| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 37, 23952-23958, September 11, 1998
-Na,K-ATPase*
From the Department of Pediatrics, Division of Pediatric Nephrology, Yale University School of Medicine, New Haven, Connecticut 06520
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
Ankyrins are a family of adapter molecules that mediate linkages between integral membrane and cytoskeletal proteins. Such interactions are crucial to the polarized distribution of membrane proteins in transporting epithelia. We have cloned and characterized a novel 190-kDa member of this family from a rat kidney cDNA library, which we term AnkG190 based on the predicted size and homology with the larger neuronal AnkG isoform. AnkG190 displays a unique 31-residue amino terminus, a repeats domain consisting of 24 repetitive 33-residue motifs, a spectrin binding domain, and a truncated regulatory domain. Probes derived from the unique amino terminus hybridize to an 8-kilobase message exclusively in kidney and lung and specifically to the kidney outer medullary collecting ducts by in situ hybridization. Transfections of Madin-Darby canine kidney and COS-7 epithelial cell lines with a full-length AnkG190 construct result in (a) expression at the lateral plasma membrane, (b) functional assembly with the cytoskeleton, and (c) interaction with at least one membrane protein, the Na,K-ATPase. Two independent Na,K-ATPase binding domains on AnkG190 are demonstrated as follows: one within the distal 12 ankyrin repeats, and a second site within the spectrin binding domain. Thus, ankyrins may interact with integral membrane proteins in a pleiotropic manner that may involve complex tertiary structural determinants.
| |
INTRODUCTION |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
Interactions between integral membrane proteins and the underlying spectrin-based cytoskeleton play key roles in several cellular activities, including motility, contact, and the maintenance of polarized membrane domains (1-3). Ankyrins are a family of conserved proteins that have emerged as crucial adapter molecules mediating such linkages, since they possess binding sites for several integral membrane proteins as well as for cytoskeletal elements (4-6). Molecular cloning has identified three distinct genes, encoding for a variety of ankyrins that are expressed in vertebrates as tissue-specific and alternatively spliced isoforms. The ANK1 gene encodes for the 210- and 220-kDa Ank1 (also called AnkR) (see Refs. 6 and 12 for nomenclature) isoforms in red blood cells (7) and for multiple small isoforms in skeletal muscle (8). ANK2 encodes for a family of alternatively spliced brain isoforms referred to as Ank2 or AnkB (9, 10). ANK3 is a newly described ankyrin gene that transcribes several Ank3 isoforms that display a generalized tissue distribution (hence also termed AnkG). The largest AnkG protein described to date is a 480-kDa isoform localized at the axonal initial segment and Node of Ranvier (11). Alternatively spliced isoforms of this parent AnkG protein include a 215-kDa peptide encoded for by a 7-kb1 mRNA in mouse epithelial tissues (12), a Golgi-associated 116-kDa species (AnkG119) expressed predominantly in epithelial cells and muscle (13), and small 120/100-kDa Ank3 molecules associated with mouse macrophage lysosomes (14). Additional immunoreactive Ank3 isoforms at 200, 170, 120, and 105 kDa have been detected in mouse tissues, but incompletely characterized (12).
Such rich isoform diversity may be especially critical to the maintenance of a specific pattern of membrane protein distribution in polarized epithelial cells such as those lining various segments of the kidney tubules, each of which vectorially transports specific ions and nutrients. It is likely that such specialized tissues harbor additional isoforms of ankyrin. Indeed, antibodies raised against AnkR recognize a prominent 190-kDa ankyrin polypeptide in kidney tissue (13, 15-18), the primary structure of which is unknown. However, AnkR-deficient NB/NB mice continue to express the 190-kDa kidney ankyrin, indicating that the latter is encoded by a gene distinct from ANK1, presumably an ANK3 gene (4, 13, 19). Based on data obtained from cross-reacting antibodies, this 190-kDa isoform is thought to be distributed in a polarized fashion along the basolateral membranes of both native and cultured renal epithelial cells, where it colocalizes with spectrin and Na,K-ATPase (3, 4, 15-18). Importantly, the polarized distribution of ankyrin (and Na,K-ATPase) is markedly disrupted following an ischemic kidney injury and is restored following recovery (20, 21), suggesting an important role for the 190-kDa ankyrin in the generation and maintenance of renal cell polarity.
