![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 37, 24065-24074, September 11, 1998
-Hydroxylase Gene*
From the Department of Biochemistry and Molecular Biology, Oregon Health Sciences University, L224, Portland, Oregon 97201
| |
ABSTRACT |
|---|
|
|
|---|
Neurotransmitter biosynthesis is regulated by
environmental stimuli, which transmit intracellular signals via second
messengers and protein kinase pathways. For the catecholamine
biosynthetic enzymes, dopamine
-hydroxylase and tyrosine
hydroxylase, regulation of gene expression by cyclic AMP, diacyl
glycerol, and Ca2+ leads to increased
neurotransmitter biosynthesis. In this report, we demonstrate that the
cAMP-mediated regulation of transcription from the dopamine
-hydroxylase promoter is mediated by the AP1 proteins c-Fos, c-Jun,
and JunD. Following treatment of cultured cells with cAMP, protein
complexes bound to the dopamine
-hydroxylase AP1/cAMP response
element element change from consisting of c-Jun and JunD to include
c-Fos, c-Jun, and JunD. The homeodomain protein Arix is also a
component of this DNA-protein complex, binding to the adjacent
homeodomain recognition sites. Transfection of a dominant negative JunD
expression plasmid inhibits cAMP-mediated expression of the dopamine
-hydroxylase promoter construct in PC12 and CATH.a cells. In
addition to the role of c-Fos in regulating dopamine
-hydroxylase
gene expression in response to cAMP, a second pathway, involving
Rap1/B-Raf is involved. These experiments illustrate an unusual
divergence of cAMP-dependent protein kinase signaling
through multiple pathways that then reconverge on a single element in
the dopamine
-hydroxylase promoter to elicit activation of gene
expression.
| |
INTRODUCTION |
|---|
|
|
|---|
The interaction of extracellular factors with the endogenous
transcriptional machinery is thought to be essential for
phenotype-specific gene expression involved in differentiation and
normal function of neurons. In the case of neural crest cell
differentiation, growth factors in the embryonic environment are
thought to induce expression of proneural transcription factors, which
activate genetic pathways necessary for driving expression of
pan-neuronal and phenotype-specific genes (1, 2). The genetic pathways involved in expression of neuronal phenotype genes are likely subject
to regulation by extracellular factors. The paired-like homeodomain
transcription factor, Arix/Phox2a, is a component of a genetic pathway
involved in regulation of some phenotype-specific characteristics in
cultured neural crest cells (2). We have demonstrated a role for this
homeodomain protein in regulating second messenger-mediated stimulation
of catecholaminergic neurotransmitter biosynthetic genes dopamine
-hydroxylase (DBH)1 and
tyrosine hydroxylase (TH) (3). These enzymes are critical in the
biosynthesis pathway of catecholamine neurotransmitters dopamine and
norepinephrine, and their expression defines an adrenergic neuronal
phenotype. Taken together these studies outline a putative pathway for
extracellular signal regulation of phenotype-specific gene expression.
Therefore, studies that further define the interaction of the cellular
transcriptional machinery with second messenger pathways are needed to
provide a framework for understanding the mechanisms underlying
regulation and maintenance of neuronal phenotype and function.
The transcriptional changes resulting from environmental stimuli are
believed to be mediated through ligand and second messenger stimulation
of protein phosphorylation cascades. Many neurotransmitter biosynthetic
genes are transcriptionally responsive to activation of protein kinase
A (via cyclic AMP) and protein kinase C (via diacyl glycerol). A
consensus cyclic AMP response element (CRE), containing the core
sequence TGACGTCA, is found on several neurotransmitter biosynthetic
genes, including TH, corticotropin-releasing hormone, and somatostatin
(4-6). The consensus CRE is recognized by the CREB/ATF family of
transcription factors (reviewed in Ref. 7). Similarly, a consensus AP1
site, containing a core sequence TCA(C/G)TCA and responsive to phorbol
esters or other agents that elevate diacyl glycerol, is present on both
the TH and VIP genes (8, 9). The AP1 site is recognized by members of
the Fos and Jun family of transcription factors. On the genes
containing two defined AP1 and CRE regulatory elements, the AP1 and CRE
sites are physically separate, and each effector may stimulate
transcription independently. In contrast, at least three
neurotransmitter biosynthetic genes contain a composite CRE/AP1 site,
which is responsive to both cAMP and phorbol ester mediated
transcriptional activation. In these genes, dopamine
-hydroxylase,
proenkephalin, and prodynorphin, the core CRE/AP1 site, TGCGTCA,
contains elements of both the consensus CRE and AP1 sites (10-13).
