INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

In addition to its role in replication fidelity, mismatch repair contributes to genome stability by controlling the level of recombination between closely related sequences (1-9). In Escherichia coli, MutS and MutL act to block recombinant yield when phenotypic selection arises in the vicinity of heteroallelic markers (10). Recent work from Zahrt and Maloy (11) provided more evidence implicating mismatch repair in recombination. Specifically, they showed that the efficiency of chromosomal gene transfer between Salmonella typhimurium and the closely related Salmonella typhi is low due to mismatch repair. Zahrt and Maloy (11) attributed this barrier of genetic exchange to DNA divergence and the ability of MMR to correct this event in favor of the recipient strand. Abdulkarim and Hughes (12) also showed that the mutHLSU genes increased the fidelity of exchange 1000-fold between the TufA and TufB translation factors, whose sequences share 99% sequence identity. Mismatch repair in this case ensures that the integrity of the genome is preserved by allowing these genes to evolve in concert.

The first biochemical evidence to implicate mismatch repair in homologous recombination was provided by the in vitro RecA-catalyzed three-strand transfer reaction. E. coli MutS was shown to inhibit exchange between M13 and fd DNAs whose sequence heterology is ~3% at the nucleotide level (13). Since MutS was without effect on M13-M13 or fd-fd exchange, we attribute the block to the occurrence of mismatched base pairs in newly formed heteroduplex.

MutL enhanced the MutS-dependent block of M13-fd exchange. Indeed, these proteins completely abolished full-length heteroduplex between these DNAs and is reminiscent of the proposed role of these activities in MMR (14-19). MutL is believed to add to the MutS mismatch complex in an ATP-dependent fashion. Evidence for this stems from work by Grilley et al. (20), who showed the region of DNase I protection by MutS and ATP is extended by MutL. In the experiments described here, the role of ATP hydrolysis by MutS is examined on RecA-strand transfer. Previous work by Wu and Marinus (21) described dominant negative mutants of MutS from MNNG treatment and showed a large fraction of the isolates were missense mutations within the nucleotide binding domain (21). It is here that we have characterized two of these mutants, MutS501 and MutS506, and show that 1) mismatch binding is retained, 2) ATP hydrolysis is reduced, and 3) mismatch correction with MutS extracts is not restored.

These mutants also blocked RecA-catalyzed strand transfer between M13 and fd DNAs. That MutS501, and to a lesser extent MutS506, inhibited M13-fd and not M13-M13 exchange, suggests that mismatch recognition precludes RecA-dependent branch migration in regions of nonhomology. Moreover, that both mutants failed to completely block strand transfer in the presence of MutL suggests that the barrier to homeologous recombination is dependent upon ATP hydrolysis.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

E. coli proteins RecA, SSB,¹ and MutL were purified as described previously (13). Restriction endonucleases SnaBI and MspI and S1 nuclease were purchased from U.S. Biochemical Corp./Amersham Pharmacia Biotech. DNase I from bovine pancreas was from Worthington.

Other Materials-- Proteinase K, phosphocreatine kinase, and phosphocreatine were purchased from Sigma. Oligonucleotides were from Oligos Etc. Replicative form and single-stranded M13 and fd bacteriophage DNAs were prepared as described (13). The replicative forms of M13 and fd DNAs were linearized with SnaBI restriction endonuclease. Linear DNA (50 pmol of 5'-ends) was 5'-end-labeled with [-³²P]ATP using T4 polynucleotide kinase and purified as described previously (13).

DNA Substrates-- Oligodeoxynucleotides were purchased from Oligos Etc. Purified oligomers were annealed and isolated as described previously (22). Covalently closed circular G/T heteroduplex used in the MMR assays was prepared as described previously (23-26). Repair was scored by determining the fraction of molecules rendered sensitive to XhoI cleavage due to T  C correction on the unmethylated strand.

Construction of Expression Vectors-- Plasmids harboring structural genes mutS501 and mutS506 (21) were amplified using the following primers: upstream 5'-GGCATCGTAGGATCCCATGAGTGGAATAGAAAATTTCGAC-3' and downstream 5'-TTAGCAGCGGGAAAGCTTTCCTATTATACA-3'. The resulting fragments (~3 kb) were inserted into the BamHI-HindIII sites of pQE10 expression vector (Qiagen) encoding an N-terminal His₆-tag to yield pLW11 (mutS501) and pLW12 (mutS506). Recombinant wild-type MutS (pLW10) was constructed in a similar manner from plasmid pMS312.