In this study, we describe the cDNA cloning and characterization of the 190-kDa ankyrin isoform from rat kidney, which we term AnkG190 based on its predicted size and homology to the 480-kDa neuronal AnkG isoform. AnkG190 displays a unique 31-residue amino terminus, a repeats domain consisting of 24 repetitive 33-residue motifs characteristic of ankyrins, a highly conserved spectrin binding domain, and a truncated regulatory domain. Complementary DNA probes derived from the unique amino terminus hybridize to an 8-kb message exclusively in kidney and lung, and cRNA probes derived from the same unique sequences hybridize specifically to kidney outer medullary collecting duct cells by in situ hybridization. Transfections of MDCK (Madin-Darby canine kidney) and COS-7 epithelial cell lines with full-length AnkG190 constructs result in (a) expression at the lateral membrane, (b) functional assembly with the cytoskeleton, and (c) interaction with at least one integral membrane protein, namely Na,K-ATPase. These findings significantly extend the known diversity of ankyrin isoforms, directly confirm the interaction of AnkG190 with Na,K-ATPase, and suggest that ankyrins may interact with integral membrane proteins in a complex, pleiotropic manner that requires complex tertiary structural determinants not easily deducible from the primary structure.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
Isolation of the AnkG190 cDNA-- All molecular biologic procedures were carried out using standard methods (22). Oligonucleotides bracketing a highly conserved 525-bp region extending from repeat 11 to 16 of human erythrocyte and brain ankyrins (7, 9, 10) were used in a high stringency PCR reaction (23), with rat kidney RNA reverse-transcribed with random hexamer priming and avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim) as template. The sense primer was GGCTTTACCCCCTTACACATCGCCTGCAAAAAGAAC and the antisense primer was CTTGGCCGCCACGTGCAGAGGGGTAAATCCTTTCTTGGT. This yielded a single 525-bp product which was subcloned into the TA vector (Invitrogen) and sequenced by the dideoxynucleotide chain termination method (U. S. Biochemical Corp.). Since its amino acid sequence was only about 55% homologous to previously described ankyrins (7, 9, 10), the PCR product was used to generate a random primed 32P-labeled probe to screen a rat kidney cDNA library at high stringency (Stratagene). Three full-length clones were isolated, which were identical in sequence and differed only in the length of the 5'-untranslated region; the largest clone was completely sequenced in both directions.
Northern Blot Analysis-- Oligonucleotides targeted to the unique amino terminus of AnkG190 (Fig. 1) were used in standard PCR reactions, with the full-length clone as template. The sense primer was GGAGACGCCGACCCGGGCGCAGAGCC (from within the 5'-untranslated region) and the antisense primer was TCGTGAATAACAGGATCCAAAGTCACCCTG (corresponding to residues 19-28). The 146-bp PCR product was sequenced to confirm its identity, labeled with 32P and random primers, and hybridized to a rat multiple tissue Northern blot (CLONTECH) at high stringency. Following detection of hybridized messages by autoradiography, the blot was stripped and probed with a previously described PCR product corresponding to residues 1254-1340 of AnkG190; these residues represent a very highly conserved region within the spectrin binding domain of ankyrins (13). Finally, the blot was probed with actin as a control for RNA loading.
In Situ Hybridization--
In situ hybridizations
were performed as described previously (34). The 146-bp PCR product
containing sequences unique to AnkG190 was subcloned into
the TA vector (Invitrogen) in both directions, to yield sense and
antisense constructs. 35S-Labeled antisense and sense cRNA
probes were generated by linearizing the constructs with the
appropriate restriction endonuclease, followed by in vitro
transcription with T7 RNA polymerase (Promega, Madison, WI) in the
presence of [35S]
