Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Genschik, P.
Right arrow Articles by Filipowicz, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Genschik, P.
Right arrow Articles by Filipowicz, W.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 39, 25516-25526, September 25, 1998


Characterization of the Escherichia coli RNA 3'-Terminal Phosphate Cyclase and Its sigma 54-Regulated Operon*

Pascal GenschikDagger §, Krzysztof Drabikowski§, and Witold Filipowicz

From the Friedrich Miescher-Institut, P. O. Box 2543, 4002 Basel, Switzerland

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The RNA 3'-terminal phosphate cyclase catalyzes the ATP-dependent conversion of the 3'-phosphate to the 2',3'-cyclic phosphodiester at the end of various RNA substrates. Recent cloning of a cDNA encoding the human cyclase indicated that genes encoding cyclase-like proteins are conserved among Eucarya, Bacteria, and Archaea. The protein encoded by the Escherichia coli gene was overexpressed and shown to have the RNA 3'-phosphate cyclase activity (Genschik, P., Billy, E., Swianiewicz, M., and Filipowicz, W. (1997) EMBO J. 16, 2955-2967). Analysis of the requirements and substrate specificity of the E. coli protein, presented in this work, demonstrates that properties of the bacterial and human enzymes are similar. ATP is the best cofactor (Km = 20 µM), whereas GTP (Km = 100 µM) and other nucleoside triphosphates (NTPs) act less efficiently. The enzyme undergoes nucleotidylation in the presence of [alpha -32P]ATP and, to a lesser extent, also in the presence of other NTPs. Comparison of 3'-phosphorylated oligoribonucleotides and oligodeoxyribonucleotides of identical sequence demonstrated that the latter are at least 300-fold poorer substrates for the enzyme. The E. coli cyclase gene, named rtcA, forms part of an uncharacterized operon containing two additional open reading frames (ORFs). The ORF positioned immediately upstream, named rtcB, encodes a protein that is also highly conserved between Eucarya, Bacteria, and Archaea. Another ORF, called rtcR, is positioned upstream of the rtcA/rtcB unit and is transcribed in the opposite direction. It encodes a protein having features of sigma 54-dependent regulators. By overexpressing the N-terminally truncated form of RtcR, we demonstrate that this regulator indeed controls expression of rtcA and rtcB in a sigma 54-dependent manner. Also consistent with the involvement of sigma 54, the region upstream of the transcription start site of the rtcA/rtcB mRNA contains the -12 and -24 elements, TTGCA and TGGCA, respectively, characteristic of sigma 54-dependent promoters. The cyclase gene is nonessential as demonstrated by knockout experiments. Possible functions of the cyclase in RNA metabolism are discussed.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The 2',3'-cyclic phosphate termini are produced during RNA cleavage by many different endoribonucleases. For most of the known enzymes, among them many secretory degradative nucleases such as RNases A or T1, cyclic phosphates are formed as intermediates that are subsequently opened into 3'-phosphomonoesters (1, 2). For some enzymes, such as tRNA-splicing endonucleases from Eucarya and Archaea, the cyclic phosphate is a final product of the cleavage reaction (4-6). In addition, the type I topoisomerase has recently been shown to have endoribonuclease activity yielding 2',3'-cyclic phosphate termini (7). Like some protein enzymes, ribozymes such as hammerheads, hairpins, or the hepatitis delta ribozyme generate 2',3'-cyclic phosphate and 5'-hydroxyl ends during the RNA cleavage reaction (8).

That the 2',3'-cyclic phosphate has an anabolic function in RNA metabolism emerged when it was found that eukaryotic RNA ligases require 2',3'-cyclic ends for RNA ligation (9-17). This requirement applies to both of the known non-organellar RNA ligases, one ligating RNA ends by the 3',5'-phosphodiester, 2'-phosphomonoester linkage and the other joining the ends by the ordinary 3',5'-phosphodiester (reviewed in Refs. 18-20). The two ligases were shown to be involved in nuclear pre-tRNA splicing (12, 14, 21-26). In addition, the ligase generating the 3',5'-phosphodiester, 2'-phosphomonoester linkage functions in splicing the unusual intron present in HAC1 pre-mRNA in yeast (27, 28) and may also be involved in ligation of virusoid and viroid RNAs in plants (29-31). Interestingly, the only known cellular RNA ligase in eubacteria, which joins RNA ends via the 2',5'-phosphodiester, also requires 2',3'-cyclic ends for ligation (32, 33). Another finding uncovering a potential role for the 2',3'-cyclic phosphate in RNA metabolism was the demonstration that the spliceosomal U6 snRNA in many organisms has a cyclic 2',3'-phosphodiester at the terminus. The mechanism and enzymes responsible for this modification and its biological function are not known (34-36).

In light of the importance of cyclic termini in RNA metabolism, it was interesting to discover that endonucleolytic cleavage is not the only way to generate RNA molecules bearing 2',3'-cyclic phosphates. Such molecules can also be produced by the action of the RNA 3'-terminal phosphate cyclase, an enzyme that catalyzes ATP-dependent conversion of a 3'-phosphate at the end of RNA to the 2',3'-cyclic phosphodiester (11). The cyclase has been purified from HeLa cells and its mechanism of action established (37-40). The cyclization occurs in three steps: (a) Enzyme + ATP right-arrow Enzyme-AMP + PPi, (b) RNA-N3'p + Enzyme-AMP right-arrow RNA-N3'pp5'A + Enzyme, and (c) RNA-N3'pp5'A right-arrow RNA-N>p + AMP.

Evidence for the initial two steps were the identification of the covalent cyclase-AMP intermediate complex (37-39, 41) and the demonstration of the RNA-N3'pp5'A molecule accumulation when the ribose at the RNA 3' terminus is replaced with the 2'-deoxy- or 2'-O-methylribose (37). Reaction (c) probably occurs non-enzymatically as the result of nucleophilic attack by the adjacent 2'-OH on the phosphorus in the phosphodiester linkage (40).

To investigate the biological role of the cyclase, we have recently cloned a cDNA encoding the human enzyme (41). The cyclase mRNA was shown to be expressed in all tissues and cell lines analyzed. The protein is localized to the nucleus, consistent with its postulated role in RNA processing. The sequence of the human cyclase has no apparent motifs in common with any protein of known function. However, genes encoding proteins having strong similarity to the cyclase were identified in organisms belonging to all three kingdoms, Eucarya, Bacteria, and Archaea. The protein encoded by the Escherichia coli gene was overexpressed and purified and was shown to have RNA 3'-terminal phosphate cyclase activity (41). Conservation of the cyclase among eukaryotic and prokaryotic organisms suggests that the enzyme performs an important function in RNA metabolism.

In this work, we describe the characterization of the E. coli cyclase and demonstrate that its gene forms part of a so far uncharacterized operon that belongs to the class of operons controlled by the alternative sigma 54 factor.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

General Procedures-- Unless stated otherwise, all techniques for manipulation of DNA and RNA, commonly used buffers, and media were as described (42, 43).