Cell Growth and MutS Purification-- All His₆-tagged proteins were purified as described by QIAexpressionist from Qiagen with the following modifications. M15pREP4 cells, transformed with pLW10, pLW11, or pLW12, were grown in 4 × 1l LB to an A₅₉₅ of 0.7, chilled to 20-25 °C and induced with 0.05 mM isopropyl-1-thio--D-galactopyranoside (27). Cells were recovered in a sonication buffer (100 ml; 50 mM sodium phosphate buffer, pH 7.5, 500 mM NaCl, 10 mM -mercaptoethanol, 5 mM imidazole, 5 mM MgCl₂, 13.3% glycerol) and stored at 70 °C. Thawed cell paste (14.5 g) was suspended in 80 ml of sonication buffer with protease inhibitors (antipain, chymostatin, and leupeptin at 0.25 µg/ml; aprotinin and pepstatin A at 0.20 µg/ml; o-phenanthroline at 0.1 µg/ml; phenylmethylsulfonyl fluoride at 17 µg/ml; and benzamidine-HCl at 0.16 µg/ml) and 90 mg of lysozyme, sonicated, and batch-eluted with nickel affinity resin. MutS was dialyzed against 1l of 50 mM HEPES, pH 7.5, 500 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, and 13.3% glycerol for 3 h, followed by overnight dialysis using the same buffer containing 200 mM KCl. MutS, at 2.5-3 mg/ml and >95% purity, was stored at 70 °C.

Gel Mobility Shift Assay-- All gel shift assays were carried out at 4 °C for 30 min in the following buffer: 20 mM HEPES, pH 7.5, 5 mM MgCl₂, 0.1 mM dithiothreitol, 0.1 mM EDTA, 80 µg/ml bovine serum albumin, 0.02 µM -³²P-labeled G/T oligonucleotide (T lower 5'-CCACGTTAGCCGAATGCTAGCAAGCTTTCGAGTCTAGAAATTTAGGCTTTT-3' and G upper 5'-AAAAGCCTAAATTTCTAGACTCGAGAGCTTGCTAGCATTCGGCGAACGTGG-3'. His₆-tagged MutS501 (or MutS506) was added at the following final concentrations: 10, 20, 30, 40, 60, 100, 150, 200, 300, and 450 nM. Reactions with ATP were performed in a similar fashion with the addition of G/C carrier (5'-CCACGTTAGCCGAATGCTAGCAAGCTCTCGAGTCTAGAAATTTAGGCTTTT-3'; 0.133 µM) and 0.208 µM MutS (15 µl). Incubations were resolved on a 6% polyacrylamide gel in 40 mM Tris-HCl, pH 8.5, and 2 mM EDTA at 4 °C for 1.5 h at 110 V using 10% glycerol and 0.1% bromphenol blue. Analysis was done with ImageQuaNT from the Molecular Dynamics STORM 860 PhosphorImager.

Determining Kinetic Parameters K_m and k_cat for MutS-- MutS ATPase activity was carried out as described by Hughes and Jiricny (28). Reactions (24 µl) were performed in 50 mM HEPES-KOH, containing 0.75 µCi of [-³²P]ATP and 2, 4, 8, 18, 25, 37.5, 50, or 75 µM ATP. MutS (0.33 µM; MutS501 and MutS506, 2 µM) was added to initiate the reaction at 37 °C, and aliquots (2 µl) were quenched (4 µl; 8.3 mM EDTA, pH 8.0; 2.0 µl formamide) and resolved for 0.5 h at 25-mA constant current as described in the figure legends. Rates for ATP hydrolysis were determined by quantitating the amount of labeled P_i liberated as described above. Kinetic determinations were accomplished by two methods from three independent experiments (29).