-thio-UTP (NEN Life Science Products,
1100 Ci/mmol).
80 °C. For prehybridization, slides were warmed to room
temperature and fixed in fresh 4% paraformaldehyde, pH 7, in PBS
treated with 0.1% diethylpyrocarbonate (PBS-DEPC). Slides were rinsed
in PBS-DEPC (2 × 5 min), deproteinated in 0.2 N HCl
for 20 min, rinsed in PBS-DEPC (1 × 5 min), and acetylated by
immersion in 0.1 M triethanolamine in DEPC/water (pH 8.0, 2 min), followed by addition of acetic anhydride (final concentration of
0.25%) for 10 min. Slides were then rinsed in PBS-DEPC (1 × 5 min), dehydrated through ascending alcohols, air-dried, and used
immediately. For hybridization, sections were covered with 40 µl of
hybridization buffer containing 1.5 × 107 cpm
probe/ml. The hybridization buffer contained 50% formamide, 10% w/v
dextran sulfate, 2× Denhardt's solution (0.04% each
polyvinylpyrrolidone, bovine serum albumin, Ficoll), 0.9 M
NaCl, 50 mM NaH2PO4, 5 mM EDTA, 0.1% SDS, 100 mM dithiothreitol, 500 µg/ml herring sperm DNA, 500 µg/ml yeast total RNA. Sections were
then covered with glass coverslips and placed in humidified chambers
overnight at 53 °C. The following morning, the coverslips were
removed in 2× SSC, and the slides were washed in 2× SSC (30 min, room
temperature), incubated in RNase A (10 µg/ml in 0.5 M
NaCl, 10 mM Tris-HCl, pH 8) for 60 min at 37 °C, and
washed in 2× SSC (30 min, room temperature), 0.1× SSC (twice for 30 min at 53 °C), and 0.1× SSC (twice for 30 min at room temperature).
Slides were then dehydrated through ascending alcohols containing 0.3 M ammonium acetate and air-dried. Film autoradiograms were
generated by apposing slides to Kodak SB-5 x-ray film for 7 days.
Transfection of AnkG190 Constructs-- PCR techniques were utilized to create a series of AnkG190 expression constructs, each containing the eight-residue FLAG tag (IBI Biosystems) added to the carboxyl terminus. Primers were targeted to AnkG190 residues as shown in Fig. 7A; the FLAG sequence and a stop codon were added to the 3' end of each antisense primer. PCR products were verified by sequencing, subcloned into the pcDNA3 eukaryotic expression vector (Invitrogen), and transfected into MDCK and COS-7 cells either transiently or stably with G418 (400 µg/ml) selection (Life Technologies, Inc.). Subconfluent cells were exposed to the DNA-LipofectAMINE complex in Opti-MEM (Life Technologies, Inc.) for 6 h, and the transiently transfected cells were analyzed upon reaching confluence, after an additional 48 h incubation in normal growth medium.
Extractions, Immunofluorescence, and Immunoprecipitations-- Both MDCK and COS-7 cells, transiently transfected with FLAG-tagged full-length AnkG190 in pcDNA3, were grown to confluence in 150-cm2 culture flasks in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and sequentially extracted in situ as described (13, 19). Briefly, cells were first extracted for 10 min at 4 °C in buffer 1 (yielding fraction 1) containing 10 mM Pipes, pH 6.8, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 0.5% Triton X-100, and protease inhibitors. The second extraction (yielding fraction II) was for 20 min at 4 °C in buffer 2 containing 250 mM ammonium sulfate instead of NaCl and 1% Triton X-100. Equal amounts of total proteins in each extract were analyzed by SDS-PAGE and Western blotting with various antibodies, to determine their distribution in the soluble (fraction 1) or cytoskeletal (fraction 2) fractions.
