INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

Protein kinase C (PKC)¹ constitutes a group of isozymes that are central in cellular signaling pathways that regulate numerous cellular processes, including cell growth, differentiation, and metabolism (1). Each isoform can be classified into one of three major classes according to the cofactor and activator requirements. The "conventional" PKC, -I, -II, and - isoforms are Ca²⁺- and anionic phospholipid-dependent, whereas the "novel" PKC, -, -, and - and "atypical" PKC and - isozymes retain a phospholipid dependence but lack a Ca²⁺ requirement (2). In addition, the activities of all PKC isoforms, except atypical PKC, are potentiated by the lipid second messenger, diacylglycerol, derived from the receptor-G-protein and phospholipase-catalyzed hydrolysis of phosphatidylinositides and phosphatidylcholines (3) and also by the potent tumor-promoting phorbol esters (4).

The Ca²⁺ and phospholipid requirements for PKC activity differ according to the lysine and arginine content of the substrate (5). Thus, the PKC-catalyzed phosphorylation of the lysine-rich protein, histone H1, requires the presence of both Ca²⁺ and phospholipid, whereas the phosphorylation of the arginine-rich protein, protamine sulfate, requires neither cofactor (6-10). The mechanism of activation by protamine sulfate, which also acts as a substrate, has been suggested to involve a binding site(s) for arginine-rich proteins on the PKC molecule, separate from the active center of the enzyme (6, 11). Similar to that which occurs upon membrane association induced by Ca²⁺ and diacylglycerol or phorbol esters, interaction with protamine sulfate has been suggested to mediate in an allosteric activating conformational change resulting in the removal of a pseudosubstrate region from the active site which, in the inactive state, blocks substrate binding (12). Therefore, use of protamine sulfate provides a useful model for the activation of PKC in the absence of lipids by interaction with other proteins. The question of the mechanism by which PKC activity induced by protein-protein interactions is regulated has become an urgent concern, since it has become apparent that there are a large number of non-membrane protein targets for the enzyme, such as, for example, cytoskeletal and nuclear elements (e.g. Refs. 13-21).

Although interaction with arginine-rich proteins such as protamine sulfate relieves the Ca²⁺ and phospholipid requirements for PKC activity, it is not known whether this non-membrane PKC activity is modulated by phorbol esters and/or diacylglycerols in a similar manner to the membrane-associated enzyme. Evidence supporting this possibility was provided recently by the finding that PKC is capable of binding phorbol esters with low affinity in the absence of membrane lipids (22) and that these compounds can induce binding of PKC to filamentous actin (F-actin) (23). Although F-actin itself was not found to be a substrate for this isoform, this may lead to enhanced phosphorylation of other protein targets. PKCII has also been shown to bind F-actin which is reported to be a substrate for this isoform (24). In this respect, F-actin can be considered to be an example of a number of specific intracellular proteins that bind the activated form of PKC, termed "receptors for activated C-kinase" (RACKs) (20, 21), which allow precise targeting of PKC isoforms to specific cellular locations. However, the non-membrane, phorbol-induced interaction of PKC with F-actin departs from the original definition of RACKs that were described as proteins that bind PKC that has been activated by membrane association (25).

For membrane-associated PKC, activation by diacylglycerol proceeds by two parallel mechanisms. The first involves an increased affinity for the membrane, which is revealed as a decrease in the concentrations of both Ca²⁺ and anionic phospholipid required for maximal activity (4, 26, 27). Second, interaction with diacylglycerol and phosphatidylserine induces an activating conformational change that results in the folding out of an N-terminal pseudosubstrate region (12, 28-31). Phorbol esters have been suggested to potentiate PKC activity in a similar manner to diacylglycerol so that the two activator types initially appeared to share a single site or two identical sites of interaction on the enzyme (4, 32, 33). However, in recent studies of activator binding to PKC, using the fluorescent phorbol ester sapintoxin D (SAPD), we showed that diacylglycerols and phorbol esters interact with differing affinities with two activator binding sites on the enzyme molecule (34-36). Furthermore, it was shown that the site with low affinity for phorbol esters binds diacylglycerol with a relatively higher affinity, suggesting that the specificity of this site may differ from the high affinity phorbol ester-binding site (35). Interaction of diacylglycerol with this low affinity phorbol ester-binding site was found to lead to an enhancement in the level of high affinity phorbol ester binding and consequently to a potentiated level of PKC activity. By contrast to diacylglycerol, the potent PKC activator and anti-tumor agent, bryostatin-1, was found to compete more effectively for high affinity phorbol ester binding and did not potentiate the level of phorbol ester-induced PKC activity. Based on these results, a model for PKC activation was proposed in which interaction of an activator with the low affinity for phorbol ester-binding site leads to an enhanced level of binding of either the same or a second activator to the high affinity phorbol ester-binding site and consequently to an elevated level of PKC activity (35).