Strand Exchange Reactions-- A standard reaction was carried out in a total volume of 80 ml containing 50 mM HEPES-KOH (pH 7.5), 12 mM MgCl₂, 6 mM phosphocreatine, 140 unit/ml creatine phosphokinase, 14 µM single-stranded circular DNA M13 (fd), 6.6 µM RecA, 10 µM linear double-stranded fd (M13), 0.4 µM SSB, 3 mM ATP, and 100 µg/ml bovine serum albumin. Preincubation of RecA and single-stranded circular DNA was for 10 min at 37 °C followed by linear duplex for an additional 10 min. Reactions were initiated by the simultaneous addition of SSB and ATP (13). Aliquots (14.5 µl) were removed at 2.5, 10, 20, 40, and 60 min; quenched with a final concentration of 0.1% SDS, 25 mM EDTA (pH 8), and 153 µg/ml proteinase K; and incubated for 15 min at 37 °C. After deproteination, load buffer (2 µl; 20% Ficoll 400, 0.1 mM EDTA, 1.0% SDS, 0.25% bromphenol blue, and 0.25% xylene cyanol) was added, and samples were analyzed by electrophoresis on agarose gels (0.8%) for 3 h at 6 V/cm.

Effects of MutS501, MutS506, and MutL on Strand Exchange-- Reactions were carried out as described previously, except MutS (75 nM) and MutL (75 nM) were added just prior to SSB and ATP (13). Control reactions were supplemented with MutS and MutL diluent buffer.

DNase I Footprinting-- Footprinting reactions were carried out as described by Grilley et al. (20) using a 100-base pair synthetic heteroduplex fragment identical in sequence to 5591-5690 of f1MR1 and f1MR3 (20). Duplexes were prepared by annealing the following oligonucleotides in 25 mM Tris-HCl, pH 7.6, 1 mM EDTA, and 150 mM NaCl: strand 1A (homoduplex) 5'-CCCTTCCTTTCTCGCCACGTTCGCCGAATTGCTAGCAAGCTCTCGAGTCTAGAAATTCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGG-3' or strand 1B (heteroduplex) 5'-CCCTTCCTTTCTCGCCACGTTCGCCGAATTGCTAGCAAGCTTTCGAGTCTAGAAATTCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGG-3' to strand 2 (template) 5'-CCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGAATTTCTAGACTCGAGAGCTTGCTAGCAATTCGGCGAACGTGGCGAGAAAGGAAGGG-3' (the underlined nucleotides indicate position of mismatch or G:C base pair). Reactions containing 5'-labeled oligoduplex (with or without a G/T mispair) and MutS, MutL, and ATP or as indicated were incubated for 10 min at 30 °C followed by DNase I at 0.1 ng/reaction (0.02 units). Samples were terminated after 20 s with EDTA (50 mM, pH 8) and precipitated with ethanol. Pellets were resuspended in 95% formamide, 10 mM EDTA, 0.025% xylene cyanol, and 0.025% bromphenol blue, and the digested products were resolved on a 10% denaturing polyacrylamide gel in 1× TBE (89 mM, pH 8.0 Tris-HCl, 89 mM boric acid, and 2 mM EDTA). DNA quantitation was performed on the Molecular Dynamics STORM 860 PhosphorImager using ImageQuaNT.

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Purification of Hexameric Histidine Recombinant MutS-- Both MutS mutants (501 and 506) and wild-type were overexpressed and purified using a N-terminal hexameric histidine tag. Induction with 0.4 mM isopropyl-1-thio--D-galactopyranoside resulted in high levels of expression, since ~30% of the total E. coli lysate (Fig. 1.) was MutS. However, a vast majority (~80%) of the recombinant protein precipitated as inclusion bodies (30). This was corrected by reducing the isopropyl-1-thio--D-galactopyranoside to 0.05-0.1 mM and lowering the growth temperature to 25 °C. Recombinant His₆-tagged proteins were purified to greater than 95% purity using nickel affinity chromatography (Fig. 1). The yield from 4-liter preparations was 40-50 mg of protein at 2.5-3.0 mg/ml.

