JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swanson, D. J.
Right arrow Articles by Lewis, E. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swanson, D. J.
Right arrow Articles by Lewis, E. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 37, 24065-24074, September 11, 1998


AP1 Proteins Mediate the cAMP Response of the Dopamine beta -Hydroxylase Gene*

Douglas J. Swanson, Eustacia Zellmer, and Elaine J. LewisDagger

From the Department of Biochemistry and Molecular Biology, Oregon Health Sciences University, L224, Portland, Oregon 97201

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Neurotransmitter biosynthesis is regulated by environmental stimuli, which transmit intracellular signals via second messengers and protein kinase pathways. For the catecholamine biosynthetic enzymes, dopamine beta -hydroxylase and tyrosine hydroxylase, regulation of gene expression by cyclic AMP, diacyl glycerol, and Ca2+ leads to increased neurotransmitter biosynthesis. In this report, we demonstrate that the cAMP-mediated regulation of transcription from the dopamine beta -hydroxylase promoter is mediated by the AP1 proteins c-Fos, c-Jun, and JunD. Following treatment of cultured cells with cAMP, protein complexes bound to the dopamine beta -hydroxylase AP1/cAMP response element element change from consisting of c-Jun and JunD to include c-Fos, c-Jun, and JunD. The homeodomain protein Arix is also a component of this DNA-protein complex, binding to the adjacent homeodomain recognition sites. Transfection of a dominant negative JunD expression plasmid inhibits cAMP-mediated expression of the dopamine beta -hydroxylase promoter construct in PC12 and CATH.a cells. In addition to the role of c-Fos in regulating dopamine beta -hydroxylase gene expression in response to cAMP, a second pathway, involving Rap1/B-Raf is involved. These experiments illustrate an unusual divergence of cAMP-dependent protein kinase signaling through multiple pathways that then reconverge on a single element in the dopamine beta -hydroxylase promoter to elicit activation of gene expression.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The interaction of extracellular factors with the endogenous transcriptional machinery is thought to be essential for phenotype-specific gene expression involved in differentiation and normal function of neurons. In the case of neural crest cell differentiation, growth factors in the embryonic environment are thought to induce expression of proneural transcription factors, which activate genetic pathways necessary for driving expression of pan-neuronal and phenotype-specific genes (1, 2). The genetic pathways involved in expression of neuronal phenotype genes are likely subject to regulation by extracellular factors. The paired-like homeodomain transcription factor, Arix/Phox2a, is a component of a genetic pathway involved in regulation of some phenotype-specific characteristics in cultured neural crest cells (2). We have demonstrated a role for this homeodomain protein in regulating second messenger-mediated stimulation of catecholaminergic neurotransmitter biosynthetic genes dopamine beta -hydroxylase (DBH)1 and tyrosine hydroxylase (TH) (3). These enzymes are critical in the biosynthesis pathway of catecholamine neurotransmitters dopamine and norepinephrine, and their expression defines an adrenergic neuronal phenotype. Taken together these studies outline a putative pathway for extracellular signal regulation of phenotype-specific gene expression. Therefore, studies that further define the interaction of the cellular transcriptional machinery with second messenger pathways are needed to provide a framework for understanding the mechanisms underlying regulation and maintenance of neuronal phenotype and function.

The transcriptional changes resulting from environmental stimuli are believed to be mediated through ligand and second messenger stimulation of protein phosphorylation cascades. Many neurotransmitter biosynthetic genes are transcriptionally responsive to activation of protein kinase A (via cyclic AMP) and protein kinase C (via diacyl glycerol). A consensus cyclic AMP response element (CRE), containing the core sequence TGACGTCA, is found on several neurotransmitter biosynthetic genes, including TH, corticotropin-releasing hormone, and somatostatin (4-6). The consensus CRE is recognized by the CREB/ATF family of transcription factors (reviewed in Ref. 7). Similarly, a consensus AP1 site, containing a core sequence TCA(C/G)TCA and responsive to phorbol esters or other agents that elevate diacyl glycerol, is present on both the TH and VIP genes (8, 9). The AP1 site is recognized by members of the Fos and Jun family of transcription factors. On the genes containing two defined AP1 and CRE regulatory elements, the AP1 and CRE sites are physically separate, and each effector may stimulate transcription independently. In contrast, at least three neurotransmitter biosynthetic genes contain a composite CRE/AP1 site, which is responsive to both cAMP and phorbol ester mediated transcriptional activation. In these genes, dopamine beta -hydroxylase, proenkephalin, and prodynorphin, the core CRE/AP1 site, TGCGTCA, contains elements of both the consensus CRE and AP1 sites (10-13). This composite CRE/AP1 site will bind to both CREB/ATF and AP1 family members, and the components of the DNA-protein complex may be dependent upon the cell type or environment. For example, the proenkephalin CRE interacts preferably with CREB in nuclear extracts from the striatum, while in adrenal medulla extracts it appears that AP1 complexes predominate (14-16).

As with other neurotransmitter biosynthetic genes, dopamine beta -hydroxylase is expressed in a tissue-specific pattern and is responsive to environmental stimuli. Within the rat dopamine beta -hydroxylase promoter proximal segment both the cell type specificity and second messenger responsiveness are controlled through one regulatory element, the DB1 enhancer (10). This enhancer consists of the above mentioned CRE/AP1 site located directly adjacent to two core homeodomain protein recognition sites (HD). The DB1 element interacts with the homeodomain transcription factor Arix/Phox2a (17), which plays a role in determining the noradrenergic phenotype (18). Forced expression of Arix in a cell, in and of itself, does not stimulate dopamine beta -hydroxylase gene expression (2, 17). Regulation of dopamine beta -hydroxylase gene transcription in the presence of Arix requires simultaneous activation of the cAMP/PKA pathway (3). Therefore, the cell selective regulation of dopamine beta -hydroxylase promoter activation likely involves the interaction of the Arix with second messenger regulated transcription factors.