Bacterial Strains and Plasmids-- E. coli strains YMC10 (thi-1 endA1 hsdR17 supE44 Delta lacU169 hutCk) and YMC22 (like YMC10, but rpoN::Tn10) (44) and plasmid pTH7 were obtained from Drs. M. Carmona-Perez and B. Magasanik (MIT, Cambridge, MA). pTH7 contains the E. coli sigma 54 (rpoN) gene cloned downstream of the tac promoter on a pBR322 derivative (45). The strain used for gene replacement, MC1061 (F- araD139 Delta (ara-leu)7697Delta (lac)X74 galU galK strA), and plasmid pMAK705 (46) were obtained from Drs. S. Kushner (University of Georgia, Athens, GA) and J. Offengand (University of Miami, FL). pBluescript II KS+ and pREP4 were from Stratagene and Qiagen, respectively.

Plasmid pRtcB, containing the rtcB gene and its flanking sequences, was obtained by cloning of the PCR1-amplified E. coli DNA fragment into the EcoRV site of pBluescript II KS+; oligonucleotides GGCACGACGGTTGCAATTATCAGG and CAGCGCAATCATCCTTTTCATC were used as amplification primers. Plasmids pRtcR and pRtcRDelta N, expressing the RtcR activator and its N-terminally truncated version, respectively, were constructed as follows. The rtcR gene with flanking regions was amplified by PCR using as a template lambda  phage DD765 DNA (kindly provided by Drs. G. Plunkett and F. Blattner, University of Wisconsin, Madison, WI) and cloned into pBluescript II KS+, yielding plasmid pKD4. HindIII and BamHI sites were introduced by oligonucleotide-directed PCR mutagenesis at the 5' and 3' ends of the rtcR gene, respectively, using pKD4 as a template. The PCR product was cloned into HindIII and BamHI sites of the pHSG765 vector containing a chloramphenicol resistance marker (47), yielding plasmid pRtcR. In this plasmid, the rtcR gene is expressed under the control of the lacZ promoter as a translational fusion with six amino acids of beta -galactosidase at the N terminus. pRtcRDelta N, expressing the N-terminally truncated mutant of RtcR, was constructed similarly except that the HindIII site was introduced 21 nucleotides upstream of the beginning of the region encoding the central domain of RtcR (the translation product starts with MTMITPLDFLKSG ... ; the first L residue shown in italics corresponds to amino acid 179 of RtcR). Identity of inserts in pRtcB, pRtcR, and pRtcRDelta N was verified by sequencing.

Plasmid pMAK705cyc::Kmr used for gene disruption was constructed as follows. The 1,324-bp SmaI-HindIII fragment from pREP4, containing the kanamycin resistance gene, was first cloned into SmaI-HindIII sites of pBluescript KS (Stratagene), yielding pBSKmr. Fragments corresponding to the 5'-flanking (620 bp) and 3'-flanking (669 bp) regions of the cyclase gene (obtained by PCR using the E. coli genomic DNA as a template and oligonucleotides TGCGCCATCGATCGCAATCATCCTTTTCATC and CTTACTTTGTCGACCTGGCACAAAAAGAGATG as the 5'-region-specific primers and oligonucleotides ATCTCTAGAGTAACCTGTTGCTGCTTAATC and GGTCGCGGATCCCTCATGCCATCTGCTGAC as the 3'-region-specific primers) were then cloned stepwise into pBSKmr, using the ClaI-SalI and XbaI-BamHI sites, respectively, yielding pBScyc5'3'/Kmr. Finally, the 2.6-kilobase SalI-XbaI fragment from pBScyc5'3'/Kmr, encompassing the kanamycin resistance gene (Kmr) and the rtcA gene upstream and downstream regions, was cloned into XbaI-SalI sites of pMAK705, yielding pMAK705cyc::Kmr.

Preparation of the E. coli Cyclase and Its Substrates-- The cyclase was overexpressed as His-tagged protein in the E. coli strain BL21(DE3) and purified on an Ni-nitrilotriacetic acid column as described previously (41). Cyclase purity was >95% as judged after Coomassie Blue staining of the gel (41). Protein concentration was measured by the method of Bradford using the reagent obtained from Bio-Rad and bovine serum albumin as a standard.

The oligoribonucleotide substrates, CCCCACCCCGp* and AAAAUAAAAGp*, were prepared as described previously (41). For use in some experiments, the substrates were additionally purified on a 10% polyacrylamide, 8 M urea gel. Aliquots of radioactive substrates were analyzed by digestion with RNase T2, nuclease P1, or calf intestine phosphatase (9), followed by TLC on cellulose plates in solvent A (see below). Over 90% of the label was always present as the terminal G3'p*. The E. coli 5 S rRNA (Boehringer Mannheim) and the in vitro transcribed human U14 snoRNA (kindly provided by F. Dragon of this laboratory) were 3'-terminally labeled using [5'-32P]pCp and T4 RNA ligase as described (41). Preparation of the unlabeled competitors, AAAAUAAAAG3'p (referred to as RNA3'p) and AAAATAAAAG3'p (referred to as DNA3'p), and their 3'-OH-terminated counterparts (referred to as RNA3'OH and DNA3'OH, respectively) as well as preparation of CCCCACCCCG3'p and (dN)npdN3'p (representing a mixture of 3'-phosphorylated oligodeoxyribonucleotides (n = 8-14); referred to as DNA3'p (m.n.)), was as described (41). TLC was in solvent A (isobutyric acid:concentrated NH3:H2O (66:1:33)) or solvent B (saturated (NH4)2SO4:3 M sodium acetate:isopropyl alcohol (80:6:2)).

Cyclase Assays-- Cyclase activity was assayed by the Norit method as described before (40, 41). Unless indicated otherwise, 10-µl assays contained 30 mM Hepes-KOH, pH 7.6, 180 mM NaCl, 2 mM MgCl2, 0.15 mM EDTA, 0.1 mM spermidine, 1.25 mM dithiothreitol, 0.005% Triton X-100, 5% glycerol, 0.2 mM ATP, 30-90 fmol (10,000-25,000 cpm) of the substrate (either AAAAUAAAAGp* or CCCCACCCCGp*; both substrates yielded similar results), and 20-200 pg of the recombinant E. coli cyclase. Incubations were for 20 min at 25 °C. For pH optimum determination, a three-buffer system containing 0.1 M MES, 0.05 M Tris, 0.05 M ethanolamine (48) was used. The buffer was adjusted to the desired pH at 25 °C. Other details are indicated in the figure legends.

Km values for ATP and GTP were calculated from Lineweaver-Burk plots. Assays were performed under standard conditions in the presence of five different concentrations of ATP (2.5-200 µM) or GTP (7.4 µM-1 mM). Velocities were calculated from the initial linear rates.

Labeling of the cyclase with different [alpha -32P]NTPs was performed under cyclase assay conditions except that the AAAAUAAAAGp* substrate was omitted. Reactions (10 µl) contained 1.2 µM [alpha -32P]NTPs (specific activity 800 Ci/mmol) or 0.33 µM [alpha -32P]dATP (specific activity 3,000 Ci/mmol) and indicated amounts of the cyclase and were incubated at 25 °C. The reactions were analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography. Immediately before gel electrophoresis, samples were supplemented with respective unlabeled NTPs or dATP to a final concentration of 10 mM.

For AMP release assays, 1.8 ng of the cyclase was first adenylylated under standard conditions in the presence of 1.7 µM [alpha -32P]ATP (specific activity 800 Ci/mmol), with no substrate added, for 2 h at 25 °C. The reactions were then diluted 7-fold with cyclase assay buffer, different amounts of competitors were added, and incubations were continued for 15 min at 25 °C. The reactions were analyzed as described above.