This composite CRE/AP1 site will bind to both CREB/ATF and AP1 family
members, and the components of the DNA-protein complex may be dependent
upon the cell type or environment. For example, the proenkephalin CRE
interacts preferably with CREB in nuclear extracts from the striatum,
while in adrenal medulla extracts it appears that AP1 complexes
predominate (14-16).
As with other neurotransmitter biosynthetic genes, dopamine
-hydroxylase is expressed in a tissue-specific pattern and is responsive to environmental stimuli. Within the rat dopamine
-hydroxylase promoter proximal segment both the cell type
specificity and second messenger responsiveness are controlled through
one regulatory element, the DB1 enhancer (10). This enhancer consists
of the above mentioned CRE/AP1 site located directly adjacent to two core homeodomain protein recognition sites (HD). The DB1 element interacts with the homeodomain transcription factor Arix/Phox2a (17),
which plays a role in determining the noradrenergic phenotype (18).
Forced expression of Arix in a cell, in and of itself, does not
stimulate dopamine
-hydroxylase gene expression (2, 17). Regulation
of dopamine
-hydroxylase gene transcription in the presence of Arix
requires simultaneous activation of the cAMP/PKA pathway (3).
Therefore, the cell selective regulation of dopamine
-hydroxylase
promoter activation likely involves the interaction of the Arix with
second messenger regulated transcription factors.
The identity of the transcription factors which interact at the AP1/CRE
component of the DB1 element is essential to further understanding the
biochemical mechanisms by which these AP1/CRE transcription factors
interact with Arix to influence cellular neurotransmitter phenotype. In
previous studies, the AP1/CRE element has been shown to interact with
members of the CREB/ATF family, including CREB, CREM, and ATF-1, in
extracts from catecholaminergic cells (3, 19). In addition, a dominant
negative mutant of CREB blocked approximately 50% of PKA induction of
a dopamine
-hydroxylase reporter gene. However, other aspects of the
analysis suggested that the CREB/ATF factors were not the primary
components of the DB1 binding complex. Only a small portion of the
DNA-protein complex was reactive with anti-CREB or anti-CREM sera, and
the entire complex was disrupted by antisera to Fos and Jun family members. In the study reported here, we have further evaluated the role
of the AP1 factors in mediating the cAMP response of the dopamine
-hydroxylase gene, and have evidence that these factors do, in fact,
play a major role. This is one of the first demonstrations where AP1
factors directly mediate a cAMP response.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Cell Culture-- The PC12 cells used in these experiments were subclone GR5, isolated by Dr. Rae Nishi at the Oregon Health Sciences University. PC12-GR5 cells are cultured in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum (Hyclone). CATH.a cells were cultured in RPMI medium containing 8% horse serum and 4% fetal bovine serum. PC12 cells were originally cloned from a pheochromocytoma (20), while the catecholaminergic CATH.a cells were derived from a tumor within the mouse central nervous system (21). HepG2 hepatoma cells are cultured in minimum Eagle's medium plus 10% fetal bovine serum, 1% nonessential amino acids, and 110 mg/liter sodium pyruvate. All cells are cultured in an atmosphere of humidified air containing 5% CO2.
Plasmid Constructs--
The construction of plasmids containing
the promoter and 5'-flanking sequence of TH and dopamine
-hydroxylase genes cloned adjacent to the bacterial chloramphenicol
acetyltransferase (CAT) transcription unit has been described
previously (4, 10). Plasmids containing point mutations of the TH
promoter region were a generous gift from Dr. Dona Chikaraishi (22),
while the plasmid with a deletion in the AP1 site of the TH promoter
construct was a gift from Dr. Ed Ziff (23). RSV-Arix contains Arix
cDNA sequence 1-1353, which includes all 5'-untranslated and
protein-coding sequences and 313 bases of the Arix 3'-untranslated
sequence (17). This cDNA segment is cloned into pSPRSV, where Arix
transcription is under control of the Rous sarcoma virus promoter and
enhancer elements and is followed by a poly(A) addition signal from
SV40 (10, 17).