The identity of the transcription factors which interact at the AP1/CRE component of the DB1 element is essential to further understanding the biochemical mechanisms by which these AP1/CRE transcription factors interact with Arix to influence cellular neurotransmitter phenotype. In previous studies, the AP1/CRE element has been shown to interact with members of the CREB/ATF family, including CREB, CREM, and ATF-1, in extracts from catecholaminergic cells (3, 19). In addition, a dominant negative mutant of CREB blocked approximately 50% of PKA induction of a dopamine beta -hydroxylase reporter gene. However, other aspects of the analysis suggested that the CREB/ATF factors were not the primary components of the DB1 binding complex. Only a small portion of the DNA-protein complex was reactive with anti-CREB or anti-CREM sera, and the entire complex was disrupted by antisera to Fos and Jun family members. In the study reported here, we have further evaluated the role of the AP1 factors in mediating the cAMP response of the dopamine beta -hydroxylase gene, and have evidence that these factors do, in fact, play a major role. This is one of the first demonstrations where AP1 factors directly mediate a cAMP response.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cell Culture-- The PC12 cells used in these experiments were subclone GR5, isolated by Dr. Rae Nishi at the Oregon Health Sciences University. PC12-GR5 cells are cultured in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum (Hyclone). CATH.a cells were cultured in RPMI medium containing 8% horse serum and 4% fetal bovine serum. PC12 cells were originally cloned from a pheochromocytoma (20), while the catecholaminergic CATH.a cells were derived from a tumor within the mouse central nervous system (21). HepG2 hepatoma cells are cultured in minimum Eagle's medium plus 10% fetal bovine serum, 1% nonessential amino acids, and 110 mg/liter sodium pyruvate. All cells are cultured in an atmosphere of humidified air containing 5% CO2.

Plasmid Constructs-- The construction of plasmids containing the promoter and 5'-flanking sequence of TH and dopamine beta -hydroxylase genes cloned adjacent to the bacterial chloramphenicol acetyltransferase (CAT) transcription unit has been described previously (4, 10). Plasmids containing point mutations of the TH promoter region were a generous gift from Dr. Dona Chikaraishi (22), while the plasmid with a deletion in the AP1 site of the TH promoter construct was a gift from Dr. Ed Ziff (23). RSV-Arix contains Arix cDNA sequence 1-1353, which includes all 5'-untranslated and protein-coding sequences and 313 bases of the Arix 3'-untranslated sequence (17). This cDNA segment is cloned into pSPRSV, where Arix transcription is under control of the Rous sarcoma virus promoter and enhancer elements and is followed by a poly(A) addition signal from SV40 (10, 17).

The construction of RSV-PKA was described in Maurer (24). The dominant negative JunD expression construct was a generous gift from Dr. Lester Lau (University of Illinois, Chicago) as described previously (25). The KCREB expression plasmid was a generous gift from Dr. Richard Goodman (Oregon Health Sciences University), the construction of which was described in Walton et al. (26). The dominant negative construct of Rap1, RapN17, was a gift of Dr. Phil Stork (Oregon Health Sciences University) and is described in Vossler et al. (27).

Transfections and Stimulation of Cultures-- DNA used for transfection was purified using the Promega Wizard kit. Following purification according to the manufacturer's procedures, DNA was precipitated from ethanol in the presence of ammonium acetate. PC12 cell cultures, in 100-mm culture dishes, were transfected with 15-23 µg of DNA using calcium phosphate, as described previously. CATH.a cell cultures were transfected with 8-11 µg of DNA using the cationic lipid, PFx 6 (Invitrogen), at a DNA:lipid ratio of 1:3, following the procedure supplied by the manufacturer. Cell cultures contained 3-6 × 106 cells/dish. All transfections contained 1-3 µg of pRSV-luciferase to verify success of transfection. Cells were harvested 2 days after transfection, and aliquots of cell extracts were assayed for protein content, CAT activity (28), and luciferase activity (29). CAT activity is standardized to co-transfected luciferase, except when cAMP analogs or RSV-PKA are used. Previous experimental results indicated a stimulatory effect of cAMP and PKA on the RSV promoter of RSV-luciferase.2 For experiments using cAMP or PKA, CAT activity is standardized to total extract protein.

In experiments using inducers, these agents were added 18 h before harvesting of cells. PC12 and CATH.a cells were treated with 200 µM 8-(4-chlorophenylthio)-adenosine 3':5'-cyclic monophosphate (CPT-cAMP). For some experiments, phorbol 12-myristate 13-acetate (PMA) was added to cultures either alone or with CPT-cAMP at a concentration of 20 nM.

Preparation of Nuclear Extracts and Electrophoretic Mobility Assay (EMSA)-- Crude nuclear extracts were made from PC12, CATH.a, and HepG2 cells following the method of Dignam et al. (30) modified by a high salt (0.6 M KCl) extraction of the nuclear pellet (as described by Ausbel (31). Additionally, all buffers used contained Pefbloc (0.2 mg/ml; Boehringer Mannheim), leupeptin (0.5 µg/ml), and pepstatin (0.7 µg/ml) as protease inhibitors and NaF (10 mM) as a phosphatase inhibitor. The nuclear extracts were dialyzed against nuclear extract buffer, consisting of 20 mM HEPES (pH 7.9), 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and 10 mM NaF. Protein concentration of each nuclear extract was determined by Bradford assay (Bio-Rad), and aliquots were frozen and stored at -70 °C.

Synthetic sense and antisense oligonucleotides were end labeled with T4 polynucleotide kinase and [gamma -32P]ATP, then annealed. The EMSA reactions were carried out in a 20-µl final volume containing 12.5 mM HEPES (pH 7.9), 10% glycerol, 5 mM MgCl2, 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, and 2 µg of poly(dI-dC)·poly(dI-dC). Nuclear extract protein concentrations were adjusted to 1.7 µg/µl with nuclear extract buffer. Labeled probe (10,000-25,000 cpm Cherenkov counts) was added to the reaction buffer containing 5 µg of nuclear extracts and incubated for 30 min at room temperature. For competition EMSAs, reaction mixtures containing nuclear extracts were preincubated for 20 min in the presence of double-stranded competitor oligonucleotides (200 ng) prior to incubation with the labeled oligonucleotide probe. Samples were carefully loaded to minimize mixing, and the complexes were resolved on 6% nondenaturing polyacrylamide gels (19:1 acrylamide:bisacrylamide) using an electrophoresis buffer containing 45 mM Tris borate and 1 mM EDTA. The gels were dried, and protein-DNA complexes were visualized autoradiographically. The sequences of the wild type and mutant oligonucleotides used in this study are as follows, (lowercase letters signifying the mutation): wild type DB1, ATGTCCATGCGTCATTAGTGCAATTAGGG; CR/APm, ATGTCCAgagcTCATTAGTGCAATTAGGG; and the 2HDm, ATGTCCATGCGTCATacGTGCAccTAGGG.