The activator binding site with relatively high affinity for phorbol esters likely resides within the C1 domain, which consists of two cystine-rich zinc finger motifs, termed C1A and C1B (37). Interaction of phorbol esters with these subdomains has been extensively characterized by truncation/deletion and mutagenesis studies (38-42) along with both crystal (43) and solution-state structural determinations (44, 45). By using glutathione S-transferase (GST) fusion proteins containing either the C1A or C1B subdomains, it has been shown that both are capable of binding phorbol esters (39, 42, 46). However, the phorbol ester binding affinities of the two subdomains may differ for each PKC isoform. For example, whereas PKC C1A and C1B appear to bind phorbol esters with similar affinities, in the case of the novel PKCs, PKC and PKC C1B bind phorbol esters with higher affinity than C1B (47, 48). Recent studies have indicated that these isoform-specific differences in phorbol ester binding to C1A and C1B may be carried over into the native enzyme. While for PKC C1B has been identified as being a high affinity phorbol ester-binding site, due to its role in phorbol ester-induced intracellular translocation (49), for PKC the high affinity site may correspond to C1A (46).

The first aim of this study was to determine if the high and low affinity activator binding sites, previously identified on membrane-associated PKC (35), similarly exist on the non-membrane form of this isoform. Second, the effects of phorbol esters and other activators of membrane-associated PKC on lipid-independent activity induced by protein-protein interactions with protamine sulfate were determined. Finally, while the high affinity phorbol ester-binding site clearly resides with the C1 domain, whether the low affinity binding site is similarly located was also investigated. The results indicate that both high and low affinity phorbol ester-binding sites on non-membrane PKC pre-exist in the absence of membrane lipids and that both sites are confined within the C1 domain of this isoform. However, phorbol esters, diacylglycerol, and bryostatin-1, although clearly described as being potent activators of membrane-associated PKC, are shown in the present study to be potent inhibitors of non-membrane PKC activity induced by protamine sulfate.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

Materials-- SAPD was from Calbiochem. 4-12-O-Tetradecanoylphorbol-13-acetate (TPA), 4-12-O-tetradecanoylphorbol-13-acetate (4-TPA), and protamine sulfate were from Sigma. Bryostatin-1 was obtained from Alexis Biochemicals, Inc. (San Diego, CA). Bovine brain phosphatidylserine (BPS), 1-palmitoyl-2-oleoylphosphatidylcholine (POPC), and 1-oleoyl-2-acetoyl-glycerol (OAG) were from Avanti Polar Lipids (Alabaster, AL). Adenosine 5'-triphosphate (ATP) was from Boehringer Mannheim, and [-³²P]ATP was from NEN Life Science Products. All other chemicals were of analytical grade and obtained from Fisher.

Preparation of Intact PKC-- The recombinant conventional PKC isoform, PKC (rat brain), was prepared using the baculovirus Spodoptera frugiperda (Sf9) insect cell expression system (50) and purified to homogeneity, as described previously (51). The specific activity of the PKC preparation was typically ~1 nmol min¹ µg¹.

Preparation of GST-C1-(His)₆ Fusion Protein-- Based on evidence that GST stabilizes the isolated C1 domain and to ensure the production of only full-length peptides, the fusion protein, GST-C1-(His)₆, was constructed. The nucleotide consensus sequence assigned to the C1 domain of PKC was that described previously (52). This was amplified by PCR with Pfu polymerase (Stratagene, La Jolla, CA) using full-length rat cDNA as the template. Primers were designed so that EcoRI and HpaI restriction sites were inserted at the 5' and 3' ends of the domain, respectively, to facilitate insertion into pGEX-5X-2 (Amersham Pharmacia Biotech). The reverse primer also encoded a blunt restriction site after the last amino acid of the domain which was utilized to insert a (His)₆ sequence (5'-CAT CAC CAT CAC CAT CAC TGA-3'). The domain fragment was subcloned into pGEX-5x-2 yielding a plasmid, the sequence of which was confirmed by dideoxy sequencing (Nucleic Acid Facility, Thomas Jefferson University), that encoded GST-C1-(His)₆, a protein-tagged N terminus with GST and C terminus with (His)₆. Along with the GST-C1-(His)₆, a fusion protein lacking the C1 domain was prepared by insertion of the (His)₆ sequence alone into pGEX-5x-2 (GST-(His)₆).