Transfections and Stimulation of Cultures-- DNA used for transfection was purified using the Promega Wizard kit. Following purification according to the manufacturer's procedures, DNA was precipitated from ethanol in the presence of ammonium acetate. PC12 cell cultures, in 100-mm culture dishes, were transfected with 15-23 µg of DNA using calcium phosphate, as described previously. CATH.a cell cultures were transfected with 8-11 µg of DNA using the cationic lipid, PFx 6 (Invitrogen), at a DNA:lipid ratio of 1:3, following the procedure supplied by the manufacturer. Cell cultures contained 3-6 × 106 cells/dish. All transfections contained 1-3 µg of pRSV-luciferase to verify success of transfection. Cells were harvested 2 days after transfection, and aliquots of cell extracts were assayed for protein content, CAT activity (28), and luciferase activity (29). CAT activity is standardized to co-transfected luciferase, except when cAMP analogs or RSV-PKA are used. Previous experimental results indicated a stimulatory effect of cAMP and PKA on the RSV promoter of RSV-luciferase.2 For experiments using cAMP or PKA, CAT activity is standardized to total extract protein.
In experiments using inducers, these agents were added 18 h before harvesting of cells. PC12 and CATH.a cells were treated with 200 µM 8-(4-chlorophenylthio)-adenosine 3':5'-cyclic monophosphate (CPT-cAMP). For some experiments, phorbol 12-myristate 13-acetate (PMA) was added to cultures either alone or with CPT-cAMP at a concentration of 20 nM.Preparation of Nuclear Extracts and Electrophoretic Mobility
Assay (EMSA)--
Crude nuclear extracts were made from PC12, CATH.a,
and HepG2 cells following the method of Dignam et al. (30)
modified by a high salt (0.6 M KCl) extraction of the
nuclear pellet (as described by Ausbel (31). Additionally, all buffers
used contained Pefbloc (0.2 mg/ml; Boehringer Mannheim), leupeptin (0.5 µg/ml), and pepstatin (0.7 µg/ml) as protease inhibitors and NaF
(10 mM) as a phosphatase inhibitor. The nuclear extracts
were dialyzed against nuclear extract buffer, consisting of 20 mM HEPES (pH 7.9), 20% glycerol, 0.1 M KCl,
0.2 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and 10 mM NaF.
Protein concentration of each nuclear extract was determined by
Bradford assay (Bio-Rad), and aliquots were frozen and stored at
70 °C.
-32P]ATP, then annealed.
The EMSA reactions were carried out in a 20-µl final volume
containing 12.5 mM HEPES (pH 7.9), 10% glycerol, 5 mM MgCl2, 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, and 2 µg of
poly(dI-dC)·poly(dI-dC). Nuclear extract protein concentrations were
adjusted to 1.7 µg/µl with nuclear extract buffer. Labeled probe
(10,000-25,000 cpm Cherenkov counts) was added to the reaction buffer
containing 5 µg of nuclear extracts and incubated for 30 min at room
temperature. For competition EMSAs, reaction mixtures containing
nuclear extracts were preincubated for 20 min in the presence of
double-stranded competitor oligonucleotides (200 ng) prior to
incubation with the labeled oligonucleotide probe. Samples were
carefully loaded to minimize mixing, and the complexes were resolved on
6% nondenaturing polyacrylamide gels (19:1 acrylamide:bisacrylamide) using an electrophoresis buffer containing 45 mM Tris
borate and 1 mM EDTA. The gels were dried, and protein-DNA
complexes were visualized autoradiographically. The sequences of the
wild type and mutant oligonucleotides used in this study are as
follows, (lowercase letters signifying the mutation): wild type DB1,
ATGTCCATGCGTCATTAGTGCAATTAGGG; CR/APm, ATGTCCAgagcTCATTAGTGCAATTAGGG;
and the 2HDm, ATGTCCATGCGTCATacGTGCAccTAGGG.
