant and the wild-type strain which showed only a weak radical signal. This correlates with the viability changes shown by these sod mutants. All of our observations indicate that the radical chain reactions appear to occur mainly in the cytosol, and some water-soluble components may be the main targets of the chain reactions.

We conclude that the mitochondrial SOD can compensate for absence of the other despite a difference in their cellular localization. This raises a question about the direction of O₂ generation in mitochondria. Since O₂ is negatively charged, it cannot pass through the mitochondrial inner membrane by simple diffusion; however, it may be transported into the cytosol through an anion channel (46). It is also known that O₂ is generated bidirectionally, both into the cytosol and the mitochondrial matrix (47). Intracellular damage caused by freezing and thawing may disturb the ability of the cell to sequester O₂ in the mitochondrial matrix, and once the O₂ level is beyond the capacity of the available Mn-SOD activity it may move out to the cytosol where the main damage is initiated. Overexpression of the SOD2 gene would then alleviate this problem. It is not likely that the de novo precursor to Mn-SOD is active in the cytosol since removal of the signal peptide during the incorporation into mitochondrial matrix is a prerequisite for the formation of active Mn-SOD (48).

Here, we report that oxidative stress contributes to damage to cells during the freeze-thaw process, that the damage is probably caused by O₂, and can be prevented by the activity of the cytoplasmic SOD. The mechanisms whereby the radical propagates cell damage leading to death during the freeze-thaw process remain to be elucidated. Our work has provided a foundation to investigate these mechanisms in detail.