RNA Isolation from E. coli Cells-- Bacterial cultures were grown in LB medium containing, when appropriate, 100 mg/liter ampicillin, 20 mg/liter kanamycin, or 10 mg/liter chloramphenicol, to an A600 of 1.0 (49). When required, isopropyl-1-thio-beta -D-galactopyranoside was added to 1 mM concentration for the last 30 min of growth. Bacteria were harvested by centrifugation. Total RNA was isolated with RNeasy spin columns (Qiagen) according to the manufacturer's recommendations, followed by DNase treatment (20 min at 37 °C, 0.1 unit/µl RNase free DNase (Promega) in 50 mM Tris-HCl, pH 7.5, 1 mM MgCl2). The column fractionation and DNase treatment were repeated twice. After the second DNase treatment, the enzyme was inactivated by heating for 5 min at 72 °C, and RNA was directly used for cDNA synthesis.

RT-PCR-- cDNA synthesis was performed in a 40-µl volume. Reactions contained the first-strand synthesis buffer for Superscript II reverse transcriptase (Life Technologies, Inc.), 10 mM dithiothreitol, 1 mM of each dNTP, 2.5 µM random hexamers (Promega), 50 ng/ml RNA, and 100 units of RNase H- SuperScript II reverse transcriptase (Life Technologies, Inc.). Incubations were for 12 min at 21 °C, followed by 45 min at 42 °C. Reverse transcriptase was inactivated by heating for 5 min at 95 °C.

PCR reactions were performed in a 50-µl volume. They contained the native Taq polymerase buffer (Stratagene), 0.5 µM primers, 4 µl of the cDNA synthesis reaction, and 1.5 units of native Taq polymerase (Stratagene). In addition, reactions contained 2 nmol (~50,000 cpm) of one of the primers that had been 5'-end labeled using [gamma -32P]ATP (3,000 Ci/mmol; Amersham Pharmacia Biotech) and T4 polynucleotide kinase and purified on a 20% acrylamide, 8 M urea gel. 21 PCR cycles were performed (1 min, 95 °C; 1 min, 65 °C; 1 min, 72 °C). Primers for the following genes were used: rtcA (TGAGCCTGTCGATGATAACC and AGCACCAGCGTACAACTTCC), rtcB (GTGAAGAGATCTACGTGACG and GATAACTTCCACCAGATCGC), rtcR N terminus (CGTTGGTCATCGATCGACTG and GCTTCTGCCAGCAGAAACCA), rtcR C terminus (GCATACGGTCGAAGAGATCG and TCTCTGGACCTTCACCCTGC), rpoN (AGGTTAACTTGCTCTCGCTC and GCCAAATGGTTGATCAAGAG), and ribosomal protein S5 (rpsE) gene (CAACGGATTTACCACGCTTGGCA and TTCCAGCAGCGATCCAGAAAGC). The unique specificity of each primer pair was verified using E. coli genomic DNA as a template. Furthermore, in additional control experiments, it has been demonstrated that formation of the RT-PCR products with all pairs of primers was dependent upon the reverse transcription step, indicating that RNA samples were not contaminated with chromosomal or plasmid DNA (data not shown). PCR reactions with different pairs of primers were always performed with the same batch of cDNA. Products of PCR reactions were separated on 2% agarose gels. Gels were dried on the DEAE-cellulose paper (Whatman) support and exposed to an x-ray film. It has been found with the N-terminal rtcR pair of primers that within an 18- to 24-cycle range, there is a linear relationship between the number of PCR cycles and the amount of amplified product.

Primer Extension-- An oligodeoxynucleotide complementary to rtcB mRNA, CCTTTGGTCCACATTTTTACC, was 5'-end 32P-labeled and purified as described above. Annealing reactions contained 20 pmol of the primer and 20 µg of RNA in 160 mM Hepes-KOH, pH 7.7, 1 M NaCl, and 1 mM Na2-EDTA. After heating at 95 °C for 2 min and annealing overnight at 48 °C, the mixture was ethanol precipitated and dissolved in 20 µl of the first-strand synthesis buffer for Superscript II reverse transcriptase containing 10 mM dithiothreitol, 1 mM of each dNTP, and 400 units of Superscript II reverse transcriptase. After 1 h at 42 °C, the reaction was processed for analysis on a 10% acrylamide, 8 M urea gel.

Cyclase Gene Replacement-- Chromosomal insertion and excision steps with pMAK705cyc::kmr, resulting in the replacement of the nearly complete rtcA (the remaining rtcA regions encode the 7 N-terminal and 34 C-terminal amino acids) by kmr, were performed in the E. coli strain MC1061 as described (46). Southern blot analysis and PCR reactions, using primers specific for the cyclase coding and flanking regions, and for the kanamycin resistance gene, performed with DNA isolated from both the knockout and control MC1061 strains, confirmed that the gene replacement had taken place.

Characterization of the Human cDNA Encoding an RtcB-like Protein-- A human cDNA clone (GenBank R61436) encoding RtcB-like protein was obtained from the I.M.A.G.E. Consortium (Livermore, CA). The clone was sequenced on both strands, using appropriate oligonucleotide primers. The sequence encoding 29 N-terminal amino acids missing in this clone was obtained by RT-PCR using sequence information derived from the highly conserved mouse cDNA clone (GenBank W42119) to design the forward PCR primer. Poly(A)+ RNA from HeLa cells, kindly provided by P. Pelczar of this laboratory, was used to generate single-stranded cDNA as described above. The PCR reaction was performed on 200 ng of cDNA using as a forward primer the oligonucleotide ATGAGTCGTAACTACAACGATG. This sequence encompasses the ATG initiation codon (shown in italics) and the adjacent 5'-untranslated region nucleotides of the mouse cDNA. The backward primer, ATCATTCACATAGAAAACACC, was complementary to the human cDNA sequence, 120 nucleotides downstream of the ATG codon. The PCR-amplified fragment was cloned into the EcoRV site in pBluescript II KS+, and the insert was sequenced. The sequence of the 5'-terminal part of the cDNA encoding human RtcB-like protein was further confirmed by inspection of two recent expressed sequence tag entries (GenBank AA090429 and AA 232068).