Antibody Supershift Assays-- In order to identify protein constituents of EMSA complexes, antisera broadly reactive against Fos and Jun family members or antisera reactive with specific family members, were tested in EMSA reactions. Nuclear extracts and reaction buffer components were preincubated together with 4 µg of affinity-purified IgG for 20 min at room temperature prior to a 30-min incubation with labeled probe and separated by electrophoresis as described above. The following is a list of antisera purchased from Santa Cruz Biotechnology, Inc. and used in the study to characterize AP1 proteins in EMSA: alpha Fos (sc-253x) Fos family-reactive rabbit polyclonal IgG against amino acids 128-152 of human c-Fos p62; c-Fos (sc-52x) c-Fos-specific rabbit IgG against amino acids 3-16 of the human c-Fos gene; Fra-1 (sc-183x) rabbit IgG directed against amino acids 3-22, unique to the amino terminus of mouse Fra-1; Fra-2 (sc-57x) rabbit IgG directed against amino acids 285-299 of the chicken Fra-2 gene product (common to rat and human genes); alpha Jun (sc-44x) Jun-family reactive rabbit polyclonal IgG against amino acids 247-263 of mouse c-Jun p39; c-Jun (sc-45x) c-Jun-specific rabbit IgG against amino acids 91-105 of the mouse c-Jun; JunD (sc-74) JunD-specific rabbit IgG against amino acids 329-341 of the mouse JunD; JunB (sc-46x) JunB-specific rabbit IgG against amino acids 45-61 of the mouse JunB.

Arix Antisera Production and Purification-- Arix antisera was raised by immunizing rabbits with a C-terminal peptide of Arix, containing the sequence YFHRKPGPALKTNLF, conjugated to keyhole limpet hemocyanin. Antisera was prepared by Atlantic Antibodies, Windham, ME. The serum was affinity-purified with a form of recombinant Arix containing the homeodomain and C-terminal portion fused to glutathione S-transferase, using the method described by Youssoufian (32).

Western Blot Analysis-- Nuclear extracts from PC12 cells from untreated or treated cultures were analyzed for c-Fos immunoreactivity by Western blot analysis. 10 µg of nuclear extracts were separated on 10% acrylamide SDS-polyacrylamide gel electrophoresis gels and transferred to nitrocellulose. c-Fos-specific immunoreactivity was identified using the c-Fos-specific (sc-52) antisera followed by enhanced chemilumiscent detection (Renaissance, NEN Life Science Products) and exposure to x-ray film.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

AP1 Proteins Bind to DB1-- The AP1/CRE site of the dopamine beta -hydroxylase gene lies within the DB1 enhancer element, which also contains two homeodomain binding sites, one of which overlaps the final base of the CRE/AP1 (Fig. 1A). We have recently reported that cAMP stimulation of PC12 cells induced Fos and Jun family-related binding activities associated with the formation of a major cAMP-induced DB1 binding complex (3). In this previous study, we showed that mutation of seven bases spanning the CRE/AP1 and 5'-homeodomain sites, disrupted the formation of the induced complex, as evidenced by EMSA. To differentiate the AP1/CRE binding site from the homeodomain binding site, an oligonucleotide probe was constructed which contains a 4-base mutation within only the AP1/CRE site (CR/APm), leaving the homeodomain site and adjacent bases intact. In competition analyses, the CR/APm oligonucleotide competes for all complexes binding to the DB1 probe except those running coincident with the induced cAMP complex (Fig. 1B). When this oligonucleotide was used as a probe in EMSA, the 4-base mutation abolishes formation of the cAMP-induced complex, further demonstrating that the CRE/AP1 element is indeed the site recognized by the induced complex (Fig. 1B).


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 1.   EMSA define the AP1 proteins which interact with the DB1 enhancer in PC12 cell nuclear extracts. A, a schematic representation of the rat DBH (-232/+14) promoter used in this study with a detail of the sequence encompassing the DB1 enhancer region, bp -180 to -151 based on Shaskus et al. (10). The segments which correspond to known regulatory elements are labeled. These regulatory domains are: CRE/AP1 (stippled box), core homeodomain recognition sites (open boxes), and the binding site for RNA polymerase II, TATA. The DB1 enhancer (underlined) represents the portion of the rat DBH promoter previously found to bind the Arix homeodomain protein and also to be critical for basal and second messenger activated transcription. B, nuclear extracts (5 µg of total protein) from basal (B) and cAMP-treated (C) PC12 cells were analyzed by EMSA using either the DB1 oligonucleotide or the CR/APm mutant probe. As indicated, the unlabeled CR/APm oligonucleotide (200 ng) was also used as a competitor of proteins interacting with the DB1 probe. The bracket outlines basal complex formation on the DB1 probe, some of which is competed by the CR/APm oligonucleotide. Arrowheads indicate the cAMP induced complex binding to the DB1 probe but is absent from the CR/APm probe. C, nuclear extracts (5 µg of total protein) from basal (B) and cAMP-treated (C) PC12 cells were preincubated with 4 µg of purified IgG antisera specifically reactive for Jun and Fos family members prior to incubation with the labeled DB1 oligonucleotide as described under "Experimental Procedures." Antisera against c-Jun and JunD produce supershifts (indicated by arrowheads) in basal cells, which are intensified following cAMP treatment. cAMP treatment also induces alpha Fos and c-Fos antisera related supershifts (arrowheads) that are not seen with Basal nuclear extracts. Antisera against JunB, Fra-1, and Fra-2 do not form supershifted complexes on the DB1 probe.

To ascertain the identity of the Fos and Jun family members involved in the DB1 DNA-protein complex, antisera directed against the individual Fos and Jun species were added to the EMSA reaction. The disruption, or altered mobility, of complex formation by specific antisera indicates the presence of that protein in complex with the DNA probe. In EMSA using nuclear extracts from unstimulated cells, antisera directed against c-Jun and JunD react with DB1 binding complexes, suggesting that these factors interact with DB1 under basal conditions, either as homo- or heterodimers (Fig. 1C, basal lanes). In extracts from cells treated with cAMP, where an induced complex is visualized, c-Jun and JunD antisera again elicit supershifts. In addition, c-Fos-specific reactivity is evident on the DB1 probe (Fig. 1C, cAMP lanes). Similar to the loss of cAMP-induced complex in EMSA by mutation of the CRE/AP1 site, (Fig. 1B), the c-Fos, c-Jun, and JunD antisera-specific supershifts were not detected using these mutant oligonucleotides in EMSA (data not shown). This result confirms the specific binding of these AP1 proteins to this site within the DB1 enhancer. Antisera against other closely related AP1 family members (Fra-1, Fra-2, Fos-B, and JunB), did not alter the basal or cAMP treated EMSA pattern on DB1, suggesting that in PC12 cells these proteins do not interact with the DB1 enhancer. Control experiments using a consensus AP1 oligonucleotide probe have verified the efficacy of these antisera in EMSA (data not shown). As previously reported (3), antiserum with broad Fos family reactivity (alpha fos) completely disrupts the complex, and antiserum to Jun family members (alpha Jun) causes partial disruption (Fig. 1C). These experiments demonstrate that cAMP treatment of PC12 cells increases the binding of AP1 family members to the CRE/AP1 site of the dopamine beta -hydroxylase promoter. The presence of c-Fos, along with c-Jun and JunD, in the complex induced by cAMP suggests that these proteins may be involved in the induction of dopamine beta -hydroxylase transcription by cAMP. The presence of c-Jun and JunD in the basal condition suggests that transcriptional activation may involve a shift in the composition of the AP1 complex, from Jun family members to Fos-Jun family members.