MDCK cells stably transfected with the full-length AnkG190-FLAG fusion construct were grown to confluence on coverslips and processed for indirect immunofluorescence microscopy as described (19, 24). All incubations were at room temperature. Cells were washed with PBS, fixed, and permeabilized with 100% acetone for 20 min, blocked with normal goat serum for 60 min, and incubated first with the M2 monoclonal antibody against FLAG (IBI Biosystems) for 1 h and then with rhodamine-conjugated goat anti-mouse secondary antibody for 30 min (Amersham Pharmacia Biotech). The coverslips were mounted on slides with Crystalmount (Biomeda) and viewed with a microscope equipped for epilumination (IX70, Olympus). COS-7 cells transiently transfected with each of the five AnkG190 constructs were grown to confluence in six-well plates and processed for immunoprecipitations as described (24). Cells were lysed for 20 min at 4 °C in 2 ml of IP buffer (10 mM Tris-HCl, pH 7, 150 mM NaCl, 5 mM EDTA, 1 mM EGTA, 0.5% deoxycholate, 1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM Pefablock), the lysate was centrifuged for 1 min at 10,000 × g, and precleared by a 60-min incubation at 4 °C with 25 µl of nonimmune serum and 200 µl of a 50% protein A-Sepharose solution (Amersham Pharmacia Biotech). The cleared supernatant was incubated for 4 h at 4 °C with 10 µg of the M2 monoclonal antibody against FLAG and for an additional 2 h at 4 °C with 200 µl of a 50% protein A-Sepharose solution. The lysate was centrifuged for 1 min at 10,000 × g, washed three times with IP buffer, and the pellet subjected to SDS-PAGE and Western analysis with a monoclonal antibody against-Na,K-ATPase
(Upstate Biotechnology).
Other Methods--
The isolation of total RNA from rat kidney
used standard methods (25). SDS-PAGE and Western blotting were as
described (26). Immunodetection of transferred proteins was by enhanced
chemiluminescence (Amersham Pharmacia Biotech). Antibody to
nonerythroid spectrin (
II) was a kind gift from Dr. Jon Morrow (Yale
University). Antibody to AnkG119 (Golgi ankyrin) has been
previously characterized (13, 24).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
Isolation and Characterization of a Novel Ankyrin (AnkG190) from Rat Kidney-- A comparison of cDNA sequences encoding human erythrocyte (7, 27) and brain (10) ankyrins revealed a region of high conservation extending from repeat 11-16. Oligonucleotides bracketing this region were used in a PCR reaction with reverse-transcribed rat kidney RNA as template, yielding a 525-bp PCR product whose amino acid sequence was only 55% homologous to red cell or brain ankyrin. Using the PCR product as a probe, three full-length clones were isolated from a rat kidney cDNA library, which were identical in sequence and differed only in the length of the 5'-untranslated region. The largest clone provided a 6134-bp contiguous cDNA sequence for AnkG190 (Fig. 1, GenBankTM accession number AF069525), with a putative polyadenylation signal (AATAAA) upstream of the poly(A)+ tail, and a single open reading frame encoding for a protein of 1763 amino acids with a predicted mass of 190 kDa. We term this protein AnkG190, based on its predicted size and homology to the 480-kDa neuronal AnkG isoform (10). Compared with AnkG480, AnkG190 possesses a unique 31-residue amino terminus, and is over 95% homologous within the repeats domain and spectrin binding domain; however, it is devoid of the large serine-rich region characteristic of the regulatory domain of AnkG480 (Fig. 2). Sequence searches with GenBankTM reveal that rat AnkG190 is only 80% homologous to mouse epithelial ankyrin (Ank3), with significant sequence diverge not only in the unique amino-terminal residues but also within the regulatory domain, where rat AnkG190 is completely devoid of a 197-residue motif present in mouse Ank3 (12). Rat AnkG190 is only 55-60% homologous to human red cell or human brain ankyrins. Nevertheless, AnkG190 retains the domain structure of ankyrins, with a characteristic repeats domain of 24 repetitive 33-residue motifs, a highly conserved spectrin binding domain, and a truncated regulatory domain (compared with AnkG480 and mouse Ank3, Fig. 2).
|
|
AnkG190 Is Expressed Exclusively in Kidney and
Lung--
High stringency rat multiple tissue Northern blot analysis
with cDNA probes derived from the unique amino terminus of
AnkG190 identified a single 
8-kb message exclusively in
kidney and lung (Fig. 3A).