Preparation of PKC-(His)₆-- To facilitate isolation and purification, a (His)₆ affinity tag was added to the C terminus of PKC. Briefly, the last 1100 base pairs were amplified by PCR using Pfu polymerase (Stratagene, La Jolla, CA) and using PKC cDNA as a template, which was cloned in this laboratory.² The reverse primer was designed so that the stop codon was eliminated, and the (His)₆ sequence (CATCACCATCACCATCACTGA) followed by a stop codon and an HpaI restriction site was inserted in frame with the coding sequence. The PCR product was gel-purified on 1% agarose, A-tailed using TAQ polymerase and dATP, and subcloned into pCR 2.1 (Invitrogen, Carlsbad, CA). The nucleotide sequence was confirmed by dideoxy sequencing (Nucleic Acid Facility, Thomas Jefferson University). The first 1203 nucleotides of PKC were excised from PKC/pCR2.1 using EcoRI/BlnI, and the last 576 nucleotides including the (His)₆ tag were excised from PKC-3'(His)₆/pCR2.1 using BlnI/HpaI. The fragments were gel-purified, ligated into the EcoRI/StuI site of pFastBac1 (Life Technologies, Inc.), and transformed into DH5 E. coli. A clone containing the full-length PKC coding sequence including the (His)₆ tag was selected by restriction analysis of plasmid DNA. A recombinant baculovirus containing the PKC-(His)₆ sequence was generated using the Bac-to-Bac Baculovirus Expression System (Life Technologies, Inc.). Sf9 cells were infected with the recombinant baculovirus at a multiplicity of infection of 5, incubated for 3 days at 27 °C, harvested by centrifugation, and pellets stored at 80 °C.

PKC Activity-- PKC activity was determined in the presence of protamine sulfate, which acts both as a phosphate acceptor and an activator of the enzyme, as described previously (34). Briefly, the assay consisted of 50 mM Tris/HCl, pH 7.4, PKC (0.04 ng/µl or 0.52 nM final), and protamine sulfate (0.4 mg ml¹). To this was added either TPA or 4-TPA from 0.5 mM dimethyl sulfoxide (Me₂SO) stock solutions, OAG from a 10 mM methanol stock, or bryostatin-1 from a 50 µM methanol stock, so that the total assay volume was 75 µl. The assay was allowed to thermally equilibrate to 30 °C and initiated by the addition of ATP (15 µM), [-³²P]ATP (~1 µCi), and MgCl₂ (15 mM) in 50 mM Tris/HCl, pH 7.4. After 30 min, the assay was quenched by the addition of 100 µl of phosphoric acid (175 mM), 100 µl of which was transferred to Whatman P81 anion exchange papers. These were washed three times with 75 mM phosphoric acid, air-dried, and placed into scintillation mixture. The incorporation of ³²P into protamine sulfate was then measured by scintillation counting. Results are expressed as specific activities. The linearity of the assay was confirmed in separate experiments (results not shown).

(Eq. 1)

Phorbol Ester Binding to Non-membrane PKC-- Binding of the fluorescent phorbol ester, SAPD, to PKC, PKC-(His)₆, or GST-C1-(His)₆ in the absence of membranes was quantified as described previously by measuring the resonance energy transfer (RET) from tryptophans to the 2-(N-methylamino)benzoyl fluorophore attached at the 12-position of the phorbol moiety (35). The fluorescence intensities, obtained upon excitation of the tryptophan fluorophore at 290 nm, were determined using a PTI Alphascan spectrofluorimeter (Photon Technology International, Inc., South Brunswick, NJ) at 333 and 425 nm, corresponding to the emission maxima of tryptophan and SAPD, respectively. The binding assay system (2 ml) consisted of 50 mM Tris/HCl, pH 7.4, 5 µg/ml (or 0.12 µM) PKC, PKC-(His)₆, or GST-C1-(His)₆ and protamine sulfate at the indicated concentrations. To this was added TPA, 4-TPA, OAG, or bryostatin-1 at the required concentration. After incubation for 10 min at 30 °C in a stirred quartz cuvette, SAPD was titrated from stock solutions of the required concentration prepared from a Me₂SO solution of the phorbol ester. The fluorescence intensities were recorded for each phorbol ester addition after allowing equilibration. To isolate the fluorescence signal resulting from RET, the observed fluorescence intensities at each SAPD concentration were corrected for volume changes incurred during the titration procedure and normalized for the contribution from the direct excitation of the SAPD fluorophore according to the following: RET = (F_i,+PKC  F_i,PKC)  (F_0,+PKC  F_0,PKC), where F_i,+PKC and F_i,PKC are the fluorescence intensities measured after each SAPD addition, in the presence and absence of PKC, respectively, and F_0,+PKC and F_0,PKC are the fluorescence intensities measured in the absence of SAPD, in the presence and absence of PKC, respectively. The resultant data were fitted by nonlinear least squares analysis to a modified Hill equation, assuming a model involving two independent SAPD-binding sites (35) as shown in Equation 2.