The Homeodomain Protein Arix Binds to DB1-- We have previously demonstrated that the homeodomain core sites of the DB1 enhancer will bind the homeodomain protein Arix when recombinant protein is used (17). In order to determine whether native Arix is present in DB1 binding complexes derived from nuclear extracts, we have developed an affinity purified rabbit antisera directed against a C-terminal peptide of Arix. In Western blot analysis, this antisera specifically recognizes a band of appropriate molecular mass (36 kDa) in nuclear extracts from Arix expressing cell lines that is not present in Arix-negative cell lines (data not shown). EMSA analyses with Arix antisera demonstrate reactive supershifts of a complex binding to the DB1 enhancer from unstimulated and cAMP-stimulated PC12 and CATH.a cells but not from Arix-negative HepG2 cells (Fig. 2). Interestingly, Arix antisera appears to disrupt the cAMP-induced complex from PC12 cells as well as forming a supershift of protein-DNA complexes, suggesting that Arix is a component of the induced complex. Mutations in the two HD core recognition sites disrupt the Arix antisera supershifts when tested with the 2HDm oligonucleotide probe (Fig. 2). Thus, in the context of nuclear proteins from catecholaminergic cell lines, endogenous Arix binding depends on the presence of intact HD core recognition sites. The proximity of the HD sites binding Arix and the CRE/AP1 site binding AP1 proteins in conjunction with the previous findings that Arix can facilitate transcriptional responses to PKA would suggest that functional interaction of these transcription factors occurs at the DB1 enhancer.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 2.   Antisera supershift analyses demonstrate the binding activity of the homeodomain protein Arix in catecholaminergic cell lines. Nuclear extracts (5 µg) from untreated or cAMP-treated PC12, CATH.a, and HepG2 cells were preincubated in the presence or absence of affinity-purified Arix antisera (2 µl) derived against a C-terminal peptide of the Arix homeodomain protein. Nuclear extract/antisera proteins were then incubated with either the DB1 or 2HDm oligonucleotides and analyzed by EMSA. A complex supershift (indicated by the arrowhead) was detected in nuclear extracts from PC12 and CATH.a cells, but not from HepG2 cells with the DB1 probe. Since no supershifts were detected with the 2HDm probe where the HD sites of the DB1 enhancer are mutated, Arix likely binds to the homeodomain sites in DB1.

AP1 Proteins Are Involved in the Response to PKA in Vivo-- To evaluate the involvement of the AP1 proteins in the transcriptional regulation of the DB1 promoter by PKA, an expression vector containing a cDNA encoding dominant negative JunD was co-transfected with the dopamine beta -hydroxylase promoter-reporter construct (DBH-CAT) and an expression vector carrying the catalytic subunit of protein kinase A (RSV-PKA). The dominant negative JunD has a deletion of the DNA binding domain but the dimerization domain remains intact (25). Thus, dominant negative JunD will form dimers with all AP1 proteins that normally dimerize with JunD, yet will not bind to DNA, preventing the transcriptional activation by endogenous AP1 partners. In both PC12 cells (Fig. 3A), and the catecholaminergic CATH.a cell line (Fig. 3B), expression of the dominant negative JunD caused a 70-80% reduction in the response of the dopamine beta -hydroxylase promoter to PKA. As we have shown previously (3), a dominant negative CREB construct, KCREB, reduced PKA-induced transcription by 50% in PC12 cells (Fig. 3A). We show here a similar effect of KCREB on PKA stimulated DBH-CAT activity in CATH.a cells (Fig. 3B). The combination of KCREB and dominant negative JunD in PC12 cells did not cause further reduction than JunD alone. These results demonstrate the involvement of AP1 proteins in mediating the cAMP/PKA-induced activation of the dopamine beta -hydroxylase promoter, and further suggest that the Jun family members involved likely function downstream of CREB/CREM in driving this response.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   Dominant negative JunD (DN-JunD) and dominant negative CREB (KCREB) alter PKA responses of the DBH promoter in catecholaminergic cell lines. A, PC12 cells were transiently transfected via calcium phosphate with 5 µg of DBH-CAT, ±5 µg of RSV-DN JunD, ±5 µg of RSV-KCREB, and ± 5 µg of RSV-PKA as indicated and B, CATH.a cells were transfected via cationic lipid (PFx 6, Invitrogen) with 3 µg of DBH-CAT, ±5 µg of RSV-DN JunD, ±5 µg of RSV-KCREB, and ± 2 µg of RSV-PKA. Cells were harvested for CAT activity 48 h later as described under "Experimental Procedures." CAT activities were calculated relative to protein content and normalized to basal control cultures. The mean value for basal cultures is thus standardized to 1.0. These data are from a representative experiment and are the mean ± S.E. from three independent transfections.