View larger version (57K): [in this window] [in a new window]   Fig. 1.   Expression and purification of recombinant mutants. Using the QIAexpressionist System (Qiagen), MutS501 and MutS506 were cloned into the plasmid pQE10 to generate recombinant His6-tagged proteins as described under "Experimental Procedures." Lanes 1, 4, and 7, uninduced lysates from wild-type MutS, MutS501, and MutS506, respectively. Lanes 2, 5, and 8, lysates after induction with isopropyl-1-thio--D-galactopyranoside at 25 °C. Lanes 3, 6, and 9, nickel affinity purification of His6-tagged recombinant proteins (2.5 µg). All purified samples had an apparent molecular mass of 97 kDa, similar to nontagged MutS.

Gel Retardation Assay/NheI Endonuclease Assays-- Both MutS501 and MutS506 were examined for mismatch recognition by the ability to retard a 51-mer G/T-containing oligonucleotide. Titration of His₆-tagged MutS revealed a K_D for a G/T mispair at 40 nM (Fig. 2a) (15). MutS501 mismatch was marginally affected with a K_D of 55 nM. Mismatch recognition by MutS506, however, was down almost 3-fold with a K_D of 125 nM. The gel retardation pattern was identical in nature to both tagged and nontagged wild-type MutS (data not shown). Discrimination for G/T heteroduplex over homoduplex DNA was 10-fold for both wild-type and MutS501 (Fig. 2b).

View larger version (21K): [in this window] [in a new window]   Fig. 2.   Titration of His6-tagged mutants with a G/T mismatch-containing oligonucleotide. a, affinity of the His6-tagged MutS501 and MutS506 for a DNA substrate containing a single G/T mismatch. A 32P-labeled 51-mer G/T oligonucleotide was incubated with increasing amounts of MutS as described. , His6-tagged wild-type MutS (0.5 µM); , His6-tagged MutS501 (2 µM); ×, His6-tagged MutS506 (2 µM). b, plot of mismatch binding in the absence and presence of ATP. Gray-shaded columns, pmol of labeled G/T oligo bound by MutS (3 pmol); dot-shaded columns, pmol of labeled G:C oligo bound by MutS (3 pmol).

View larger version (16K): [in this window] [in a new window]   Fig. 3.   NheI restriction protection assays. Labeled 51-mer G/T (or G:C) oligonucleotide(s) was preincubated with MutS protein (0, 25, 50, 100, 200, 400, and 600 ng) at 4 °C as described under "Experimental Procedures." NheI endonuclease was added after 2 min at 37 °C, and incubations were continued for 15 min. Results from His6-tagged wild-type, MutS501, and MutS506 with both G/T and G:C oligonucleotides are defined as follows. a, /, G:C/G/T oligonucleotide with wild type; /, G:C/G/T oligonucleotide with wild type in the presence of 150 µM ATP. b, /, G/T oligonucleotide with MutS501 with or without ATP; /, G/T oligonucleotide with MutS506 with or without ATP.

Kinetics of ATP Binding/Hydrolysis-- ATPase activity was examined for MutS501 and MutS506 to further characterize the dominant negative phenotype (21). Kinetic parameters, K_m and k_cat were determined for wild type, MutS501, and MutS506 to verify their role in MMR. As shown in Fig. 4, E. coli MutS hydrolyzes ATP to ADP + P_i and thus corroborates the early findings of Grilley et al. (20). From three independent experiments, k_cat and K_m values were determined, and the data were analyzed by both Lineweaver-Burk and Eadie-Hofstee double reciprocal plots. As a comparison, values for MutS from S. typhimurium are presented (29). In terms of k_cat, E. coli wild-type MutS is approximately 30 times faster. This rate of hydrolysis does not seem to be dependent upon better binding, since the K_m values are virtually identical (Table I). Moreover, it is unlikely that this difference in k_cat is due to an ATPase contaminant in the E. coli preparations, because both MutS501 and MutS506 possessed different rates of ATP hydrolysis.

View larger version (14K): [in this window] [in a new window]   Fig. 4.   ATPase activity of mutants. Time course of ATP hydrolysis was performed with [-32P]ATP and cold ATP (50 µM). All reactions were carried out at 37 °C, and aliquots were removed at the indicated times, quenched, and resolved on 15% nondenaturing polyacrylamide gel as described under "Experimental Procedures." , control His6-tagged wild-type MutS (0.5 µM); , His6-tagged MutS501 (2 µM); ×, His6-tagged MutS506 (2 µM).