(Eq. 2)

where F_min, H, F_max, H, F_min, L, and F_{max,  L} are the minimum and maximum fluorescence intensities (i.e. the corrected RET signal for saturation of the high and low affinity phorbol ester-binding sites by SAPD, addition of further SAPD not further increasing the signal); K_H and K_L are binding constants (defined as the SAPD concentration corresponding a half-maximal fluorescence intensity increase); and n_H and n_L are the Hill coefficients for high and low affinity binding, respectively. Upon activation by protamine sulfate there was small decrease in the (non-membrane) PKC tryptophan fluorescence intensity, possibly due to a conformational change as the enzyme became active; however, this does not affect the validity of Equation 2 for non-membrane-associated PKC.

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Previous studies from this laboratory demonstrated the existence of high and low affinity phorbol ester-binding sites on membrane-associated PKC (34, 35). In order to determine if these binding site(s) "pre-exist" on lipid-independent PKC or whether they are exposed upon membrane association, phorbol ester binding to non-membrane PKC was studied. The effects of TPA, SAPD, OAG, and bryostatin-1 on non-membrane PKC activity induced by protamine sulfate was also determined. To control for potential nonspecific interactions of these compounds with non-membrane PKC, phorbol ester binding to the isolated C1 domain of this isoform, and also to the atypical isoform, PKC, which is incapable of binding phorbol esters (55, 56), was determined. The binding assay used was based on the increase in fluorescence intensity due to RET from tryptophans to the fluorophore of the phorbol ester, SAPD, as recently described (35).

Phorbol Ester Binding to Non-membrane PKC in Isolation and in the Presence of Protamine Sulfate-- Interaction of phorbol esters with PKC was determined using a binding assay based on the increase in fluorescence intensity resulting from RET from tryptophans to the fluorophore of the phorbol ester, SAPD, as recently described (35). The binding isotherm obtained for the interaction of SAPD with PKC in the absence of protamine sulfate (or membrane lipids), shown in Fig. 1A, was found to be "dual sigmoidal," indicating that even alone, PKC contains two SAPD-binding sites of low and high affinity, respectively. Also shown in Fig. 1A is a comparison of the binding isotherm obtained for SAPD binding to this non-membrane form of PKC with that determined previously for the enzyme associated with membrane lipid vesicles consisting of POPC and BPS (35). The binding constant for low affinity SAPD binding to non-membrane PKC in the absence of lipids, K_H, obtained by fitting the binding data shown in Fig. 1A to Equation 2, was similar to that determined for low affinity binding to the membrane-associated enzyme (Table I). Low affinity SAPD-binding site is therefore suggested to be lipid-independent (i.e. it does not require membrane association). By contrast, the strength of the high affinity interaction of SAPD with non-membrane PKC was ~5-fold less than that for high affinity binding to the enzyme associated with membranes containing PS (Table I). In control experiments TPA was found to cause a small blue shift in the tryptophan emission maxima and a small increase in the fluorescence intensity, reflecting a conformational change in the enzyme. Whether this occurs with SAPD and thus influences the distance-dependent RET signal is difficult to determine, since addition of SAPD reduces the tryptophan signal due to fluorescence quenching as part of the RET process. However, in separate measurements of the tryptophan emission tail at 425 nm, where the RET signal is measured, obtained by adding the same TPA concentration as used in the SAPD binding data, it was possible to approximately correct for this. The resulting dual sigmoidal SAPD binding curve was not significantly influenced by this small correction.

View larger version (27K): [in this window] [in a new window]   Fig. 1.   Interaction of SAPD with PKC alone and in the presence of protamine sulfate. A, binding of SAPD to PKC was determined in the absence of all cofactors, membrane lipids, or protamine sulfate from measurements of RET between PKC tryptophans and the SAPD fluorophore. The binding isotherm for this lipid-independent form of PKC (circles) was compared with that obtained for the membrane-associated enzyme (open squares). RET data obtained for SAPD binding to the non-membrane and membrane-associated enzyme were normalized to the maximum RET signal obtained in each case. Binding of PKC to lipid vesicles composed of POPC and BPS (4:1 molar, 150 µM total lipid concentration) was achieved in the presence of Ca2+ (0.1 mM) essentially as described (35). B, binding of SAPD to PKC determined in the presence of increasing concentrations of protamine sulfate: 0 M (circles); 108 M (squares); 107 M (triangles up); 106 M (triangles down); 105 M (diamonds); 104 M (hexagons); and 103 M (crosses). Data are representative of triplicate determinations. Solid curves represent the theoretical curves obtained from fits of binding data to Equation 2 by nonlinear regression analysis. Methods were as described under "Experimental Procedures."