Computer Analysis-- Unless indicated otherwise, sequence management and analysis were performed with the GCG Wisconsin package of programs (Genetics Computer Group, Madison, WI) on the UNIX platform. Protein sequence alignments were performed with the ClustalW 1.5 program (50), using default parameters; the alignment was improved manually. Shading of amino acids was performed with the BOXSHADE program at the BOXSHADE WWW server at the University of Lausanne (http://ulrec3.unil.ch/software/boxshade/boxshade.html). Phylogenetic analysis was performed with the PHYLIP package (51). The ClustalW 1.6 multiple-sequence alignment served as an input file for the PROTDIST program, which generated the distance matrix. The distance matrix was further analyzed by the NEIGHBOR program to obtain an evolutionary tree. The statistical significance of phylogenetic relationships was assessed by bootstrapping analysis with the BOOTSTRAP program; 500 data sets were analyzed by the PROTDIST program, generating distance matrices for all these data sets. Phylogenetic trees were generated from these matrices with the NEIGHBOR program. A consensus tree was generated with the CONSENSE program. Helix-turn-helix motifs were predicted with the helix-turn-helix program version 1.0.5 (52).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Requirements of the E. coli Cyclase-- To compare the human and E. coli enzymes, we have studied requirements of the overexpressed and purified bacterial protein using oligoribonucleotides specifically labeled at the 3'-terminal phosphate, AAAAUAAAAGp* or CCCCACCCCGp*, as substrates. The cyclization reaction with the E. coli enzyme showed a pH optimum of 8.0-8.5 (Fig. 1A). The reaction required the presence of divalent cations, either Mg2+ or Mn2+. In the presence of Mn2+, the enzyme activity was 50-70% higher than in the presence of Mg2+. With both cations, a broad optimum was found at 1-4 mM. No activity was seen when 2 mM Mg2+ or Mn2+ was replaced with 2 mM Ca2+, Zn2+, or Cu2+ (Table I and data not shown). The efficiency of Mn2+ as a cofactor distinguishes the E. coli and human enzymes. In the presence of Mn2+ ions, the human protein, either purified from HeLa cell extracts (39) or bacterially overexpressed (Table I), showed only 5 and 17%, respectively, of the activity seen with Mg2+. Activity of the E. coli enzyme was similar at 0 and 0.1 M NaCl (in addition to 30 mM Hepes-KOH). Addition of NaCl to 0.2 or 0.4 M inhibited cyclization by 30 and 70%, respectively. At 20 or 50 mM, sodium phosphate did not inhibit the reaction, but sodium pyrophosphate was strongly inhibitory (86 and 98% inhibition, respectively) (Table I and data not shown).


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 1.   pH optimum (A) and effect of different nucleoside triphosphates on cyclization of AAAAUAAAAGp* (B). Assays were performed as described under "Materials and Methods" except that the three-buffer system containing 0.1 M MES, 0.05 M Tris, 0.05 M ethanolamine was used in A. A similar pH dependence curve was obtained when this buffer was replaced by 30 mM MES-NaOH (pH 5.0-6.5), MOPS-NaOH (pH 6.0-7.5), and Tris-HCl (pH 6.8-8.8). The concentration of NTPs in B was 0.2 mM.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Requirements of the E. coli cyclase
Components present in complete reactions and assay conditions were as described under "Materials and Methods." In experiment 2, the E. coli cyclase was replaced by 1.7 ng of the recombinant human enzyme (41). In experiment 4, the concentration of all added nucleoside phosphates was 2 mM. Values of 100% in experiments 1-4 correspond to 11.1, 25.7, 56, and 12.3 fmol, respectively.

The activity of different nucleoside triphosphates as cofactors in the cyclization reaction was compared. ATP was found to be the most efficient cofactor, and considerable activity was also seen with GTP. UTP, CTP, and dATP were much less active (Fig. 1B). Km values for ATP and GTP were 20 and 100 µM, respectively (see "Materials and Methods"). Previously determined values for the human enzyme are 6 µM (ATP) and 200 µM (GTP) (38, 39). ADP and AMP were not active as cofactors (Table I). Likewise, ATP could not be replaced by either alpha ,beta -methylene (AMPCPP), beta ,gamma -methylene (AMPPCP), or beta ,gamma -imido (AMPPNP), all nonhydrolyzable analogs of ATP. ATPgamma S was about 20% more active than ATP (Table I). Similar observations were previously made for the human cyclase (37, 38, 40).

To test whether the cyclization reaction catalyzed by the bacterial cyclase proceeds via the formation of the covalent enzyme-NMP intermediate, the cyclase was incubated with different [alpha -32P]NTPs, and resulting complexes were analyzed by SDS-polyacrylamide gel electrophoresis. At a low cyclase concentration (12 ng/assay), radiolabeling of the enzyme could only be detected with [alpha -32P]ATP and [alpha -32P]GTP, but not with [alpha -32P]CTP, [alpha -32P]UTP, or [alpha -32P]dATP (Fig. 2A and data not shown). The labeling with ATP was more efficient than with GTP (Fig. 2A, compare lanes 2 and 5). When 100-fold more protein (1.2 µg/assay) was used, covalent labeling of the cyclase was also detected with [alpha -32P]CTP, [alpha -32P]UTP, and [alpha -32P]dATP (Fig. 2B).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 2.   Labeling of the cyclase with alpha -32P-labeled ribonucleoside triphosphates and [alpha -32P]dATP. Assays contained 12 ng (A) or 1.2 µg (B) of the cyclase and were incubated in the presence of indicated labeled triphosphates for the time shown above the autoradiograms. Positions of protein size markers (in kDa) are indicated.

Substrate Specificity-- The foregoing experiments have shown that the E. coli enzyme can catalyze the cyclization of the 3'-terminal phosphate in synthetic oligoribonucleotides such as CCCCACCCCGp, AAAAUAAAAGp, and AAAAUAAAAGCp (41). We have tested the ability of two natural RNAs, the E. coli 5 S rRNA and human U14 snoRNA, to act as substrates. The RNAs were modified by ligation of [5'-32P]pCp to the 3' terminus. Incubation with the E. coli cyclase resulted in the formation of 2',3'-cyclic phosphate termini in both RNAs as determined by digestion with nuclease P1, followed by TLC on cellulose plates (data not shown; see "Materials and Methods").

For the human cyclase, we have previously demonstrated that prolonged incubation of the 3'-phosphorylated oligodeoxyribonucleotides with an excess of the enzyme generates low amounts of products bearing dN3'pp5'A at the 3' terminus. Competition experiments have shown that 3'-phosphorylated oligodeoxyribonucleotides are ~500-fold poorer substrates than oligoribonucleotides (41). Two different assays were used to compare the ability of the 3'-phosphorylated oligoribonucleotide AAAAUAAAAG3'p, referred to as RNA3'p, and the oligodeoxyribonucleotide of equivalent sequence, AAAATAAAAG3'p, referred to as DNA3'p, to act as substrates for the E. coli cyclase. Using a competition assay (Fig. 3A), it was found that RNA3'p and another oligoribonucleotide, CCCCACCCCG3'p, are approximately 1,000-fold better competitors than DNA3'p in the cyclization reaction carried out with the radiolabeled AAAAUAAAAG3'p* as a substrate. A mixture of 3'-phosphorylated oligodeoxyribonucleotides ((dN)npdN3'p, n = 8-14), obtained by limited digestion of a synthetic 80-mer oligodeoxyribonucleotide with micrococcal nuclease and referred to as DNA3'p(m.n.), was also an about 300-fold poorer competitor than RNA3'p. 3'-Hydroxyl-terminated oligoribonucleotides and oligodeoxyribonucleotides, RNA3'OH and DNA3'OH, did not compete with the cyclization of AAAAUAAAAG3'p* even when added at 10,000-fold excess (Fig. 3A).


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 3.   Activity of oligoribonucleotides or oligodeoxyribonucleotides containing either 3'-p or 3'-OH termini in the competition (A) and AMP (B) release assays. A, cyclase assays were performed as described under "Materials and Methods." They contained 1.2 ng of the cyclase, 50 fmol of AAAAUAAAAG3'p*, and different unlabeled oligonucleotides at molar excess over AAAAUAAAAG3'p* as indicated. Inset, competition by nucleoside 3'-phosphates and nucleoside 5',3'-bisphosphates (pN3'p) or nucleoside 5',2'-bisphosphates (pN2'p), all added at 6,000-fold molar excess. The 100% value corresponds to 50 fmol of AAAAUAAAA>p* formed. B, AMP release assays were performed as described under "Materials and Methods." Different amounts of competitors were added: none (lane N), 3 fmol (lane a), 33 fmol (lane b), 330 fmol (lane c), 3,300 fmol (lane d), 20 pmol (lane e), and 200 pmol (lane f).