Antibody Supershift Assays--
In order to identify protein
constituents of EMSA complexes, antisera broadly reactive against Fos
and Jun family members or antisera reactive with specific family
members, were tested in EMSA reactions. Nuclear extracts and reaction
buffer components were preincubated together with 4 µg of
affinity-purified IgG for 20 min at room temperature prior to a 30-min
incubation with labeled probe and separated by electrophoresis as
described above. The following is a list of antisera purchased from
Santa Cruz Biotechnology, Inc. and used in the study to characterize
AP1 proteins in EMSA:
Fos (sc-253x) Fos family-reactive rabbit
polyclonal IgG against amino acids 128-152 of human c-Fos p62; c-Fos
(sc-52x) c-Fos-specific rabbit IgG against amino acids 3-16 of the
human c-Fos gene; Fra-1 (sc-183x) rabbit IgG directed against amino acids 3-22, unique to the amino terminus of mouse Fra-1; Fra-2 (sc-57x) rabbit IgG directed against amino acids 285-299 of the chicken Fra-2 gene product (common to rat and human genes);
Jun (sc-44x) Jun-family reactive rabbit polyclonal IgG against amino acids
247-263 of mouse c-Jun p39; c-Jun (sc-45x) c-Jun-specific rabbit IgG
against amino acids 91-105 of the mouse c-Jun; JunD (sc-74)
JunD-specific rabbit IgG against amino acids 329-341 of the mouse
JunD; JunB (sc-46x) JunB-specific rabbit IgG against amino acids 45-61
of the mouse JunB.
Arix Antisera Production and Purification-- Arix antisera was raised by immunizing rabbits with a C-terminal peptide of Arix, containing the sequence YFHRKPGPALKTNLF, conjugated to keyhole limpet hemocyanin. Antisera was prepared by Atlantic Antibodies, Windham, ME. The serum was affinity-purified with a form of recombinant Arix containing the homeodomain and C-terminal portion fused to glutathione S-transferase, using the method described by Youssoufian (32).
Western Blot Analysis-- Nuclear extracts from PC12 cells from untreated or treated cultures were analyzed for c-Fos immunoreactivity by Western blot analysis. 10 µg of nuclear extracts were separated on 10% acrylamide SDS-polyacrylamide gel electrophoresis gels and transferred to nitrocellulose. c-Fos-specific immunoreactivity was identified using the c-Fos-specific (sc-52) antisera followed by enhanced chemilumiscent detection (Renaissance, NEN Life Science Products) and exposure to x-ray film.
| |
RESULTS |
|---|
|
|
|---|
AP1 Proteins Bind to DB1--
The AP1/CRE site of the dopamine
-hydroxylase gene lies within the DB1 enhancer element, which also
contains two homeodomain binding sites, one of which overlaps the final
base of the CRE/AP1 (Fig. 1A).
We have recently reported that cAMP stimulation of PC12 cells induced
Fos and Jun family-related binding activities associated with the
formation of a major cAMP-induced DB1 binding complex (3). In this
previous study, we showed that mutation of seven bases spanning the
CRE/AP1 and 5'-homeodomain sites, disrupted the formation of the
induced complex, as evidenced by EMSA. To differentiate the AP1/CRE
binding site from the homeodomain binding site, an oligonucleotide
probe was constructed which contains a 4-base mutation within only the
AP1/CRE site (CR/APm), leaving the homeodomain site and adjacent bases
intact. In competition analyses, the CR/APm oligonucleotide competes
for all complexes binding to the DB1 probe except those running
coincident with the induced cAMP complex (Fig. 1B). When
this oligonucleotide was used as a probe in EMSA, the 4-base mutation
abolishes formation of the cAMP-induced complex, further demonstrating
that the CRE/AP1 element is indeed the site recognized by the induced
complex (Fig. 1B).
|
fos) completely disrupts the complex, and antiserum to
Jun family members (
Jun) causes partial disruption (Fig.
1C). These experiments demonstrate that cAMP treatment of
PC12 cells increases the binding of AP1 family members to the CRE/AP1
site of the dopamine
-hydroxylase promoter. The presence of c-Fos,
along with c-Jun and JunD, in the complex induced by cAMP suggests that
these proteins may be involved in the induction of dopamine
-hydroxylase transcription by cAMP. The presence of c-Jun and JunD
in the basal condition suggests that transcriptional activation may
involve a shift in the composition of the AP1 complex, from Jun family
members to Fos-Jun family members.