Effects of the Phorbol Ester, TPA, and Its "Inactive" Epimer, 4-TPA, the Diglyceride OAG, and Bryostatin-1 on SAPD Binding to Non-membrane PKC in the Presence of Protamine Sulfate-- In order to determine the specificity of low and high affinity phorbol ester binding to non-membrane PKC associated with protamine sulfate, the effects of TPA and the inactive 4-OH epimer, 4-TPA, on SAPD binding was first determined. This was accomplished by utilizing the increase in fluorescence anisotropy of SAPD as it binds to the phorbol ester-binding site, reflecting a more restricted motion compared with membrane-associated or free SAPD. Addition of SAPD (1 µM, sufficient to saturate the high affinity site), in the absence of lipids, led to a marked increase in r_s consistent with binding to the non-membrane enzyme (Fig. 2A). Addition of TPA (1 µM) resulted in a decrease in r_s, due to the displacement of bound SAPD. The inactive epimer 4-TPA (1 µM) also displaced SAPD but at a slower rate indicating that the affinity of 4-TPA for non-membrane PKC is reduced compared with TPA. Addition of SAPD (1 µM) to PKC, in the presence of lipids (150 µM) as PS:PC vesicles (1:4, molar), again resulted in an increase in r_s, consistent with binding (Fig. 2B). This was enhanced by addition of 0.1 mM Ca²⁺, sufficient to induce complete membrane association. Addition of TPA (1 µM) again displaced high affinity SAPD binding, as found for non-membrane-associated PKC. However, high affinity SAPD binding was not inhibited by 4-TPA (1 µM). These results clearly show the competition of TPA for SAPD binding and show that the phorbol ester-binding site properties of PKC change markedly upon membrane association.

View larger version (27K): [in this window] [in a new window]   Fig. 2.   SAPD binding to PKC determined from fluorescence anisotropy. SAPD binding to PKC shown by a decrease in the motional freedom of the SAPD fluorophore measured as the steady state anisotropy (rs). A, addition of PKC (20 µg) to free SAPD (1 µM, sufficient to saturate the high affinity site) with protamine sulfate (0.5 mg/ml) and in the absence of lipids, showing SAPD displacement by TPA (1 µM) as compared with 4-TPA (1 µM). B, addition of PKC (20 µg) to SAPD (1 µM) in the presence of lipids (150 µM, PS:PC 1:4, molar) and 0.1 mM Ca2+ to induce complete membrane association again showing SAPD displacement by TPA (1 µM) as compared with 4-TPA (1 µM). Methods were as described under "Experimental Procedures."

View larger version (24K): [in this window] [in a new window]   Fig. 3.   Effects of the phorbol esters, TPA and 4-TPA, the diglyceride, OAG, and bryostatin-1 on SAPD binding to non-membrane PKC. SAPD binding PKC was determined from measurements of RET. A, SAPD binding to PKC with protamine sulfate alone (circles) or in the presence of TPA at levels of 0.25 µM (squares), or 10 µM (triangles down), or with 10 µM 4-TPA (triangles up). B, SAPD binding to PKC associated with protamine sulfate in the absence (circles) or in the presence of OAG at levels of 10 µM (squares) or 100 µM (triangles). C, binding of SAPD to PKC in the presence of protamine sulfate in the absence (circles) or with bryostatin-1 present at 10 nM (squares) or 100 nM (triangles). Protamine sulfate was present at a concentration corresponding to that required to induce maximal stimulation of activity (0.5 mg ml1). Data are representative of triplicate determinations. Solid curves represent the theoretical curves obtained from fits of binding data to Equation 2 by nonlinear regression analysis. Other methods were as described under "Experimental Procedures."