In the second assay, the oligoribonucleotides and oligodeoxyribonucleotides were compared for their ability to release AMP from the performed adenylylated enzyme complex. The complex was formed by preincubation of the protein with [alpha -32P]ATP. Incubations were then continued in the presence of increasing quantities of different oligonucleotides. Addition of 33 fmol of RNA3'p decreased the amount of the complex by more than 50% (Fig. 3B, lane b), and no complex was detected when 330 or 3,300 fmol of RNA3'p was added in the second incubation (lanes c and d). In contrast, incubation in the presence of 330 or 3,300 fmol of RNA3'OH, DNA3'p, or DNA3'OH (lanes c and d) did not result in the release of the label from the preformed complex. In the presence of even higher amounts (20 and 200 pmol), DNA3'p but not DNA3'OH resulted in AMP release from the complex (Fig. 3B, lanes e and f).

Competition experiments, similar to those shown in Fig. 3A, were also carried out using nucleoside 3'-monophosphates (Np) and nucleoside 5',3'-bisphosphates (pN3'p) or nucleoside 5',2'-bisphosphates (pN2'p) as competitors. No significant competition for the cyclization of AAAAUAAAAG3'p* was observed when 6,000-fold molar excess of each compound was used (Fig. 3A, inset). A small inhibitory effect of pC3'p and pdCp was probably unspecific as incubation of radiolabeled [5'-32P]pC3'p with an excess of the cyclase for 5 h at 25 °C did not result in detectable formation of pC>p as verified by TLC (data not shown). Identical inhibition with pC3'p and pdCp also argues against these compounds acting as cyclase substrates because oligodeoxyribonucleotides or 2'-deoxy-terminated oligoribonucleotides were found to be much less efficient substrates for the enzyme (Fig. 3 and data not shown).

Taken together, the results presented in this section indicate that E. coli cyclase can efficiently use as substrates 3'-phosphate-terminated RNA molecules of different sequence and base composition and that ribonucleoside 3'-monophosphates and 5',3'-bisphosphates do not act as substrates. Furthermore, 3'-phosphate-terminated DNA molecules are two to three orders of magnitude poorer substrates than RNAs.

Structure of the Cyclase Operon-- The gene encoding the cyclase, named rtcA (for RNA terminal phosphate cyclase orfA), is positioned at 76 min on the E. coli K12 chromosome. rtcA probably forms part of an uncharacterized operon, the structure of which is schematically shown in Fig. 4. Another ORF transcribed in the same direction, named rtcB, is present upstream of rtcA. As the termination codon of rtcB is immediately followed by the AUG of rtcA, it is very probable that the two genes are transcribed into a dicistronic mRNA. Inspection of the region positioned upstream of rtcB suggested that transcription of the rtcB/rtcA unit may involve the alternative sigma 54 factor. The region likely to correspond to the rtcB/rtcA promoter contains TTGCA and TGGCA elements, the sequences and spacing of which are identical with the -12 and -24 elements constituting recognition signals for sigma 54 (53-55). Moreover, there are two putative binding sites for the integration host factor, known to be involved in transcription of many sigma 54-specific promoters (56-59), further upstream. Finally, the ORF positioned upstream of rtcB, named rtcR, which is transcribed in the opposite direction, encodes a protein having all the features of sigma 54-dependent regulators (Fig. 4; see below). Initiation of transcription by sigma 54-RNA polymerase holoenzyme requires additional activator proteins that bind to enhancer-like sequences typically positioned 100-200 bp upstream from the transcription start site (reviewed in Refs. 58, 60-62).


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 4.   Structure of the cyclase operon and the sequence of the intergenic promoter region between rtcB and rtcR. Genes constituting the cyclase operon are shown as filled black arrows. The rtcB transcription start site, as established by primer extension analysis (Fig. 7), is indicated by a bent arrow. Translation start sites for rtcB and rtcR are marked with arrows, and putative Shine-Dalgarno sequences are underlined. The -12 and -24 consensus sequences characteristic of sigma 54 promoters are boxed. Sequences resembling the most highly conserved regions of the consensus binding site, AATCAAN4TTA, for the integration host factor (IHF) are indicated by boxes connected by the dotted lines. The boxed sequences are flanked by AT-rich regions, which contain at many positions nucleotides conforming with the extended integration host factor consensus (80, 81). Inspection of the upstream region of the rtcA/rctB promoter did not identify obvious sequence repeats that could act as likely targets for RtcR.

A schematic structure of the rtcR-encoded protein is shown in Fig. 5A. Generally, sigma 54-specific regulators comprise three different domains: the N-terminal regulatory or sensory domain, the highly conserved central domain responsible for ATP hydrolysis and interaction with sigma 54, and the C-terminal DNA binding domain, which contains a helix-turn-helix motif (reviewed in Refs. 58, 60-62). The central domain of RtcR shows 28-39% identity and 56-61% similarity with counterparts in other regulators of this class and contains conserved regions C1-C7 found in other members of the family (61). The N-terminal domain does not have significant sequence similarity to any of the known sigma 54 class regulators or other proteins deposited in the data bases; it also does not contain conserved Asp residues characteristic of the members of two component systems (61, 63, 64). Alignment of C-terminal domains of RtcR and a representative selection of known sigma 54 regulators (Fig. 5B) suggests that RtcR has an atypical DNA binding domain with the helix-turn-helix motif containing a 20-amino acid-long turn. Helix-turn-helix motifs with turns as long as 20 amino acids have been identified in some structurally characterized DNA binding proteins (65). Phylogenetic analyses, performed with the PHYLIP program, indicated that within a family of sigma 54 class activators, RtcR does not resemble any particular known activator more than others (Fig. 5C). A similar conclusion was reached when phylogenetic analyses were carried out separately for each of the three domains of the regulator (data not shown).


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 5.   Structural properties and phylogenetic analysis of RtcR. A, schematic structure of RtcR. Positions of the N-terminal regulatory domain, central domain, and a putative DNA binding domain are indicated. B, alignment of the C-terminal portion of the putative DNA binding domain of RtcR with a representative selection of other known sigma 54-specific regulators. Names of the regulators, corresponding to SwissProt annotations, and the bacteria from which they originate are indicated. Positions corresponding to the first amino acid shown are also specified. Identical amino acids and amino acids conserved in at least 50% of sequences are indicated by black and gray boxes, respectively. Regions corresponding to the helix-turn-helix motif and to the additional N-proximal helix (65) are marked with vertical lines. The LevR regulator, which most probably contains its DNA binding domain at the N terminus (67), is not included in the comparison. C, phylogenetic analysis of sigma 54-specific transcriptional regulators, performed with the PHYLIP package of programs. Numbers at branch points indicate the percentage of trees in the data set matching the consensus tree. Branch lengths are proportional to phylogenetic distances. For additional information, see "Materials and Methods."