The Homeodomain Protein Arix Binds to DB1-- We have previously demonstrated that the homeodomain core sites of the DB1 enhancer will bind the homeodomain protein Arix when recombinant protein is used (17). In order to determine whether native Arix is present in DB1 binding complexes derived from nuclear extracts, we have developed an affinity purified rabbit antisera directed against a C-terminal peptide of Arix. In Western blot analysis, this antisera specifically recognizes a band of appropriate molecular mass (36 kDa) in nuclear extracts from Arix expressing cell lines that is not present in Arix-negative cell lines (data not shown). EMSA analyses with Arix antisera demonstrate reactive supershifts of a complex binding to the DB1 enhancer from unstimulated and cAMP-stimulated PC12 and CATH.a cells but not from Arix-negative HepG2 cells (Fig. 2). Interestingly, Arix antisera appears to disrupt the cAMP-induced complex from PC12 cells as well as forming a supershift of protein-DNA complexes, suggesting that Arix is a component of the induced complex. Mutations in the two HD core recognition sites disrupt the Arix antisera supershifts when tested with the 2HDm oligonucleotide probe (Fig. 2). Thus, in the context of nuclear proteins from catecholaminergic cell lines, endogenous Arix binding depends on the presence of intact HD core recognition sites. The proximity of the HD sites binding Arix and the CRE/AP1 site binding AP1 proteins in conjunction with the previous findings that Arix can facilitate transcriptional responses to PKA would suggest that functional interaction of these transcription factors occurs at the DB1 enhancer.
|
AP1 Proteins Are Involved in the Response to PKA in Vivo--
To
evaluate the involvement of the AP1 proteins in the transcriptional
regulation of the DB1 promoter by PKA, an expression vector containing
a cDNA encoding dominant negative JunD was co-transfected with the
dopamine
-hydroxylase promoter-reporter construct (DBH-CAT) and an
expression vector carrying the catalytic subunit of protein kinase A
(RSV-PKA). The dominant negative JunD has a deletion of the DNA binding
domain but the dimerization domain remains intact (25). Thus, dominant
negative JunD will form dimers with all AP1 proteins that normally
dimerize with JunD, yet will not bind to DNA, preventing the
transcriptional activation by endogenous AP1 partners. In both PC12
cells (Fig. 3A), and the
catecholaminergic CATH.a cell line (Fig. 3B), expression of
the dominant negative JunD caused a 70-80% reduction in the response
of the dopamine
-hydroxylase promoter to PKA. As we have shown
previously (3), a dominant negative CREB construct, KCREB, reduced
PKA-induced transcription by 50% in PC12 cells (Fig. 3A).
We show here a similar effect of KCREB on PKA stimulated DBH-CAT
activity in CATH.a cells (Fig. 3B). The combination of KCREB
and dominant negative JunD in PC12 cells did not cause further
reduction than JunD alone. These results demonstrate the involvement of
AP1 proteins in mediating the cAMP/PKA-induced activation of the
dopamine
-hydroxylase promoter, and further suggest that the Jun
family members involved likely function downstream of CREB/CREM in
driving this response.
|
Induction of c-Fos by Phorbol Ester Does Not Lead to Increased
Transcription from the Dopamine
-Hydroxylase Promoter--
From the
experimental results reported thus far, a possible explanation for the
role of AP1 family members in the induction of dopamine
-hydroxylase
gene transcription is that the cAMP-mediated induction of c-Fos (16,
33, 34) leads to the formation of a positive acting Fos-Jun complex. To
test this hypothesis, we elevated c-Fos by a different treatment, PMA,
and evaluated transcription from the dopamine
-hydroxylase promoter.
PC12 cells were treated with either PMA, CPT-cAMP, or both agents, and
c-Fos protein expression and DNA binding activity were compared with
transcription from the DBH-CAT promoter. Western blot analysis
demonstrates that c-Fos protein expression is induced in PC12 cells by
each treatment in comparison with basal nuclear extracts (Fig.
4A), although cAMP-treated
extracts exhibited a greater signal than did PMA extracts at this time
point. There is also a qualitative difference in the pattern of c-Fos
isoforms induced by these different agents, in that cAMP and cAMP + PMA
treatment appears to increase the higher molecular weight forms of
immunoreactive c-Fos, likely representing posttranslationally modified
forms (35, 36). The induction of c-Fos by PMA as well as cAMP was also
confirmed in EMSA. Nuclear extracts from PC12 cells treated with PMA,
cAMP, or cAMP + PMA exhibit an increased intensity of the slowly
migrating complex on the DB1 oligonucleotide, and a c-Fos antisera
supershift in each of these lanes demonstrates the presence of c-Fos in
that complex (Fig. 4B). Although PMA treatment induced c-Fos
expression and DB1 binding activity, it did not alter the activity of
the dopamine
-hydroxylase promoter in PC12 cells transfected with the DBH-CAT reporter compared with basal cultures (Fig. 4C).