Interaction of SAPD with the Isolated C1 Domain of PKC (GST-C1-(His)₆) and with PKC-- To address the possibility that the compounds studied may interact "nonspecifically" with a site(s) outside of the C1 domain, binding of SAPD to the isolated C1 domain of PKC was determined. The fusion protein GST-C1-(His)₆ contains a single tryptophan within the C1B region, as well as four tryptophan residues within the GST moiety, thus allowing for determination of binding from measurements of RET to the SAPD fluorophore. The SAPD binding isotherm obtained for the isolated C1 domain was found to be dual sigmoidal, as shown in Fig. 4A, providing evidence that both the high and low affinity SAPD-binding sites, observed to exist on non-membrane PKC, may be confined within the C1 domain of this isoform. The strengths of both high and low affinity SAPD interactions with the isolated C1 domain were marginally reduced compared with the native intact enzyme, observed as an increase in K_H and K_L (Table I). However, both high and low affinity SAPD-binding sites appeared to have similar specificities to native PKC, in that both interactions were inhibited by TPA, 4-TPA, OAG, and bryostatin-1 (Fig. 4A). The possibility that SAPD may bind in a nonspecific manner to the GST or (His)₆ moieties was ruled out by the finding that the level of RET from the tryptophans of GST-(His)₆ was insignificant within the phorbol ester concentration range used. Furthermore, evidence against the low and high affinity SAPD interactions being of a nonspecific nature outside the C1 domain was provided by the finding that SAPD failed to bind to PKC, as shown in Fig. 4B, which is in keeping with the inability of this isoform to bind phorbol esters (56).

View larger version (25K): [in this window] [in a new window]   Fig. 4.   Interaction of SAPD with fusion proteins containing the isolated C1 domain of PKC (GST-C1-(His)6) or the atypical isoform PKC (PKC-(His)6). A, interaction of SAPD with GST-C1-(His)6 determined from RET measurements, alone (circles) or with 1 µM TPA (squares), 1 µM 4-TPA (triangles up), 50 µM OAG (hexagons), or 50 nM bryostatin-1 (triangles down). SAPD binding to the fusion protein GST-(His)6 which lacks the C1 domain was also determined to control for nonspecific interactions (open diamonds). Inset, the same binding data plotted on a linear abscissa. B, interaction of SAPD with PKC-(His)6, determined from RET measurements (circles). Binding data obtained for native PKC are shown for comparison (triangles). Data are representative of triplicate determinations. Solid curves represent the theoretical curves obtained from fits of binding data to Equation 2 by nonlinear regression analysis. Other methods were as described under "Experimental Procedures."

Effects of Phorbol Esters on Non-membrane, Protamine Sulfate-induced PKC Activity-- PKC is effectively activated by protamine sulfate without the need for membrane association or Ca²⁺; however, whether this non-membrane activity is affected by phorbol esters (or other activators) is currently not known. Therefore, it was important in the present study to determine the effects of phorbol esters on protamine sulfate-induced PKC activity. Membrane lipid-independent PKC activity induced by protamine sulfate was potently inhibited in a concentration-dependent manner both by the fluorescent phorbol ester, SAPD, and also by TPA, as shown in Fig. 5, A and B, respectively. This surprising observation contrasts completely with the fact that phorbol esters activate the membrane-associated enzyme (35). Interestingly, the "non-active" phorbol ester, 4-TPA, also inhibited this activity, although the potency of the inhibition by this phorbol ester was less than with TPA (Fig. 5A and see Table II). The Hill coefficients, shown in Table II, for the inhibition of activity by TPA and 4-TPA and SAPD were ~1, again indicating that the effects of both phorbol esters may be mediated by at least one inhibitory site. Furthermore, the IC₅₀ for the inhibition of protamine sulfate-induced activity by SAPD, obtained by fitting the dose-response curve shown in Fig. 5B to Equation 1 by linear regression (Table II), was similar to the SAPD concentration required for half-maximal binding to the high affinity site, determined from nonlinear regression analysis of the data shown in Fig. 1A using Equation 2 (Table I). This suggests that the inhibitory effect of phorbol esters may, at least in part, be mediated by the high affinity phorbol ester-binding site. Finally, the inhibition of protamine sulfate-induced activity by SAPD was ~5-fold greater than the concentration of phorbol ester required for the half-maximal activation of membrane-associated PKC (EC₅₀), in keeping with the increase in the strength of high affinity binding observed upon membrane association (see Table II).

View larger version (19K): [in this window] [in a new window]   Fig. 5.   Effects of the phorbol esters, TPA, 4-TPA, and SAPD, on non-membrane PKC activity induced by protamine sulfate. A, inhibition of protamine sulfate-induced PKC activity by TPA (circles) or 4-TPA (squares), as a function of phorbol ester concentration. B, dose dependence of the inhibition of protamine sulfate-induced activity by SAPD. Protamine sulfate was present at a concentration corresponding to that required to induce maximal stimulation of activity (0.5 mg ml1). Data are representative of triplicate determinations ± S.D. Other details as described under "Experimental Procedures."

View this table: [in this window] [in a new window]   Table II Summary of potencies (IC50) and Hill coefficients (n) for the inhibition of non-membrane, protamine sulfate-induced PKC activity and activation of membrane-associated PKC (EC50) by phorbol esters, diacylglycerol, and bryostatin-1 Errors are reported as ± S.D. Regression coefficients were >0.98 for each data set. For details see "Materials and Methods."