Hybridization of the same blot with a cDNA probe targeted to a
highly conserved region within the spectrin binding domain yielded the
same 8-kb message in kidney and lung, with additional smaller
transcripts in the 4.5-6-kb range, as described previously (11-13).
Somewhat larger isoforms were detected in skeletal muscle, heart, and
brain (multiple transcripts) only with the probe from the spectrin
binding domain. Hybridization with actin revealed approximately equal
loading of message in all lanes (not shown). Collectively, these data
suggest that AnkG190 is an alternatively spliced,
tissue-specific isoform of the Ank3 family.
|
AnkG190 Is Expressed by the Outer Medullary Collecting Duct Cells of the Rat Kidney-- In situ hybridization of rat kidney tissue sections with an antisense cRNA probe generated from the unique amino-terminal sequences of AnkG190 showed that it is distributed primarily in the outer medullary region, indicating that it is expressed by the outer medullary collecting duct cells (Fig. 4). The sense cRNA probes did not hybridize at all to the same region (not shown). These results are comparable to those recently obtained for mouse epithelial Ank3, the expression of which was found to be predominantly in the outer medullary collecting ducts (12).
|
AnkG190 Assembles with the Cytoskeletal Fraction, at
the Lateral Membrane of Transfected Cells--
Since antibodies that
specifically recognize AnkG190 were not available, we used
transfected MDCK (dog kidney collecting duct cell line) and COS-7
(monkey kidney) cells to examine the biochemical and cellular
properties of an AnkG190-FLAG fusion construct. In situ extraction (13, 19) followed by Western blot analysis with
FLAG antibody revealed that in both cell types, the transiently or
stably transfected AnkG190 assembled predominantly in
fraction II, or the Triton-inextractable, cytoskeletal fraction (Fig.
5). In the same cells, a similar
segregation into fraction II was also detected for native nonerythroid
spectrin and -Na,K-ATPase. In contrast, the Golgi-associated ankyrin
(AnkG119) in these cells was exclusively found in the
soluble fraction I, as previously reported (13).
|
-Na,K-ATPase were also predominantly localized to the lateral
membrane in these cells, as expected (not shown) (13, 16).
|
AnkG190 Interacts with -Na,K-ATPase via Its Distal
12 Repeats and Spectrin Binding Domains--
Given the association of
AnkG190 with the plasma membrane by extractions and
immunofluorescence, and the putative role of ankyrins as molecules
linking integral membrane proteins (such as Na,K-ATPase) with the
underlying cytoskeleton, it was of interest to demonstrate a functional
interaction between AnkG190 and Na,K-ATPase. Indeed,
immunoprecipitations with FLAG antibody of COS-7 cells transiently
transfected with the full-length AnkG190-FLAG fusion construct (construct I, Fig.
7A), followed by Western
analysis with antibody against -Na,K-ATPase, revealed a functional
complex between these proteins. Furthermore, a similar analysis using a
series of AnkG190 constructs showed that both the distal 12 repeats (construct III) and the spectrin binding
domain (construct IV) were capable of interacting with
-Na,K-ATPase, whereas the proximal 12 repeats and the regulatory
domain were devoid of Na,K-ATPase binding activity.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
Ankyrins are critical adapter molecules that are thought to
maintain the polarized distribution of integral membrane proteins by
mediating their linkage with the underlying spectrin-based cytoskeleton
(4-6). Renal epithelial cells express a prominent 190-kDa ankyrin
polypeptide (13, 15-18); data with cross-reacting antibodies have
suggested that it co-distributes with spectrin and Na,K-ATPase along
the basolateral membrane (3, 4, 15-18, 20, 21). The present study
identifies the primary structure of this novel ankyrin which is
expressed exclusively in kidney and lung, termed AnkG190
based on its predicted size and homology to the larger neuronal
AnkG isoform (10). AnkG190 displays a unique
amino terminus, a highly conserved repeats domain and spectrin binding
domain, and a truncated regulatory domain. AnkG190 is expressed primarily by the outer medullary collecting duct cells in rat
kidney. In cultured epithelial cells, AnkG190 assembles predominantly with the Triton-inextractable cytoskeletal fraction at
the lateral plasma membrane and forms a functional complex with
-Na,K-ATPase.