Induction of c-Fos by Phorbol Ester Does Not Lead to Increased Transcription from the Dopamine beta -Hydroxylase Promoter-- From the experimental results reported thus far, a possible explanation for the role of AP1 family members in the induction of dopamine beta -hydroxylase gene transcription is that the cAMP-mediated induction of c-Fos (16, 33, 34) leads to the formation of a positive acting Fos-Jun complex. To test this hypothesis, we elevated c-Fos by a different treatment, PMA, and evaluated transcription from the dopamine beta -hydroxylase promoter. PC12 cells were treated with either PMA, CPT-cAMP, or both agents, and c-Fos protein expression and DNA binding activity were compared with transcription from the DBH-CAT promoter. Western blot analysis demonstrates that c-Fos protein expression is induced in PC12 cells by each treatment in comparison with basal nuclear extracts (Fig. 4A), although cAMP-treated extracts exhibited a greater signal than did PMA extracts at this time point. There is also a qualitative difference in the pattern of c-Fos isoforms induced by these different agents, in that cAMP and cAMP + PMA treatment appears to increase the higher molecular weight forms of immunoreactive c-Fos, likely representing posttranslationally modified forms (35, 36). The induction of c-Fos by PMA as well as cAMP was also confirmed in EMSA. Nuclear extracts from PC12 cells treated with PMA, cAMP, or cAMP + PMA exhibit an increased intensity of the slowly migrating complex on the DB1 oligonucleotide, and a c-Fos antisera supershift in each of these lanes demonstrates the presence of c-Fos in that complex (Fig. 4B). Although PMA treatment induced c-Fos expression and DB1 binding activity, it did not alter the activity of the dopamine beta -hydroxylase promoter in PC12 cells transfected with the DBH-CAT reporter compared with basal cultures (Fig. 4C). While cAMP stimulated DBH-CAT transcription, the combination of PMA + cAMP produced a response greater than that of cAMP alone. These results suggest that induction of c-Fos does not in itself lead to stimulation of dopamine beta -hydroxylase transcription but that an additional event due to PKA activation is necessary for a stimulation of dopamine beta -hydroxylase transcription. Additionally, the results of these experiments demonstrate that the two signal transduction pathways converge at the dopamine beta -hydroxylase promoter to synergistically activate transcription.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4.   The induction of c-Fos protein and DBH-CRE/AP1 binding by cAMP but not by PMA correlates with DBH promoter activation. A, A c-Fos Western blot analysis using c-Fos-specific antisera (Santa Cruz Biotechnology, sc-52) was performed on nuclear extracts (10 µg) from PC12 cells either untreated or treated with PMA, cAMP, or cAMP + PMA (C+P) for 2 h prior to harvest as described under "Experimental Procedures." Multiple isoforms were detected in each treatment group with this antisera ranging in molecular mass from approximately 55 to 70 kDa, likely representing posttranslationally modified forms (35). B, an EMSA supershift analysis of c-Fos binding to the DB1 probe using the same nuclear extracts as in panel A. PMA, cAMP, and cAMP + PMA treatment all induce a detectable c-Fos supershift (arrow heads). C, transient transfection of PC12 cell cultures with 10 µg of DBH-CAT was followed by treatment with each inducing agent and harvested the following day for CAT activity determination. The results are expressed relative to basal cultures and represent the mean ± S.E. of triplicate transfections.

The Small G Protein Rap1 Is Involved in the Response of the Dopamine beta -Hydroxylase Promoter to PKA-- While the transduction of the cAMP signal to the nucleus commonly involves the phosphorylation of transcription factors by PKA, recently an alternative pathway for cAMP signal transduction has been described (27). In neuroendocrine cells, including PC12, elevation of cAMP results in activation of the MAP kinase pathway, and subsequent phosphorylation and activation of the transcription factor Elk-1. The small G protein Rap1 is a participant in mediating this signal transduction. To evaluate the participation of this pathway in the transcriptional activation of dopamine beta -hydroxylase by cAMP, a dominant negative form of Rap1, RapN17, was introduced into PC12 or CATH.a cells prior to treatment with cAMP. The presence of the dominant negative Rap1 protein reduced the cAMP-mediated stimulation of reporter gene activity by 40-60% in both PC12 and CATH.a cells (Fig. 5). This result suggests that a component of the action of cAMP/PKA on transcription from the dopamine beta -hydroxylase promoter may be mediated through the MAP kinase pathway.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of the MAP kinase pathway by dominant negative Rap1 partially reduces the cAMP responsive DBH transcription. A, PC12 cells were transiently transfected via calcium phosphate with 10 µg of DBH-CAT and ± 5 µg of CMV-RapN17 as indicated and B, CATH.a cells were transfected via cationic lipid (PFx 6, Invitrogen) with 3 µg of DBH-CAT and ± 5 µg of CMV-RapN17. Cells were treated with CPT-cAMP one day after transfection, and harvested for CAT activity the following day. CAT activities were calculated relative to protein content and normalized to basal control cultures. The mean value for basal cultures is thus standardized to 1.0.

The AP1 Site Is Necessary for the Response of the Tyrosine Hydroxylase Gene to Arix-- Tyrosine hydroxylase catalyzes the conversion of tyrosine to DOPA and is the first step in the catecholaminergic biosynthetic pathway. In response to environmental stimuli, the tyrosine hydroxylase and dopamine beta -hydroxylase genes are often coordinately induced. As with the dopamine beta -hydroxylase promoter, the tyrosine hydroxylase gene contains positively acting response elements for cAMP and Arix. In contrast to the organization of the dopamine beta -hydroxylase gene, the major CRE of the tyrosine hydroxylase gene contains a consensus binding site for the CREB family of transcription factors (4), and the CRE is not located adjacent to the homeodomain binding sites, octamer and heptamer (Fig. 6A) (17, 22). In addition, cAMP-stimulated transcription of the tyrosine hydroxylase gene is not synergistic with the presence of Arix (3). To map the functional Arix response element of the tyrosine hydroxylase gene, reporter constructs containing mutations in the octamer, heptamer, and nearby AP1 sites were cotransfected with RSV-Arix into the hepatoma cell line, HepG2. As predicted, mutation in the octamer and heptamer sites eliminated the response of the tyrosine hydroxylase promoter to Arix (Fig. 6B). Surprisingly, mutation in the AP1 site, 27 bases removed from the octamer and heptamer sites, also reduced the response to Arix by approximately 60%. This experiment demonstrates that the AP1 site is important for the functional activity of the nearby Arix response element, drawing a parallel between the structure and function of the tyrosine hydroxylase and dopamine beta -hydroxylase genes.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6.   The AP1 site in the TH promoter is necessary for the activation by Arix. A, a schematic representation of the rat TH promoter region outlining the positions of specific enhancer motifs examined in these experiments including AP1, dyad/E box (dyad), octamer (Octa), heptamer (Hept), hypoxia induction (HIF), and CRE sites (stippled boxes). The regulatory elements depicted are as described previously (25, 51). B, a representation of a portion of the mutant TH-CAT reporters used in the above transfection outline the Wild-type enhancer sequences of AP1, octamer (Octa), and heptamer (Hepta) (boxes) along with those of the mutations (underlined). C, PC12 cells were transiently transfected via calcium phosphate with 10 µg of wild-type or mutant TH-CAT constructs, 2 µg of RSV-luciferase, and either with (black bars) or without (stippled bars) 5 µg of RSV-Arix. CAT activities are presented as the mean value ± S.E., relative to the luciferase activity, in cell lysates from triplicate transfections. Extracts from cells transfected with only wild type TH-CAT as given a value of 1.0. The variation in basal activity between promoter constructs agrees with that previously observed (22).