1

View larger version (16K): [in this window] [in a new window]   Fig. 5.   Strand transfer and product inhibition by His6-tagged MutS, MutS501, and MutS506 using 32P-labeled DNA reactions were carried out as described under "Experimental Procedures." Time points (15 µl) were taken as indicated, and the amount of full-length relaxed circles (60 min) was plotted against increasing concentrations of MutS protein: His6-tagged wild-type (), MutS501 (), and MutS506 ().

Mismatch Correction-- Mismatch repair was examined to compare the repair efficiency of MutS501 and MutS506 with His₆-tagged wild-type by complementing mutS-(MutS201::Tn5) extracts. Maximum repair of closed circular G/T heteroduplex by His₆-tagged MutS occurred at 0.2 pmol of protein (Table II). This corresponded well with wild-type MutS as optimum repair occurred between 0.2 and 0.8 pmol of MutS. Unlike wild type, His₆-tagged MutS started to inhibit repair above 0.3 pmol.²

View this table: [in this window] [in a new window]   Table II MutS mismatch repair complementation assays with RK1517 Hemimethylated G/T heteroduplex DNA was treated with RK1517 (mutS) extracts in the presence of varying amounts of MutS protein as described under "Experimental Procedures." Repair was scored as described previously, and the amount of background repair observed in the absence of purified MutS protein was 0.3 fmol.

MutS501 and MutS506 Inhibit M13-fd RecA-catalyzed Strand Exchange-- To better define the mechanism behind the MutS,L block of RecA-mediated strand transfer, we examined the role of MutS ATPase activity in this process. Functional His₆-tagged MutS was therefore tested against the ATPase-defective mutants in the ability to block M13-fd exchange (13). As illustrated in Fig. 5., His₆-tagged wild type limits full-length heteroduplex formation at increasing MutS concentrations. This concentration-dependent block is in good agreement with previous studies on nontagged MutS and again illustrates no unusual perturbations due to the N-terminal histidines (34). Maximal inhibition was observed at a MutS to mismatch ratio of 1:2.5. MutS501 shows a similar ability to inhibit strand transfer as wild-type MutS. The extent of inhibition by MutS506, however, was down approximately 2-3-fold.

Effects of MutS,L on Homologous Exchange-- A concentration of MutS to mismatch of 1:4 yielded a 2-fold decrease in full-length heteroduplex. Consistent with previous studies (13), the rate of strand transfer between M13 and M13 was about 3 times faster than M13-fd (Fig. 6, a and b), thus illustrating that homology search by RecA is sensitive to non-Watson-Crick base pairing. M13 duplex was taken up by the RecA filamented single-stranded circular M13 within the first 10 min of incubation. The population of branched intermediates for M13-M13 exchange appeared more dispersed, indicating no barrier to branch migration. MutS failed to change this distribution in the homologous reaction (Fig. 6a), an observation consistent with the formation of normal canonical base pairing. Conversely, branched intermediates between M13 duplex and fd single-strands accumulated as a defined species that appeared to stabilize when MutS was present (Fig. 6b).

View larger version (89K): [in this window] [in a new window]   Fig. 6.   Effects of MutS,L on M13-M13 and M13-fd strand transfer. Reactions were carried out under standard conditions as described under "Experimental Procedures" and included (in a total volume of 80 µl) 14 µM M13 or fd single-stranded circular DNA; 10 µM M13 double-stranded DNA as indicated; 0.4 µM SSB; 2 mM ATP; and RecA, MutS, and MutL proteins as indicated. Aliquots were removed at the indicated times and quenched as described. The reactions contained the following DNA substrates. a, 14 µM M13 single-stranded DNA and 10 µM M13 double-stranded DNA; b, 14 µM fd single-stranded DNA and 10 µM M13 double-stranded DNA. Protein additions were as follows. control, RecA (6.6 µM) and His6-tagged MutS,L diluent buffer; +MutL, RecA, MutL, and MutS diluent buffer; +MutS, RecA, MutS, and MutL diluent buffer; +MutS,L, RecA protein. The mobilities of the following substrates and products are indicated: single-stranded circular DNA (ss); double-stranded linear duplex substrate DNA (ds); relaxed circular product DNA (full-length heteroduplex) (oc); three-stranded branched intermediates (bi).