Interactions between ankyrin and several integral membrane proteins
have been documented, and the structural basis of some such linkages
have been identified. The initial cloning and characterization of red
cell ankyrin, and the elucidation of its characteristic repeats domain
of 24 tandemly arrayed 33-residue motifs (7, 27), lead to the postulate
that different repeats, singly or in combination, constitute the
binding sites for integral membrane proteins. Recent evidence suggests
that this membrane binding domain consists of four independently folded
subdomains of six repeats each (28). Thus, in in vitro
assays, both the voltage-dependent sodium channel (29) and
the anion exchanger (30-32) bind red cell ankyrin predominantly via
the distal 12 repeats, whereas neurofascin appears to interact
independently with both repeats 7-12 as well as repeats 13-24 (32).
However, previous in vitro competition assays have shown
that the spectrin binding domain of red cell ankyrin can also associate
with liposomes containing Na,K-ATPase (31). Our studies demonstrate for
the first time that AnkG190, the isoform of ankyrin
associated with the plasma membrane of polarized kidney epithelial
cells, forms a functional immunoprecipitable complex with
-Na,K-ATPase in vivo. Furthermore, we show that two
distinct ankyrin domains, namely the distal 12 ankyrin repeats as well
as the spectrin binding domain, are capable of this interaction
in vivo, whereas the proximal 12 repeats and the regulatory
domains are devoid of Na,K-ATPase binding ability. These results are
compatible with previous findings that both red cell and kidney
ankyrins bind to two distinct cytoplasmic domains of -Na,K-ATPase
(19, 33). Furthermore, our results provide a structural basis for the
ability of even significantly truncated ankyrin isoforms, such as the
Golgi-associated AnkG119 (which contains only the distal 12 ankyrin repeats and a diminutive regulatory domain), to not only bind
Na,K-ATPase but indeed to mediate its trafficking from endoplasmic
reticulum to Golgi apparatus (13, 24).
In summary, ankyrins interact with integral membrane proteins such as Na,K-ATPase in a complex, pleiotropic manner that requires recognition of multiple binding sites on both ligands. Such combinatorial complexity presumably allows not only for the acquisition of the high binding affinities that characterize ankyrin-Na,K-ATPase interactions (16, 19, 31) but also for the ability of ankyrins to accommodate an increasing number of integral membrane proteins and sequester them into specialized domains of polarized epithelial cells. With the kidney AnkG190 clone in hand, it will be important in future studies to determine the minimal Na,K-ATPase-binding residues on ankyrin, the relative contribution of the two independent binding sites, and the consequences of interference with this binding on the generation and maintenance of polarized distribution of Na,K-ATPase in epithelial cells.
| |
ACKNOWLEDGEMENT |
|---|
We are grateful to Dr. Jon Morrow for the antibody to fodrin and for insightful discussions.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant R29-DK47072 and by a Grant-in-Aid from the American Heart Association, Connecticut Affiliate (to P. D.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF069525.
To whom correspondence should be addressed. Present address:
Pediatric Nephrology, Albert Einstein College of Medicine, Montefiore Medical Center, 111 East 210th St., Bronx, NY 10467.