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The developmental and temporal expression of the catecholamine biosynthetic genes involves the integration of multiple extracellular signals to influence specific gene expression. In the experiments reported in this study, we show that the regulation of the proximal dopamine beta -hydroxylase promoter by cAMP, or PKA, involves coordinate activation of members from two different transcription factor families, CREB/ATF and AP1. Additionally, the Rap1/B-Raf-activated MAP kinase pathway contributes to cAMP activation of dopamine beta -hydroxylase transcription. These participants, acting through multiple cAMP-dependent pathways, converge on the CRE/AP1 and homeodomain binding elements of the DB1 enhancer region, to regulate the basal, tissue-specific, and second messenger-mediated transcription of the rat dopamine beta -hydroxylase gene. A summary of these findings is presented in Fig. 7 as a model of the basal and stimulated transcription from the dopamine beta -hydroxylase promoter in relation to these transcriptional activators interacting with the DB1 enhancer.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7.   Schematic model of AP1 protein and Arix interaction with the DBH promoter involved in basal and cAMP-stimulated transcription. The evidence from this report suggests that cAMP activates multiple pathways that converge at the DB1 enhancer to stimulate transcription through a shift in the AP1 binding components to include c-Fos. Basal transcription from the promoter (top) is characterized by Arix and c-Jun/JunD proteins binding to the DB1 enhancer region at the HD and CRE/AP1 sites, respectively. Activation of PKA by cAMP results in the induction of c-Fos (Fos) binding as well as an increase in c-Jun/JunD (Jun) binding to the CRE/AP1 site (bottom). The presence of these activators together with Arix may work to stabilize the interaction of the co-activator CBP and the transcription machinery with the promoter to enhance transcription. Additionally, cAMP stimulation may activate the MAP kinase pathway through Rap/B-Raf to increase AP1:DNA binding or to alter the phosphorylation state of Arix and/or AP1 proteins facilitating transcriptional activation.

AP1 Proteins Mediate cAMP Signal-- Several experimental results suggest that binding of AP1 family members directly to the dopamine beta -hydroxylase-CRE/AP1 site following PKA activation contributes to transcriptional stimulation. First, we have previously demonstrated that a cAMP-induced complex which binds to the DB1 enhancer is disrupted by antisera broadly reactive to AP1 family members and is also competed by a consensus AP1 oligonucleotide (3). Second, we have identified c-Fos as a component of the cAMP-induced DB1 binding complex, while c-Jun and JunD proteins are components of both basal and cAMP-induced DB1 binding complexes. These findings suggest that elevation of cAMP elicits a shift in AP1 composition at the dopamine beta -hydroxylase CRE/AP1 site from Jun/JunD homo- or heterodimers in untreated cells, to include c-Fos, likely in the form of Jun:Fos or JunD:Fos heterodimers. Third, we have demonstrated that a dominant negative mutant of JunD, which disrupts AP1-dependent activities, strongly inhibits the transcriptional response to activated PKA (Fig. 3). Notably, the functional role of AP1 components in cAMP-mediated dopamine beta -hydroxylase expression is apparent not only in a chromaffin-like cell line, PC12, but was also demonstrated in a cell line derived from central catecholaminergic cells, CATH.a. This fact suggests that the findings presented here may be characteristic of catecholaminergic cells in general and not a unique character of one cell line. Support for these findings is also seen in vivo, where immobilization stress activation of dopamine beta -hydroxylase transcription in the adrenal medulla is also dependent on Fos/Jun mediation. Following immobilization stress, binding of Fos to the DB1 enhancer is increased in extracts from adrenal medulla (37), and female mice which are heterozygous for a null mutation in c-fos do not respond to immobilization stress with an increase in dopamine beta -hydroxylase mRNA as do wild-type mice (38).

The c-Fos gene has been shown to be transcriptionally regulated by cAMP, through CREB-dependent and CREB-independent means (34, 39, 40). Since c-Fos is induced by cAMP, it may be expected that cAMP regulation of gene expression would commonly be mediated by AP1 factors as well as by CREB/ATF family members. However, thus far, few genes have been identified where the cAMP signal is transmitted through AP1 proteins. Genes identified encompass those with the hybrid CRE/AP1 of TGCGTCA, including proenkephalin and prodynorphin. Our observation that dominant negative CREB is only partially effective in inhibiting PKA activation and appears to act upstream of dominant negative JunD is consistent with a role for CREB in the induction of c-Fos, and therefore AP1 activity, which subsequently activates transcription from the dopamine beta -hydroxylase promoter. However, the results observed in Fig. 4, demonstrating a lack of PMA-induced promoter activation, suggest that the mere induction of c-Fos is not sufficient to account for the transactivation of the dopamine beta -hydroxylase promoter. cAMP-dependent event(s) in addition to c-Fos induction must be required in order for transactivation of the dopamine beta -hydroxylase promoter to occur.

In addition to induction of c-Fos, cAMP-mediated events involving phosphorylation changes in AP1 proteins may influence dopamine beta -hydroxylase promoter activity. Numerous studies have shown that modulation in phosphorylation state of c-Jun and c-Fos proteins can influence their transcriptional activity (35, 36, 41-44). Uniquely in PC12 cells, PKA stimulation can lead to the activation of the MAP kinases through a Rap1/B-Raf-dependent pathway. This activation has been shown to phosphorylate and activate the Ets transcription factor Elk-1 (27). The ability of the dominant negative Rap1 construct to inhibit a portion of the cAMP response suggests the potential involvement of this pathway. Perhaps one of the components of the AP1 complex or other coactivators is a target for the MAP kinase phosphorylation cascade leading to activation of the dopamine beta -hydroxylase promoter.

Arix Participates in the PKA Response-- Previous results from our laboratory have implicated the homeodomain protein Arix as a catecholaminergic cell specific transcription factor that acts synergistically with PKA to strongly activate the dopamine beta -hydroxylase promoter (3). The recombinant protein was originally found to bind to the HD recognition sites adjacent to the CRE/AP1 site within the DB1 enhancer (17). The demonstration in this study that endogenous Arix binds to DB1 coincidentally with the AP1 components in nuclear extracts further solidifies the involvement of this factor in the regulation of the dopamine beta -hydroxylase promoter in PC12 and CATH.a cells. The functional synergism of Arix with PKA could be mediated through a recruitment of AP1 proteins to the promoter though a direct physical interaction, as, for example, has been demonstrated with Phox1 recruitment of the serum response factor to the SRE of the c-Fos gene (45). However, co-immunoprecipitation analyses have demonstrated no evidence of physical interaction of Arix with c-Fos or c-Jun (data not shown), suggesting that the biological interaction does not involve stable protein-protein interactions between of AP1 proteins and Arix. The possibility remains that an indirect reciprocal influence of AP1 factors and Arix on DNA binding could occur, via a mechanism such as DNA bending (46). Alternatively, AP1 proteins and Arix may conjointly interact with a co-activator, such as CBP, leading to mutually cooperative binding to the promoter. Since studies have demonstrated the physical interaction of c-Jun and c-Fos with CBP (47, 48), it is possible Arix may contribute to the recruitment of this co-activator. The possibility also remains that Arix is a target for phosphorylation and subsequent activation through the multiple pathways being activated by cAMP in these cells.