View larger version (16K): [in this window] [in a new window]   Fig. 7.   Kinetics of strand transfer with MutS and MutL. Reaction conditions were the same as described in Fig. 6, a and b. Formation of open circular molecules was quantitated in the absence and presence of MutS and MutL proteins. Reactions contained the following DNA substrates: 14 µM M13 single-stranded DNA and 10 µM M13 double-stranded DNA (a); 14 µM fd single-stranded DNA and 10 µM M13 double-stranded DNA (b); , RecA; , RecA and MutL; , RecA and His6-tagged MutS; , RecA, His6-tagged MutS and MutL.

Effects of MutL on RecA-catalyzed Strand Transfer in the Presence of Mutants MutS501 and MutS506-- In examining the role of mismatch repair proteins in homeologous recombination, we tested the effects of MutS501 and MutS506 on both M13-M13 and M13-fd exchange in the presence of MutL. As illustrated in Fig. 8 and 9a, we observed that MutS501 inhibits M13-fd exchange similar to that observed for wild type. In contrast, the level of inhibition by MutS506 was down 2-fold (Fig. 9b). This inhibition of M13-fd exchange was dependent upon heteroduplex formation as both mutants contribute little to the block of M13-M13 strand transfer (data not shown).

View larger version (75K): [in this window] [in a new window]   Fig. 8.   Effects of MutS501 and MutS506 on M13-fd strand transfer. Reaction conditions were identical to those in Fig. 6b except with mutant proteins. The reactions included: RecA and His6-tagged MutS501 and MutL diluent buffer (+MutS501); RecA, His6-tagged MutS501 and MutL (+MutS501,L); RecA, His6-tagged MutS506 and MutL diluent buffer (+MutS506); RecA, His6-tagged MutS506 and MutL (+MutS506,L). The mobilities of the following substrates and products are indicated as in Fig. 6. Time points are as indicated.

View larger version (16K): [in this window] [in a new window]   Fig. 9.   Kinetics of M13-fd exchange with MutS501 or MutS506 and MutL. Reaction conditions were as described in Fig. 7. The formation of open circular molecules was quantitated in the absence and presence of MutS501 (a) or MutS506 (b) and MutL. , RecA protein; , RecA and MutL proteins; , RecA and His6-tagged MutS proteins; , RecA and His6-tagged MutS and MutL proteins.

Footprinting of Wild-type MutS, MutS501, and MutS506 at a Mismatch-- We further characterized the DNA binding properties of MutS501 and MutS506 using DNase I footprinting. Grilley et al. (20) showed that MutL will extend the MutS footprint at a G/T mispair in the presence of ATP. MutS501 protein retains its mismatch binding specificity and protects a region of ~20 base pairs spanning the G/T mismatch (Fig. 10a). This footprint is identical to that observed for wild type. Consistent with previous studies with gel retardation, MutS501 remained at the mismatch site in the presence of ATP. His₆-tagged wild-type MutS, however, does not protect against DNase I digestion in the presence of ATP (Fig. 10b). This observation is different from Grilley et al. (20) with nontagged MutS. We do, however, point out that in the studies of Grilley et al. they did observe a decrease in protection due to ATP. Evidence here and elsewhere suggests MutS leaves the mismatch in the presence of ATP (31).

View larger version (50K): [in this window] [in a new window]   Fig. 10.   Footprinting studies on wild-type MutS, MutS501, and MutS506. DNase I footprinting reactions were carried out as described under "Experimental Procedures" and contained (in a total volume of 15 µl) 200 fmol of DNA and MutS protein as follows (a). Each lane from left to right contained 0, 1, 5, and 10 pmol of wild type (lane 1); His6-tagged MutS (lane 2); MutS501 (lane 3); MutS506 (lane 4). b, reactions were performed as above with 5 pmol of both MutS and MutL proteins and 0.5 mM ATP. The arrows mark the site of the G/T mismatch. The brackets indicate the region of protection.