The abbreviations used are: kb, kilobase pair(s); MDCK, Madin-Darby canine kidney; PCR, polymerase chain reaction; bp, base pair(s); PBS, phosphate-buffered saline; DEPC, diethylpyrocarbonate; PAGE, polyacrylamide gel electrophoresis; Pipes, 1,4-piperazinediethanesulfonic acid.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. Kizhatil, J. Q. Davis, L. Davis, J. Hoffman, B. L. M. Hogan, and V. Bennett Ankyrin-G Is a Molecular Partner of E-cadherin in Epithelial Cells and Early Embryos J. Biol. Chem., September 7, 2007; 282(36): 26552 - 26561. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Cunha and P. J. Mohler Cardiac ankyrins: Essential components for development and maintenance of excitable membrane domains in heart Cardiovasc Res, July 1, 2006; 71(1): 22 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Khundmiri, E. J. Weinman, D. Steplock, J. Cole, A. Ahmad, P. D. Baumann, M. Barati, M. J. Rane, and E. Lederer Parathyroid Hormone Regulation of Na+,K+-ATPase Requires the PDZ 1 Domain of Sodium Hydrogen Exchanger Regulatory Factor-1 in Opossum Kidney Cells J. Am. Soc. Nephrol., September 1, 2005; 16(9): 2598 - 2607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lopez, S. Metral, D. Eladari, S. Drevensek, P. Gane, R. Chambrey, V. Bennett, J.-P. Cartron, C. Le Van Kim, and Y. Colin The Ammonium Transporter RhBG: REQUIREMENT OF A TYROSINE-BASED SIGNAL AND ANKYRIN-G FOR BASOLATERAL TARGETING AND MEMBRANE ANCHORAGE IN POLARIZED KIDNEY EPITHELIAL CELLS J. Biol. Chem., March 4, 2005; 280(9): 8221 - 8228. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. K. Mosavi, T. J. Cammett, D. C. Desrosiers, and Z.-y. Peng The ankyrin repeat as molecular architecture for protein recognition Protein Sci., June 1, 2004; 13(6): 1435 - 1448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kizhatil and V. Bennett Lateral Membrane Biogenesis in Human Bronchial Epithelial Cells Requires 190-kDa Ankyrin-G J. Biol. Chem., April 16, 2004; 279(16): 16706 - 16714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lencesova, A. O'Neill, W. G. Resneck, R. J. Bloch, and M. P. Blaustein Plasma Membrane-Cytoskeleton-Endoplasmic Reticulum Complexes in Neurons and Astrocytes J. Biol. Chem., January 23, 2004; 279(4): 2885 - 2893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Del Rio, A. Imam, M. DeLeon, G. Gomez, J. Mishra, Q. Ma, S. Parikh, and P. Devarajan The Death Domain of Kidney Ankyrin Interacts with Fas and Promotes Fas-Mediated Cell Death in Renal Epithelia J. Am. Soc. Nephrol., January 1, 2004; 15(1): 41 - 51. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Woroniecki, J. R. Ferdinand, J. S. Morrow, and P. Devarajan Dissociation of spectrin-ankyrin complex as a basis for loss of Na-K-ATPase polarity after ischemia Am J Physiol Renal Physiol, February 1, 2003; 284(2): F358 - F364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Gagelin, B. Constantin, C. Deprette, M.-A. Ludosky, M. Recouvreur, J. Cartaud, C. Cognard, G. Raymond, and E. Kordeli Identification of AnkG107, a Muscle-specific Ankyrin-G Isoform J. Biol. Chem., April 5, 2002; 277(15): 12978 - 12987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Bennett and A. J. Baines Spectrin and Ankyrin-Based Pathways: Metazoan Inventions for Integrating Cells Into Tissues Physiol Rev, July 1, 2001; 81(3): 1353 - 1392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Williams, W. Resneck, T Kaysser, J. Ursitti, C. Birkenmeier, J. Barker, and R. Bloch Na,K-ATPase in skeletal muscle: two populations of beta-spectrin control localization in the sarcolemma but not partitioning between the sarcolemma and the transverse tubules J. Cell Sci., January 2, 2001; 114(4): 751 - 762. [Abstract] [PDF]
|
|
|
|
|
|
J. G. J. Hoenderop, P. H. G. M. Willems, and R. J. M. Bindels Toward a comprehensive molecular model of active calcium reabsorption Am J Physiol Renal Physiol, March 1, 2000; 278(3): F352 - F360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. De Matteis and J. Morrow Spectrin tethers and mesh in the biosynthetic pathway J. Cell Sci., January 7, 2000; 113(13): 2331 - 2343. [Abstract] [PDF]
|
|
|
|
 |
|
 A. M. Kachinsky, S. C. Froehner, and S. L. Milgram A PDZ-containing Scaffold Related to the Dystrophin Complex at the Basolateral Membrane of Epithelial Cells J. Cell Biol., April 19, 1999; 145(2): 391 - 402. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||