View larger version (12K): [in this window] [in a new window]   Fig. 6.   Effects of TPA on the concentration dependence of protamine sulfate-induced PKC activity. Dose-dependent increase in PKC-specific activity induced by protamine sulfate alone (circles) or in the presence of 100 nM (squares) or 500 nM TPA (triangles). Data are representative of triplicate determinations ± S.D. Other details as described under "Experimental Procedures."

Effects of OAG, and Bryostatin-1 on Non-membrane, Protamine Sulfate-induced PKC Activity-- The diglyceride, OAG, also inhibited protamine sulfate-induced PKC activity in a concentration-dependent manner (Fig. 7A), although the potency of this inhibitory effect was less than for TPA, 4-TPA, or SAPD (Table II). This inhibitory effect again contrasts with the well described potentiating effect of diacylglycerols on membrane-associated PKC. The Hill coefficient, shown in Table II, for the inhibitory effect of OAG was ~1, again indicating at least one site of action. Interestingly, for OAG, the IC₅₀ for the inhibition of non-membrane, protamine sulfate-induced PKC activity was similar to the EC₅₀ for the activation of the membrane-associated enzyme.

View larger version (18K): [in this window] [in a new window]   Fig. 7.   Effects of OAG and bryostatin-1 on non-membrane PKC activity induced by protamine sulfate. A, dose-dependent inhibition of protamine sulfate (0.5 mg ml1)-induced PKC activity by OAG. B, dose-dependent inhibition of protamine sulfate-induced PKC activity by bryostatin-1. Protamine sulfate was present at a concentration corresponding to that required to induce maximal stimulation of activity (0.5 mg ml1). Data are representative of triplicate determinations ± S.D. Other details are described under "Experimental Procedures."

	DISCUSSION

Top Abstract Introduction Procedures Results Discussion References

In the present study, it is shown that the low and high affinity phorbol ester-binding sites, previously shown to exist on membrane-associated PKC (35), also exist on soluble PKC. The results show that although membrane-association is not required to expose these sites, the affinities and specificities of the sites are modified by this interaction. Furthermore, evidence is also presented that both high and low affinity phorbol ester-binding sites may be confined within the C1 domain of the enzyme. However, binding of phorbol esters, which are commonly classed as activators of membrane-associated PKC, resulted in a potent inhibition of lipid-independent enzyme activity induced by protein-protein interactions with the arginine-rich protein, protamine sulfate. Furthermore, two other important activators of membrane-associated PKC, diacylglycerol and bryostatin-1, competed for both high and low affinity phorbol ester binding and also inhibited protamine sulfate-induced activity.

The observation that PKC alone bound SAPD in the absence of protamine sulfate (or membrane lipids) is consistent with membrane association not being an absolute requirement for phorbol ester binding, as observed in several other studies. For example, it has been previously observed that phorbol esters are capable of inducing a low level of PKC activity in the absence of membranes or protein elements, providing evidence for a lipid-independent interaction of phorbol esters with PKC (63). Finally, it has been shown that the novel Ca²⁺-independent isoform, PKC, and also a peptide corresponding to the C1B region, bound phorbol ester in the absence of lipids (22). In the present study, binding of phorbol ester to non-membrane PKC utilized SAPD as a probe for low and high affinity binding sites, as previously observed to exist on the membrane-associated enzyme (35). Phorbol ester binding to PKC is commonly determined using phorbol 12,13-dibutyrate (PDBu) which, being relatively hydrophilic compared with TPA (or SAPD), minimizes nonspecific interactions and enables the physical separation of bound from free ligand. However, this precludes the detection of low affinity binding. By contrast, the SAPD binding assay used in the present study does not require physical separation of bound from free ligand, and the affinity of SAPD for binding to PKC is ~10-fold greater than that of PDBu (64), which allows for the detection low affinity phorbol ester binding. The results show that both the high and low affinity phorbol ester-binding sites, previously shown to be present on the membrane-associated enzyme (35), pre-exist on non-membrane PKC. Furthermore, the observation that the isolated C1 domain of PKC also bound SAPD with high and low affinities provides evidence that, as for the high affinity site, the low affinity phorbol ester-binding sites may also be contained within this domain, rather than residing elsewhere on the PKC molecule. This is also apparent from the observation that PKC failed to bind SAPD, in keeping with the inability of this isoform to bind other phorbol esters. However, further experiments are required to determine the nature of the low affinity phorbol ester-binding site within the C1 domain and whether this site corresponds to either the C1A or B subdomains.