While cAMP stimulated DBH-CAT transcription, the combination of PMA + cAMP produced a response greater than that of cAMP alone. These results
suggest that induction of c-Fos does not in itself lead to stimulation
of dopamine
-hydroxylase transcription but that an additional event
due to PKA activation is necessary for a stimulation of dopamine
-hydroxylase transcription. Additionally, the results of these
experiments demonstrate that the two signal transduction pathways
converge at the dopamine
-hydroxylase promoter to synergistically activate transcription.
|
The Small G Protein Rap1 Is Involved in the Response of the
Dopamine
-Hydroxylase Promoter to PKA--
While the transduction
of the cAMP signal to the nucleus commonly involves the phosphorylation
of transcription factors by PKA, recently an alternative pathway for
cAMP signal transduction has been described (27). In neuroendocrine
cells, including PC12, elevation of cAMP results in activation of the
MAP kinase pathway, and subsequent phosphorylation and activation of
the transcription factor Elk-1. The small G protein Rap1 is a
participant in mediating this signal transduction. To evaluate the
participation of this pathway in the transcriptional activation of
dopamine
-hydroxylase by cAMP, a dominant negative form of Rap1,
RapN17, was introduced into PC12 or CATH.a cells prior to treatment
with cAMP. The presence of the dominant negative Rap1 protein reduced the cAMP-mediated stimulation of reporter gene activity by 40-60% in
both PC12 and CATH.a cells (Fig. 5). This
result suggests that a component of the action of cAMP/PKA on
transcription from the dopamine
-hydroxylase promoter may be
mediated through the MAP kinase pathway.
|
The AP1 Site Is Necessary for the Response of the Tyrosine
Hydroxylase Gene to Arix--
Tyrosine hydroxylase catalyzes the
conversion of tyrosine to DOPA and is the first step in the
catecholaminergic biosynthetic pathway. In response to environmental
stimuli, the tyrosine hydroxylase and dopamine
-hydroxylase genes
are often coordinately induced. As with the dopamine
-hydroxylase
promoter, the tyrosine hydroxylase gene contains positively acting
response elements for cAMP and Arix. In contrast to the organization of
the dopamine
-hydroxylase gene, the major CRE of the tyrosine
hydroxylase gene contains a consensus binding site for the CREB family
of transcription factors (4), and the CRE is not located adjacent to
the homeodomain binding sites, octamer and heptamer (Fig.
6A) (17, 22). In addition,
cAMP-stimulated transcription of the tyrosine hydroxylase gene is not
synergistic with the presence of Arix (3). To map the functional Arix
response element of the tyrosine hydroxylase gene, reporter constructs
containing mutations in the octamer, heptamer, and nearby AP1 sites
were cotransfected with RSV-Arix into the hepatoma cell line, HepG2. As
predicted, mutation in the octamer and heptamer sites eliminated the
response of the tyrosine hydroxylase promoter to Arix (Fig.
6B). Surprisingly, mutation in the AP1 site, 27 bases
removed from the octamer and heptamer sites, also reduced the response
to Arix by approximately 60%. This experiment demonstrates that the
AP1 site is important for the functional activity of the nearby Arix
response element, drawing a parallel between the structure and function
of the tyrosine hydroxylase and dopamine
-hydroxylase genes.
|
| |
DISCUSSION |
|---|
|
|
|---|
The developmental and temporal expression of the catecholamine
biosynthetic genes involves the integration of multiple extracellular signals to influence specific gene expression. In the experiments reported in this study, we show that the regulation of the proximal dopamine
-hydroxylase promoter by cAMP, or PKA, involves
coordinate activation of members from two different transcription
factor families, CREB/ATF and AP1. Additionally, the
Rap1/B-Raf-activated MAP kinase pathway contributes to cAMP activation
of dopamine
-hydroxylase transcription. These participants, acting
through multiple cAMP-dependent pathways, converge on the
CRE/AP1 and homeodomain binding elements of the DB1 enhancer region, to
regulate the basal, tissue-specific, and second messenger-mediated
transcription of the rat dopamine
-hydroxylase gene. A summary of
these findings is presented in Fig. 7 as
a model of the basal and stimulated transcription from the dopamine
-hydroxylase promoter in relation to these transcriptional
activators interacting with the DB1 enhancer.