Involvement of RtcR and sigma 54 in Transcription of the Cyclase Operon-- sigma 54-specific regulators are usually constitutively expressed but not constitutively active (reviewed in Refs. 58, 61, 62, 64). For some regulators, it has been shown that deletion of the sensory domain derepresses ATPase activity of the regulator and makes it constitutively active (64). To investigate whether the RtcR regulator plays a role in expression of the cyclase operon, we have tested the effect of overexpression of wild-type and N-terminally truncated forms of RtcR on transcription of rtcA and rtcB in the strain YMC10 and its derivative YMC22, containing the inactivated sigma 54 gene. RNA isolated from either control bacteria or from bacteria transformed with plasmids expressing the full-length RtcR or its N-terminally truncated form, RtcRDelta N, was reverse transcribed using random hexamers as primers. Resulting cDNAs were utilized as templates for PCR, using pairs of oligodeoxynucleotide primers specific for rtcA and rtcB and, as controls, the genes encoding sigma 54 (rpoN) and a ribosomal protein S5 (rpsE). Expression of the rtcR gene was monitored with two pairs of primers, one specific for the region encoding the N-terminal part of RtcR and another specific for the C-terminal part.

Results of RT-PCR analysis are shown in Fig. 6. As expected, overexpression of the mRNA encoding the wild-type RtcR could be visualized with both the rtcR N-terminal and C-terminal pairs of primers (lanes 4), whereas that of RtcRDelta N mRNA could be visualized with only the C-terminal primers (lanes 5-7). Expression of rtcR in nontransformed bacteria was found to be very low and could only be visualized when more PCR cycles were performed (data not shown). Transcription of rtcA and rtcB was observed in YMC10 cells expressing the N-terminally truncated (lanes 5) but not wild-type (lanes 4) RtcR. Neither rtcA nor rtcB was expressed in the YMC22 sigma 54 knockout strain transformed with pRtcRDelta N alone (lanes 6). However, transcription of both genes took place when YMC22 was additionally cotransformed with pTH7, which encodes sigma 54 (lanes 7). Activation of rtcA and rtcB transcription by the N-terminally truncated but not wild-type RtcR was also observed in E. coli BL21(DE)pLysS cells transformed with plasmids in which expression of the regulators is driven by the T7 promoter (data not shown).


View larger version (61K):
[in this window]
[in a new window]
  		Fig. 6.   Transcription of rtcA and rtcB genes in response to overexpression of the wild-type and N-terminally truncated RtcR. Bacterial strains and plasmids used for transformations are indicated at the top. cDNA prepared from either nontransformed bacteria or bacteria transformed with indicated plasmids was used as a template for PCR, using pairs of oligodeoxynucleotide primers (one of them being 32P-labeled) specific for rtcA, rtcB, rtcR (two pairs of primers, specific for regions encoding N-terminal and C-terminal parts of the gene, respectively), and genes coding for sigma 54 (rpoN) and a ribosomal protein S5 (rpsE). Far left lanes, size markers (in bp). The sigma 54 (rpoN) lanes are overexposed to visualize sigma 54 mRNA expression in bacteria not transformed with pTH7.

To obtain additional evidence that expression of the cyclase operon involves sigma 54, the transcription start site of the rtcB/rtcA mRNA was determined by primer extension. The analysis was performed with RNA isolated from both YMC10 and the YMC22 sigma 54 knockout mutant, each overexpressing the N-terminally truncated form of RtcR. Consistent with the experiments presented in Fig. 6, the primer extension product was only identified when RNA from YMC10 was used as a template (Fig. 7). The 5'-end of the RNA mapped to the C residue positioned 11 nucleotides downstream of the putative -12 TTGCA box present in the rtcB upstream region.


View larger version (62K):
[in this window]
[in a new window]
  		Fig. 7.   Mapping of the 5'-end of rtcB/rtcA mRNA by primer extension. Extension reactions were carried out with RNA isolated from YMC10 (lane 1) or YMC22 (lane 2) strains, both transformed with pRtcRDelta N. Lanes G, A, T, and C represent sequencing reactions performed with the plasmid pRtcB as a template and the primer used for extension assays. The major primer extension product is indicated by an arrow. The sequence around the start site (marked with an asterisk) and the -12 box is shown on the left.

Taken together, the results presented above indicate that both sigma 54 and the sigma 54-specific regulator RtcR are involved in expression of the cyclase operon.

rtcA Is a Nonessential Gene-- To investigate whether the rtcA gene product is essential for E. coli growth, the central 90% of the rtcA coding region was replaced by homologous recombination with a gene coding for kanamycin resistance in the strain MC1061 (46). The replacement was confirmed by Southern and PCR analyses (data not shown; see "Materials and Methods"). No differences in growth of the parent and the rtcA null strain on either LB or a minimal M9 medium were observed (data not shown).

Genes Similar to rtcB Are Present in Archaea and Eucarya-- Genes encoding cyclase-like proteins are conserved among Eucarya, Bacteria, and Archaea (41). By searching sequence data bases, we have found that also genes similar to rtcB, the gene likely to be cotranscribed with the cyclase gene in E. coli, are present in other organisms such as Methanococcus jannaschii and Caenorhabditis elegans, representing two other kingdoms. Expressed sequence tags encoding RtcB-like proteins in humans have also been identified. The human cDNA was fully sequenced, and the protein encoded by it is included in the alignment shown in Fig. 8 (for sequences of RtcB-like proteins in other species, see legend). The E. coli RtcB and other related proteins listed in Fig. 8 show no significant sequence similarity or motifs in common with proteins of known function deposited in public data bases. The noteworthy feature of RtcB proteins is the presence of six conserved histidine residues, suggesting possible involvement of a metal ion in RtcB function.


View larger version (149K):
[in this window]
[in a new window]
  		Fig. 8.   Alignment of the RtcB protein from E. coli (SwissProt P46850) with related proteins from M. jannaschii (Q58095), C. elegans (P90838), and Homo sapiens (this work). Genes or expressed sequence tags encoding RtcB-like proteins or their fragments were also identified in mouse, Toxoplasma gondii, Methanobacterium thermoautotrophicum, Archaeglobus fulgidus, Mycobacterium leprae, and Mycobacterium tuberculosis (GenEMBL, release 106), in Pseudomonas aeruginosa (Pseudomonas Genome Project; http://www.pseudomonas.com/), and in Deinococcus radiodurans and Thermotoga maritima (The Institute of Genomic Research, Gaithersburg, MD). For other details, see legend to Fig. 5B.

The RtcB protein was overexpressed in E. coli as a C-terminal His6-tag fusion and purified on the Ni-nitrilotriacetic acid column. The recombinant protein contained no detectable RNase or RNA ligase activities (the latter assayed with 5'-hydroxyl and cyclic-phosphate-terminated RNA substrates). Likewise, it had no phosphodiesterase activity opening the cyclic phosphate in RNA or pG>p to either a 3'- or 2'-monoester or a phosphatase activity removing the 3'-phosphate from RNA. Addition of RtcB had no effect on the cyclization reaction catalyzed by the E. coli RNA 3'-phosphate cyclase (data not shown).

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Recent cloning of a cDNA encoding the RNA 3'-terminal phosphate cyclase from humans led to the identification of cDNAs and/or genes encoding cyclase-like proteins in diverse eukaryotes and also the bacterium E. coli and the archeon M. jannaschii. The protein encoded by the E. coli gene was overexpressed and shown to have RNA 3'-phosphate cyclase activity (41). In this work, we have studied the requirements and substrate specificity of the overexpressed E. coli cyclase. We have also established that the cyclase gene forms part of a so far uncharacterized operon, expression of which is controlled by sigma 54 and the transcriptional regulator RtcR.