Comparison of isotherms corresponding to SAPD binding to membrane-associated PKC with that obtained for binding to the soluble isozyme (Fig. 1A) revealed that interaction with membrane lipid vesicles containing PS results in an ~5-fold increase in the strength of high affinity SAPD binding. This is in keeping with the results of studies by Kazanietz and co-workers (22), who showed that the structure-activity relationship for phorbol ester binding to soluble, non-membrane PKC, differed markedly compared with that for binding to the membrane-associated isoform. For example, although it was shown that the affinity of PDBu for binding to PKC in the presence of phosphatidylserine (PS) was enhanced 80-fold compared with the soluble isozyme, the binding affinity of phorbol-12-decanoate was found to be only enhanced 6-fold.

In the present study it was shown that 4-TPA, TPA, OAG, and bryostatin-1 each displaced both high and low affinity SAPD binding to native PKC and to the isolated C1 domain, suggesting that both sites on the non-membrane enzyme may have similar binding specificities. By contrast, the low and high affinity phorbol ester-binding sites on membrane-associated PKC have previously been shown to have differing specificities (35). In particular, the observation that 4-TPA inhibited high affinity SAPD binding to non-membrane PKC while having negligible effects on high affinity SAPD binding to the membrane-associated enzyme (Fig. 2) suggests that this site on non-membrane PKC may have a reduced specificity for the orientation of the 4-OH and/or the A and B rings of SAPD, compared with that on the membrane-associated enzyme. Furthermore, whereas bryostatin-1 appears to compete for low affinity SAPD binding to non-membrane PKC and to the isolated C1 domain, this compound failed to compete for low affinity SAPD binding to the membrane-associated enzyme, suggesting that the specificities of the low affinity sites on non-membrane and membrane-associated PKC may also differ. In keeping with this was the finding that the ratios of the values of IC₅₀ for the inhibition of non-membrane PKC to the corresponding values of EC₅₀ for the activation of the membrane-associated enzyme differed for the compounds studied (see Table II).

The mechanism of activation of PKC by arginine- and lysine-rich proteins has been suggested to involve the formation of high order aggregates (6, 7). Also consistent with the formation of an aggregate was the observation that the specific activity of protamine sulfate phosphorylation displayed positive cooperativity with respect to protamine sulfate concentration, as observed previously (6). Importantly, the observation that neither the Hill coefficient nor the mid-point of the specific activity against protamine sulfate curve was affected by the presence of SAPD argues against the possibility that the inhibition of protamine sulfate activity resulted from an effect on PKC-protamine sulfate interactions. Rather, the apparent decrease in the maximal reaction velocity suggests that the inhibitory effect involves an attenuation of the activating conformational change induced by interaction with the arginine-rich protein. This conformational change could provide a basis for the observed increase in RET induced by protamine sulfate, since the molecular rearrangement would result in a change in the average distance between participating PKC tryptophan and SAPD fluorophores.

The finding that the value of the IC₅₀ for the inhibition of protamine sulfate activity by SAPD was close to the phorbol ester concentration required for half-maximal binding to the high affinity site on protamine sulfate-associated PKC strongly suggests that the inhibitory effect may be mediated by interaction with this site. However, based on the present data, it is not possible to determine whether, similar to SAPD, the inhibitory effect of these compounds is mediated specifically by interaction with the non-membrane high affinity phorbol ester-binding site per se. Only direct measurements of binding of these compounds to the PKC would resolve this issue, which is technically difficult to achieve at the sensitivity required. Interaction of phorbol esters, diacylglycerol, and bryostatin with the SAPD-binding sites on PKC appears to inhibit the protamine sulfate-induced activating conformational change, based on the observation that the inhibitory effect of SAPD on protamine sulfate-induced activity corresponded to a reduction in the maximal reaction velocity (V_max), rather than an effect on the PKC-protamine sulfate interactions. Conversely, the protamine sulfate-induced activating conformational change does not appear to impact on phorbol ester binding, based on the observation that neither the binding constants nor the Hill coefficients for high and low affinity SAPD binding changed significantly in the presence of increasing protamine sulfate concentrations. These observations suggest that the inhibition of activity by phorbol esters (and other activators) may proceed by an "uncompetitive" type mechanism in which the effect of SAPD binding is to prevent rather than reverse the activating conformational change.

Finally, the observed differences in the specificities of the low and high affinity phorbol ester-binding sites on non-membrane and membrane-associated PKC may partially contribute to the distinct effects of bryostatin, compared with phorbol esters, on PKC-regulated cellular processes adding to differences in down-regulation, isoform-selectivity, and cellular location.