|
AP1 Proteins Mediate cAMP Signal--
Several experimental results
suggest that binding of AP1 family members directly to the dopamine
-hydroxylase-CRE/AP1 site following PKA activation contributes to
transcriptional stimulation. First, we have previously demonstrated
that a cAMP-induced complex which binds to the DB1 enhancer is
disrupted by antisera broadly reactive to AP1 family members and is
also competed by a consensus AP1 oligonucleotide (3). Second, we have
identified c-Fos as a component of the cAMP-induced DB1 binding
complex, while c-Jun and JunD proteins are components of both basal and
cAMP-induced DB1 binding complexes. These findings suggest that
elevation of cAMP elicits a shift in AP1 composition at the dopamine
-hydroxylase CRE/AP1 site from Jun/JunD homo- or heterodimers in
untreated cells, to include c-Fos, likely in the form of Jun:Fos or
JunD:Fos heterodimers. Third, we have demonstrated that a dominant
negative mutant of JunD, which disrupts AP1-dependent
activities, strongly inhibits the transcriptional response to activated
PKA (Fig. 3). Notably, the functional role of AP1 components in
cAMP-mediated dopamine
-hydroxylase expression is apparent not only
in a chromaffin-like cell line, PC12, but was also demonstrated in a
cell line derived from central catecholaminergic cells, CATH.a. This
fact suggests that the findings presented here may be characteristic of
catecholaminergic cells in general and not a unique character of one
cell line. Support for these findings is also seen in vivo,
where immobilization stress activation of dopamine
-hydroxylase
transcription in the adrenal medulla is also dependent on Fos/Jun
mediation. Following immobilization stress, binding of Fos to the DB1
enhancer is increased in extracts from adrenal medulla (37), and female
mice which are heterozygous for a null mutation in c-fos do
not respond to immobilization stress with an increase in dopamine
-hydroxylase mRNA as do wild-type mice (38).
-hydroxylase promoter. However, the results observed in
Fig. 4, demonstrating a lack of PMA-induced promoter activation,
suggest that the mere induction of c-Fos is not sufficient to account
for the transactivation of the dopamine
-hydroxylase promoter.
cAMP-dependent event(s) in addition to c-Fos induction must
be required in order for transactivation of the dopamine
-hydroxylase promoter to occur.
In addition to induction of c-Fos, cAMP-mediated events involving
phosphorylation changes in AP1 proteins may influence dopamine
-hydroxylase promoter activity. Numerous studies have shown that modulation in phosphorylation state of c-Jun and c-Fos proteins can
influence their transcriptional activity (35, 36, 41-44). Uniquely in
PC12 cells, PKA stimulation can lead to the activation of the MAP
kinases through a Rap1/B-Raf-dependent pathway. This activation has been shown to phosphorylate and activate the Ets transcription factor Elk-1 (27). The ability of the dominant negative
Rap1 construct to inhibit a portion of the cAMP response suggests the
potential involvement of this pathway. Perhaps one of the components of
the AP1 complex or other coactivators is a target for the MAP kinase
phosphorylation cascade leading to activation of the dopamine
-hydroxylase promoter.
Arix Participates in the PKA Response--
Previous results from
our laboratory have implicated the homeodomain protein Arix as a
catecholaminergic cell specific transcription factor that acts
synergistically with PKA to strongly activate the dopamine
-hydroxylase promoter (3). The recombinant protein was originally
found to bind to the HD recognition sites adjacent to the CRE/AP1 site
within the DB1 enhancer (17). The demonstration in this study that
endogenous Arix binds to DB1 coincidentally with the AP1 components in
nuclear extracts further solidifies the involvement of this factor in
the regulation of the dopamine
-hydroxylase promoter in PC12 and
CATH.a cells. The functional synergism of Arix with PKA could be
mediated through a recruitment of AP1 proteins to the promoter though a
direct physical interaction, as, for example, has been demonstrated
with Phox1 recruitment of the serum response factor to the SRE of the
c-Fos gene (45). However, co-immunoprecipitation analyses have
demonstrated no evidence of physical interaction of Arix with c-Fos or
c-Jun (data not shown), suggesting that the biological interaction does
not involve stable protein-protein interactions between of AP1 proteins and Arix. The possibility remains that an indirect reciprocal influence
of AP1 factors and Arix on DNA binding could occur, via a mechanism
such as DNA bending (46). Alternatively, AP1 proteins and Arix may
conjointly interact with a co-activator, such as CBP, leading to
mutually cooperative binding to the promoter. Since studies have
demonstrated the physical interaction of c-Jun and c-Fos with CBP (47,
48), it is possible Arix may contribute to the recruitment of this
co-activator. The possibility also remains that Arix is a target for
phosphorylation and subsequent activation through the multiple pathways
being activated by cAMP in these cells.