The requirements and other enzymatic properties of the overexpressed E. coli cyclase are generally similar to the properties of the human protein, although some important differences are apparent. One of them is the ability of Mn2+ ions to replace Mg2+ in reactions catalyzed by the E. coli but not by the human cyclase. Both enzymes preferentially use ATP as a cofactor but are also able to utilize GTP and, much less efficiently, other ribonucleoside triphosphates. GTP is a relatively more efficient cofactor with the E. coli than with the human enzyme. Apparent Km values for ATP and GTP are, respectively, 20 and 100 µM for the E. coli protein and 6 and 200 µM for the human counterpart. Like the human protein (37-41), the E. coli enzyme undergoes adenylylation, and the adenylyl group can be released from the preformed cyclase-AMP complex protein upon incubation with the 3'-phosphorylated RNA but not the 3'-OH-terminated RNA. Covalent labeling of the bacterial cyclase with [alpha -32P]GTP and, much less efficiently, with [alpha -32P]CTP, [alpha -32P]UTP, and [alpha -32P]dATP was also observed. Although we have not directly validated the identity of nucleotidyl groups attached to the E. coli enzyme, previous demonstration that the human cyclase can undergo guanylylation, cytidylylation, and uridylylation (39) argues that the same is also true for the E. coli enzyme. Altogether, the results discussed above strongly suggest that the mechanism of 3'-phosphate cyclization by the E. coli enzyme is similar to that established for the human protein (Refs. 37-39; reviewed in Ref. 40). This conclusion is further supported by the observation that E. coli cyclase, like its human counterpart (37, 41), can inefficiently convert the 3'-terminal phosphate in the oligodeoxyribonucleotide AAAATAAAAGp into the product terminated with dN3'pp5'A.2

Substrate specificities of the bacterial and human enzymes seem to be similar. Both enzymes can use a variety of 3'-phosphorylated RNAs and oligoribonucleotides bearing either purine or pyrimidine 3'-terminal nucleotides (Refs. 11, 38, 40, and 41 and this work). It was demonstrated previously that nucleoside 3'-phosphates and nucleoside 5',3'-diphosphates do not act as substrates for the human cyclase (11, 38, 40). We have found that these compounds also do not act as substrates for the E. coli enzyme. Using the AMP release and competition assays (Fig. 3), we have compared the ability of oligoribonucleotides and oligodeoxyribonucleotides of identical sequence to act as substrates for the bacterial cyclase. As with the human protein (41), the oligodeoxyribonucleotides were found to be at least 300-fold poorer substrates than the oligoribonucleotides. Hence, RNA and not DNA molecules are the most likely physiological substrates for the bacterial enzyme.

The E. coli cyclase gene, rtcA, forms part of the previously uncharacterized operon containing two additional ORFs. The ORF positioned immediately upstream, named rtcB, encodes a protein of unknown function that, like the cyclase, is also highly conserved among Eucarya, Bacteria, and Archaea. Inspection of sequences of RtcB and related proteins from other organisms, as well as preliminary experiments aimed at identifying an enzymatic activity potentially associated with RtcB, did not provide any clue as to the function of the protein. Another ORF of the cyclase operon, named rtcR, is positioned upstream of the rtcA/rtcB unit and is transcribed in the opposite direction. It encodes a protein having features of sigma 54-dependent regulators (Fig. 5; reviewed in Refs. 58, 61, 64). By overexpressing the N-terminally truncated form of RtcR, we have demonstrated that this regulator controls expression of rtcA and rtcB in a sigma 54-dependent manner. Further evidence that sigma 54 is involved in expression of rtcA and rtcB is provided by the presence of the TTGCA and TGGCA elements centered 13 and 24 bp upstream of the rtcA/rtcB transcription start site established by primer extension (Figs. 4 and 7). Both the sequence and position relative to the transcription start site of these two elements conform with the consensus -12 and -24 boxes characteristic of all studied sigma 54-dependent promoters (53-55).

The observation that overexpression of the N-terminally truncated but not full-length RtcR induces transcription of rtcA and rtcB suggests that, as in the case of several previously characterized sigma 54-specific regulators (e.g. XylR, DmpR, DctD, and LevR (66-69)), the N-terminal domain represses activity of RtcR, and its deletion makes the regulator constitutively active. Physiologically, activation of most sigma 54-specific regulators is brought about either by phosphorylation or by binding of specific effector molecules to the sensory domain that, in the uninduced state, represses the ATPase activity of the protein required for isomerization of the promoter complex (reviewed in Refs. 55, 58-61, 64). RtcR is not a member of the two-component system family of regulators (63, 64), so its activation is unlikely to involve phosphorylation. A potential effector interacting with RtcR remains to be identified. With the exception of Myxococcus xantus in which rpoN null mutants are nonviable (70), in all bacteria studied to date, sigma 54 and consequently also genes or operons dependent on it were found not to be essential for growth. Products of genes controlled by sigma 54 factors have very diverse physiological functions. They are involved in specialized metabolic processes such as utilization of alternative carbon and energy sources or assimilation and fixation of nitrogen, in the production of extracellular structures such as flagellum and pilus, or in the synthesis of virulence determinants (54, 55, 59, 64, 71). In Caulobacter crescentus and M. xantus, some important cell differentiation decisions involve sigma 54 and/or sigma 54-specific transcription regulators (72-75). Identification of physiological conditions leading to activation of the rtcA operon in E. coli would greatly help in establishing a biological function of the RNA 3'-phosphate cyclase in bacteria.

The findings that two different eukaryotic RNA ligases (18-20) and also the RNA ligase identified in E. coli and some other bacteria (32, 33) all require 2',3'-cyclic phosphate termini suggested that cyclases may be involved in RNA ligation pathways by generating (or regenerating) cyclic phosphate ends (40, 41). The E. coli RNA ligase studied by Abelson and co-workers (32, 33) preferentially uses yeast tRNA half molecules as substrates in vitro and ligates them via an unusual 2'-5'-phosphodiester bond. Physiological substrates of this ligase and also enzymes responsible for generation of cyclic ends required for ligation remain unknown. Like rtcA, the gene encoding the RNA ligase in E. coli is not essential (33). In the archeon Desulfurococcus mobilis, the 23 S pre-rRNA contains an intron, and its cleavage by the endonuclease seems to generate splicing intermediates containing 3'-phosphomonoesters (76). It is not known whether the terminal phosphate has to undergo cyclization prior to the ligation step. In eukaryotes, the spliceosomal U6 snRNA and also a small fraction of some other low molecular weight RNAs have 2',3'-cyclic phosphate termini (34, 36); it is possible that a cyclase is involved in formation of these structures. No RNA molecules bearing cyclic phosphate ends have been as yet identified in prokaryotes. In certain E. coli strains, phage T4 induces cleavage of the host tRNALys by anticodon nuclease, which produces 2',3'-cyclic phosphate and 5'-OH ends. The damaged tRNALys is normally repaired by the action of two phage-encoded enzymes: polynucleotide kinase and RNA ligase (77, 78). Although previous experiments have already indicated that anticodon nuclease itself generates cyclic termini (77) and that T4 RNA ligase requires 3'-OH and not a cyclic phosphate for ligation (79), we have tested for a possible effect of cyclase gene disruption on T4 growth in the absence and presence of anticodon nuclease expressed from the cosmid. Both the parent and the cyclase mutant strains supported T4 growth and showed normal restriction of the ligase and kinase mutants of T4 in the presence of anticodon nuclease.3 Further experiments are required to establish the biological role of the RNA 3'-terminal phosphate cyclase in E. coli and other organisms.