Functional Similarity between the Tyrosine Hydroxylase and Dopamine beta -Hydroxylase Genes-- The tyrosine hydroxylase and dopamine beta -hydroxylase genes are coordinately activated by external stimuli, and yet have a different genetic organization of the CRE and AP1 sites. While the dopamine beta -hydroxylase gene has a composite CRE/AP1 site, the tyrosine hydroxylase gene has separate sites for each regulatory influence (see Figs. 1A and 6A). A similarity between the regulation of the tyrosine hydroxylase and dopamine beta -hydroxylase genes is the importance of the AP1 element for the activation of the tyrosine hydroxylase gene by the transcription factor Arix. As with the dopamine beta -hydroxylase gene, the tyrosine hydroxylase gene interacts with AP1 proteins c-Fos, c-Jun, and JunD, and complex formation of the tyrosine hydroxylase AP1 element is enhanced when cells are treated under depolarizing conditions or increased calcium influx (49). The segment of DNA including both the AP1 and Arix binding sites of the tyrosine hydroxylase promoter is necessary for expression of the tyrosine hydroxylase promoter in cultured sympathetic ganglia (50). Taken together, these results demonstrate a functional similarity between the tyrosine hydroxylase and dopamine beta -hydroxylase genes, in that the Arix binding site interacts with a nearby AP1 site to modulate transcription of both genes. This common mechanism may underlie the coordinate regulation in cells that express the Arix homeodomain proteins. Conversely, the divergence of CRE and AP1 sites in the tyrosine hydroxylase promoter may provide for a means to differentially regulate the enzymes in cells, such as striatal neurons, which do not express the noradrenergic cell specific Arix protein.

This class of neurotransmitter biosynthetic genes, which contain a compound CRE/AP1 site, and transmit intracellular signals through AP1 proteins, allows for efficient convergence of signal transduction from external stimuli to gene transcription. Furthermore, the apparent complexity in the second messenger pathways involved in mediating a cAMP response in these cells, a direct PKA component and an indirect Rap1/B-Raf component, would provide for multiple points by which extracellular signal may modulate catecholamine enzyme transcription.

    ACKNOWLEDGEMENTS

We thank Dr. Richard Maurer for the gift of RSV-PKA, Dr. Lester Lau for the dominant negative JunD construct, Dr. Dona Chikaraishi for TH-CAT constructs containing mutation in AP1, octamer, and heptamer sites, Dr. Richard Goodman for KCREB, and Dr. Phil Stork for CMV-RapN17. We thank Megumi Adachi for critical comments during preparation of this manuscript.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grants NS33159 and GM38696 (to E. J. L.) and a fellowship from the American Heart Association, Oregon Affiliate (to D. J. S.).

Dagger To whom correspondence should be addressed. Tel.: 503-494-5076; Fax: 503-494-8393; E-mail: lewis{at}ohsu.edu.

The abbreviations used are: DBH, dopamine beta -hydroxylase; RSV, Rous sarcoma virus; CAT, chloramphenicol acetyltransferase; TH, tyrosine hydroxylase; CPT-cAMP, 8-(4-chlorophenylthio)adenosine 3':5'-cyclic monophosphate; 8-Br-cAMP, 8-bromoadenosine 3':5'-cyclic monophosphate; PMA, phorbol 12-myristate 13-acetate; CRE, cAMP response element; HD, homeodomain recognition element; PKA, cAMP-dependent protein kinase catalytic subunit a; CBP, CREB-binding protein; EMSA, electrophoretic mobility assay; MAP, mitogen-activated protein.