Functional Similarity between the Tyrosine Hydroxylase and Dopamine
-Hydroxylase Genes--
The tyrosine hydroxylase and dopamine
-hydroxylase genes are coordinately activated by external stimuli,
and yet have a different genetic organization of the CRE and AP1 sites.
While the dopamine
-hydroxylase gene has a composite CRE/AP1 site,
the tyrosine hydroxylase gene has separate sites for each regulatory
influence (see Figs. 1A and 6A). A similarity
between the regulation of the tyrosine hydroxylase and dopamine
-hydroxylase genes is the importance of the AP1 element for the
activation of the tyrosine hydroxylase gene by the transcription factor
Arix. As with the dopamine
-hydroxylase gene, the tyrosine
hydroxylase gene interacts with AP1 proteins c-Fos, c-Jun, and JunD,
and complex formation of the tyrosine hydroxylase AP1 element is
enhanced when cells are treated under depolarizing conditions or
increased calcium influx (49). The segment of DNA including both the
AP1 and Arix binding sites of the tyrosine hydroxylase promoter is
necessary for expression of the tyrosine hydroxylase promoter in
cultured sympathetic ganglia (50). Taken together, these results
demonstrate a functional similarity between the tyrosine hydroxylase
and dopamine
-hydroxylase genes, in that the Arix binding site
interacts with a nearby AP1 site to modulate transcription of both
genes. This common mechanism may underlie the coordinate regulation in
cells that express the Arix homeodomain proteins. Conversely, the
divergence of CRE and AP1 sites in the tyrosine hydroxylase promoter
may provide for a means to differentially regulate the enzymes in cells, such as striatal neurons, which do not express the noradrenergic cell specific Arix protein.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Richard Maurer for the gift of RSV-PKA, Dr. Lester Lau for the dominant negative JunD construct, Dr. Dona Chikaraishi for TH-CAT constructs containing mutation in AP1, octamer, and heptamer sites, Dr. Richard Goodman for KCREB, and Dr. Phil Stork for CMV-RapN17. We thank Megumi Adachi for critical comments during preparation of this manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grants NS33159 and GM38696 (to E. J. L.) and a fellowship from the American Heart Association, Oregon Affiliate (to D. J. S.).
To whom correspondence should be addressed. Tel.: 503-494-5076;
Fax: 503-494-8393; E-mail: lewis{at}ohsu.edu.
The abbreviations used are:
DBH, dopamine
-hydroxylase; RSV, Rous sarcoma virus; CAT, chloramphenicol
acetyltransferase; TH, tyrosine hydroxylase; CPT-cAMP, 8-(4-chlorophenylthio)adenosine 3':5'-cyclic monophosphate; 8-Br-cAMP, 8-bromoadenosine 3':5'-cyclic monophosphate; PMA, phorbol 12-myristate
13-acetate; CRE, cAMP response element; HD, homeodomain recognition
element; PKA, cAMP-dependent protein kinase catalytic
subunit a; CBP, CREB-binding protein; EMSA, electrophoretic mobility
assay; MAP, mitogen-activated protein.
2 D. J. Swanson, E. Zellmer, and E. J. Lewis, unpublished observation.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Das, T. Ezashi, R. Gupta, and R. M. Roberts Combinatorial Roles of Protein Kinase A, Ets2, and 3',5'-Cyclic-Adenosine Monophosphate Response Element-Binding Protein-Binding Protein/p300 in the Transcriptional Control of Interferon-{tau} Expression in a Trophoblast Cell Line Mol. Endocrinol., February 1, 2008; 22(2): 331 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, M. F. Shannon, and I. G. Young A role for Ets1, synergizing with AP-1 and GATA-3 in the regulation of IL-5 transcription in mouse Th2 lymphocytes Int. Immunol., February 1, 2006; 18(2): 313 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
|