	DISCUSSION

Top Abstract Introduction Procedures Results Discussion References

Here, we present data that define the enzymatic properties of MutS mutants MutS501 and MutS506 in MMR and recombination. Gel retardation analysis shows both MutS501 and 506 retain the ability to bind mismatches. Indeed, MutS501 was as efficient as wild-type in binding a G/T mispair. MutS506 binding specificity, however, was reduced almost 3-fold. This difference in mismatch binding is consistent with the in vivo studies of Wu and Marinus (21), who showed repair of a 2-base deletion was more efficient in mutS501 than mutS506 mutant strains. That both mutS501 and mutS506 are dominant over wild type suggests mismatch binding is not the only criterion defining this phenotype. We do believe the results presented here offer a plausible explanation for the relative difference in repair efficiencies by these mutants (21).

The initial goal of these studies was to define the role of MutS,L during RecA-catalyzed strand transfer between closely related DNAs. Previous work has shown that the formation of mismatched base pairs in heteroduplex is modulated by MutS,L (13). In E. coli, MutS initiates repair by binding to the mismatch site. In subsequent steps, incision at a hemimethylated d(GATC) site is dependent upon MutS, MutL, MutH, and ATP hydrolysis. It is known that a persistent and strand-specific nick will direct repair and thus bypass the MutH requirement (15, 36, 38, 39). That MutS,L and ATP hydrolysis are still required for excision reflects an intimate interaction between these proteins in governing a repair event. In this study, we examined how these repair activities interact during strand transfer by examining the role of ATP hydrolysis by MutS in this process. We demonstrate that the extent of exchange between homeologous DNAs is affected by the ability of MutS to bind newly formed mismatches. More precisely, strand exchange between M13 and fd DNAs is hampered by both MutS501 and MutS506. Since both mutants have reduced ATPase activity (60-100-fold) and failed to leave the mismatch in the presence of ATP, we attribute this block of strand exchange to mismatch binding.

Based on studies from Cox (40, 41), RecA promotes the exchange of homologous DNAs at a rate of 350 bp min¹. Given the size of M13 phage DNA, RecA should drive the reaction to completion in approximately 18 min. Indeed, we observed 100% conversion of linear duplex to nicked circles between M13 DNAs in 20 min. The rate of branch migration for M13-fd exchange was slower at ~105 bp min¹. Because of this difference in rates, as manifested by regions of nonhomology, we believe MutS has time to test for the presence of non-Watson-Crick base pairing. Indeed, it would be fair to assume that mismatch binding interferes with normal RecA reassociation in regions where the density of mispairs is energetically unfavorable (13).

The effect by MutL on homologous strand transfer could result from MutS-dependent translocation along the DNA via a-shaped loop structures, a process that would help stabilize MutS,L on duplex DNA after mismatch binding. Recent studies from Allen et al. (31) are consistent with this idea. The rate of loop formation catalyzed by MutS and ATP increased 2-fold in the presence of MutL. Moreover, the ATPase-defective mutants MutS501 and MutS506 failed to show the enhanced block of full-length heteroduplex between M13 and fd DNAs in the presence of MutL. It appears the role of MutL is confined to a step following mismatch recognition and is probably coupled to MutS ATPase activity. DNase I footprinting studies presented here are consistent with this line of reasoning. Unlike wild-type MutS, both mutants failed to expand the region of nuclease protection in the presence of ATP and MutL. However, it is not immediately obvious whether binding or hydrolysis is required for MutL recruitment to the complex. MutS could in principle undergo a conformational change once ATP is bound. Mismatch binding would then be lost, and the hydrolytic step would ensure that MutS remains in this state, thus facilitating DNA translocation over mismatch recognition. It is also likely that MutL somehow contributes to this form of MutS by stabilizing the complex on duplex DNA (28). Taken together, these results suggest MMR exerts a similar strategy in testing for the occurrence of mismatched base pairs during RecA-catalyzed strand transfer.

Certainly, further studies are needed to help define other roles of mismatch repair in recombination. Based on studies in yeast S. cerevisiae two MutS homologues, MSH4 and MSH5 are implicated in meiotic recombination (42-44). Just recently, the human homologue of yMSH4 was identified (45). This, along with studies illustrating yMSH2-specific binding to Holliday junctions (46), could implicate further roles for mismatch repair in genome stability.