2 D. J. Swanson, E. Zellmer, and E. J. Lewis, unpublished observation.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Anderson, D. J. (1997) Trends Genet. 13, 276-280[CrossRef][Medline] [Order article via Infotrieve]
  2. Lo, L., Tiveron, M.-C., and Anderson, D. J. (1998) Development 125, 609-620[Abstract]
  3. Swanson, D. J., Zellmer, E., and Lewis, E. J. (1997) J. Biol. Chem. 272, 27382-27392[Abstract/Free Full Text]
  4. Lewis, E. J., Harrington, C. A., and Chikaraishi, D. M. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3550-3554[Abstract/Free Full Text]
  5. Seasholtz, A. F., Thompson, R. C., and Douglass, J. O. (1988) Mol. Endocrinol. 2, 1311-1319[Abstract]
  6. Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G., and Goodman, R. H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6682-6686[Abstract/Free Full Text]
  7. Meyer, T. E., and Habener, J. F. (1993) Endocr. Rev. 14, 269-288[CrossRef][Medline] [Order article via Infotrieve]
  8. Icard-Liepkalns, C., Faucon-Gifuet, N., Vyas, L., Robert, J. J., Sassone-Corsi, P., and Mallet, J. (1992) J. Neurosci. Res. 32, 290-298[CrossRef][Medline] [Order article via Infotrieve]
  9. Hahm, S. H., and Eiden, L. E. (1996) J. Neurochem. 67, 1872-1881[Medline] [Order article via Infotrieve]
  10. Shaskus, J., Greco, D., Asnani, L. P., and Lewis, E. J. (1992) J. Biol. Chem. 267, 18821-18830[Abstract/Free Full Text]
  11. Comb, M., Birnberg, N. C., Seasholtz, A., Herbert, E., and Goodman, H. M. (1986) Nature 323, 353-256[CrossRef][Medline] [Order article via Infotrieve]
  12. Collins-Hicok, J., Lin, L., Spiro, C., Laybourn, P. J., Tschumper, R., Rapacz, B., and McMurray, C. T. (1994) Mol. Cell. Biol. 14, 2837-48[Abstract/Free Full Text]
  13. Messersmith, D. J., Kim, D. J., Gu, J., Dubner, R., and Iadarola, M. J. (1996) Mol. Brain Res. 40, 15-21[Medline] [Order article via Infotrieve]
  14. Konradi, C., Kobierski, L., Nguyen, T. V., Heckers, S., and Hyman, S. E. (1993) Proc. Natl. Acad. Sci U. S. A. 90, 7005-7009[Abstract/Free Full Text]
  15. MacArthur, L. (1996) J. Neurochem. 67, 2256-2264[Medline] [Order article via Infotrieve]
  16. Bacher, B., Wang, X., Schulz, S., and Hollt, V. (1996) J. Neurochem. 66, 2264-2271[Medline] [Order article via Infotrieve]
  17. Zellmer, E., Zhang, A., Greco, D., Rhodes, J., Cassel, S., and Lewis, E. J. (1995) J. Neurosci. 15, 8109-8120[Abstract]
  18. Morin, X., Cremer, H., Hirsch, M.-R., Kapur, R. P, Goridis, C., and Brunet, J.-F. (1997) Neuron 18, 411-423[CrossRef][Medline] [Order article via Infotrieve]
  19. Afar, R., Silverman, R., Aguanno, A., and Albert, V. R. (1996) Mol. Brain Res. 36, 79-92[Medline] [Order article via Infotrieve]
  20. Greene, L. A., and Tischler, A. S. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 2424-2428[Abstract/Free Full Text]
  21. Suri, C., Fung, B. P., Tischler, A. S., and Chikaraishi, D. M. (1993) J. Neurosci. 13, 1280-1291[Abstract]
  22. Lazaroff, M., Patankar, S., Yoon, S. O., and Chikaraishi, D. M. (1995) J. Biol. Chem. 270, 21579-21589[Abstract/Free Full Text]
  23. Gizang-Ginsberg, E., and Ziff, E. B. (1990) Genes Dev. 4, 477-491[Abstract/Free Full Text]
  24. Maurer, R. A. (1989) J. Biol. Chem. 264, 6870-6873[Abstract/Free Full Text]
  25. Yoon, J. K., and Lau, L. F. (1994) Mol. Cell. Biol. 14, 7731-7743[Abstract/Free Full Text]
  26. Walton, J. M., Rehfuss, R. P., Chrivia, J. C., Lochner, J. E., and Goodman, R. H. (1992) Mol. Endocrinol. 6, 647-655[Abstract]
  27. Vossler, M. R., Yao, H., York, R. D., Pan, M.-G., Rim, C. S., and Stork, P. J. S. (1997) Cell 89, 73-82[CrossRef][Medline] [Order article via Infotrieve]
  28. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051[Abstract/Free Full Text]
  29. de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7, 725-737[Abstract/Free Full Text]
  30. Dignam, J. D., Lebovits, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1474[Abstract/Free Full Text]
  31. Ausbel, F. M. (1995) Current Protocols in Molecular Biology, pp. 12.1.1-12.1.9, John Wiley & Sons, New York
  32. Youssoufian, H (1998) BioTechniques 24, 198-202[Medline] [Order article via Infotrieve]
  33. Greenberg, M. E., Greene, L. A., and Ziff, E. B. (1985) J. Biol. Chem. 260, 14101-14110[Abstract/Free Full Text]
  34. Sassone-Corsi, P., Visvader, J., Ferland, L., Mellon, P. L., and Verma, I. M. (1988) Genes Dev. 2, 1529-1538[Abstract/Free Full Text]
  35. Tratner, I., Ofir, R., and Verma, I. M. (1992) Mol. Cell. Biol. 12, 998-1006[Abstract/Free Full Text]
  36. Agarwal, S., Corbley, M. J., and Roberts, T. M. (1995) Oncogene 11, 427-438[Medline] [Order article via Infotrieve]
  37. Nankova, B., Devlin, D., Kvetnansky, R., Kopin, E. J., and Sabban, E. L. (1993) J. Neurochem. 61, 776-779[CrossRef][Medline] [Order article via Infotrieve]
  38. Serova, L. I., Saez, E., Spiegelman, B. M., and Sabban, E. L. (1998) J. Neurochem. 70, 1935-1940[Medline] [Order article via Infotrieve]
  39. Velcich, A., and Ziff, E. B. (1990) Mol. Cell. Biol. 10, 6273-6282[Abstract/Free Full Text]
  40. Boutillier, A-L, Barthel, F., Roberts, J. L., and Loeffler, J.-P. (1992) J. Biol. Chem. 267, 23520-23526[Abstract/Free Full Text]
  41. Boyle, W. J., Smeal, T., Defize, L. H. K., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T. (1991) Cell 64, 573-584[CrossRef][Medline] [Order article via Infotrieve]
  42. Pulverer, B. J., Kyriakis, J. M., Avruch, J., Nikolakaki, E., and Woodgett, J. R. (1991) Nature 353, 670-674[CrossRef][Medline] [Order article via Infotrieve]
  43. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes Dev. 7, 2135-2148[Abstract/Free Full Text]
  44. Deng, T., and Karin, M. (1994) Nature 371, 171-175[CrossRef][Medline] [Order article via Infotrieve]
  45. Grueneberg, D. A., Simon, K. J., Brennan, K., and Gilman, M. (1995) Mol. Cell. Biol. 15, 3318-3326[Abstract]
  46. Kerppola, T. K., and Curran, T. (1991) Cell 66, 317-326[CrossRef][Medline] [Order article via Infotrieve]
  47. Arias, J., Alberts, A. S., Brindle, P., Claret, F. X., Smeal, T., Karin, M., Feramisco, J., and Montminy, M. R. (1994) Nature 370, 226-229[CrossRef][Medline] [Order article via Infotrieve]
  48. Bannister, A. J., and Kouzarides, T. (1995) EMBO J. 14, 4758-4762[Medline] [Order article via Infotrieve]
  49. Nagamoto-Combs, K., Piech, K. M., Best, J. A., Sun, B., and Tank, A. W. (1997) J. Biol. Chem. 272, 6051-6058[Abstract/Free Full Text]
  50. Robert, J.-J., Geoffroy, M.-C., Finiels, F., and Mallet, J. (1997) J. Neurochem. 68, 2152-2160[Medline] [Order article via Infotrieve]
  51. Norris, M. L., and Millhorn, D. E. (1995) J. Biol. Chem. 270, 23774-23779[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
P. Das, T. Ezashi, R. Gupta, and R. M. Roberts
Combinatorial Roles of Protein Kinase A, Ets2, and 3',5'-Cyclic-Adenosine Monophosphate Response Element-Binding Protein-Binding Protein/p300 in the Transcriptional Control of Interferon-{tau} Expression in a Trophoblast Cell Line
Mol. Endocrinol., February 1, 2008; 22(2): 331 - 343.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
J. Wang, M. F. Shannon, and I. G. Young
A role for Ets1, synergizing with AP-1 and GATA-3 in the regulation of IL-5 transcription in mouse Th2 lymphocytes
Int. Immunol., February 1, 2006; 18(2): 313 - 323.
[Abstract] [Full Text] [PDF]


Home page