    ACKNOWLEDGEMENTS

We gratefully acknowledge the gifts of plasmids and strains from Drs. M. Carmona-Perez, B. Magasanik, J. Offengand, S. Kushner, F. Blattner, and G. Plunkett. We also thank J. Hall for synthesis of AAAATAAAAG3'p and The Institute for Genomic Research and The Pseudomonas Genome Project for availability of sequence data prior to publication. We thank Drs. T. Bickle, J. Hofsteenge, and F. Nasr for critical reading of the manuscript and E. Billy for help with some experiments and preparation of figures.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by a fellowship from the European Community. Present address: Institut de Biologie Moléculaire des Plantes du CNRS, 12 rue du Général Zimmer, 67084 Strasbourg, France.

§ These authors contributed equally to this work.

To whom correspondence should be addressed: Maulbeerstrasse 66, 4058 Basel, Switzerland. Tel.: 41 61 697 4128 or 697 6993; Fax: 41 61 697 3976; E-mail: Filipowi{at}fmi.ch.

The abbreviations used are: PCR, polymerase chain reaction; N, any of the four (A, G, C, U) nucleosides; Np, nucleoside 3'-phosphates; pNp or pN3'p, nucleotide 5',3'-bisphosphatespN2'p, nucleoside 5',2'-bisphosphatesAMPCPP and AMPPCP, alpha ,beta - and beta ,gamma -methylene analogs of ATPAMPPNP, beta ,gamma -imido analog of ATPATPgamma S, adenosine 5'-O-(thiotriphosphate)adenosine>p, 2',3'-cyclic phosphateMES, 2-(N-morpholino)ethanesulfonic acidMOPS, 3-(N-morpholino)propanesulfonic acidORF, open reading frameRT, reverse transcriptionbp, base pair(s).

2 P. Genschik and W. Filipowicz, unpublished results.

3 C. Tyndall, T. Bickle, P. Genschik, and W. Filipowicz, unpublished results.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

  1. Blackburn, P., and Moore, S. (1982) in The Enzymes (Boyer, P., ed), Vol. XV, pp. 317-433, Academic Press, New York
  2. Takahashi, K., and Moore, S. (1982) in The Enzymes (Boyer, P., ed), Vol. XV, pp. 435-468, Academic Press, New York
  3. Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983) Cell 32, 525-536[CrossRef][Medline] [Order article via Infotrieve]
  4. Gandini-Attardi, D., Margarit, I., and Tocchini-Valentini, G. P. (1985) EMBO J. 4, 3289-3297[Medline] [Order article via Infotrieve]
  5. Thompson, L. D., and Daniels, C. J. (1988) J. Biol. Chem. 263, 17951-17959[Abstract/Free Full Text]
  6. Rauhut, R., Green, P. R., and Abelson, J. (1990) J. Biol. Chem. 265, 18180-18184[Abstract/Free Full Text]
  7. Sekiguchi, J., and Shuman, S. (1998) Mol. Cell. 1, 89-97
  8. Symons, R. H. (1992) Annu. Rev. Biochem. 61, 641-671[CrossRef][Medline] [Order article via Infotrieve]
  9. Konarska, M., Filipowicz, W., Domdey, H., and Gross, H. J. (1981) Nature 293, 112-116[CrossRef][Medline] [Order article via Infotrieve]
  10. Konarska, M., Filipowicz, W., and Gross, H. J. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 1474-1478[Abstract/Free Full Text]
  11. Filipowicz, W., Konarska, M., Gross, H. J., and Shatkin, A. J. (1983) Nucleic Acids Res. 11, 1405-1418[Abstract/Free Full Text]
  12. Filipowicz, W., and Shatkin, A. J. (1983) Cell 32, 547-557[CrossRef][Medline] [Order article via Infotrieve]
  13. Furneaux, H., Pick, L., and Hurwitz, J. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 3933-3937[Abstract/Free Full Text]
  14. Greer, C. L., Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983) Cell 32, 537-546[CrossRef][Medline] [Order article via Infotrieve]
  15. Schwartz, R. C., Greer, C. L., Gegenheimer, P., and Abelson, J. (1983) J. Biol. Chem. 258, 8374-8383[Abstract/Free Full Text]
  16. Perkins, K. K., Furneaux, H., and Hurwitz, J. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 684-688[Abstract/Free Full Text]
  17. Pick, L., Furneaux, H., and Hurwitz, J. (1986) J. Biol. Chem. 261, 6694-6704[Abstract/Free Full Text]
  18. Filipowicz, W., and Gross, H. J. (1984) Trends Biochem. Sci. 9, 68-71
  19. Westaway, S. K., and Abelson, J. (1995) in (Soell, D., and RajBhandary, U., eds) tRNA: Structure, Biosynthesis and Function. American Society for Microbiology, Washington, D. C., pp. 79-92
  20. Phizicky, E. M., and Greer, C. (1993) Trends Biochem. Sci. 18, 31-34[CrossRef][Medline] [Order article via Infotrieve]
  21. Gegenheimer, P., Gabius, H. J., Peebles, C. L., and Abelson, J. (1983) J. Biol. Chem. 258, 8365-8373[Abstract/Free Full Text]
  22. Laski, F. A., Fire, A. Z., RajBhandary, U. L., and Sharp, P. A. (1983) J. Biol. Chem. 258, 11974-11980[Abstract/Free Full Text]
  23. Phizicky, E. M., Schwartz, R. C., and Abelson, J. (1986) J. Biol. Chem. 261, 2978-2986[Abstract/Free Full Text]
  24. Phizicky, E. M., Consaul, S. A., Nehrke, K. W., and Abelson, J. (1992) J. Biol. Chem. 267, 4577-4582[Abstract/Free Full Text]
  25. Strange, N., and Beier, H. (1987) EMBO J. 6, 2811-2818[Medline] [Order article via Infotrieve]
  26. Zillmann, M., Gorovsky, M. A., and Phizicky, E. M. (1991) Mol. Cell. Biol. 11, 5410-5416[Abstract/Free Full Text]
  27. Sidrauski, C., Cox, J. S., and Walter, P. (1996) Cell 87, 405-413[CrossRef][Medline] [Order article via Infotrieve]
  28. Sidrauski, C., and Walter, P. (1997) Cell 90, 1-20[CrossRef][Medline] [Order article via Infotrieve]
  29. Branch, A. D., Robertson, H. D., Greer, C., Gegenheimer, P., Peebles, C., and Abelson, J. (1982) Science 217, 1147-1149[Abstract/Free Full Text]
  30. Kikuchi, Y., Tyc, K., Filipowicz, W., Sanger, H. L., and Gross, H. J. (1982) Nucleic Acids Res. 10, 7521-7529[Abstract/Free Full Text]
  31. Kiberstis, P. A., Haseloff, J., and Zimmern, D. (1985) EMBO J. 4, 817-827[Medline] [Order article via Infotrieve]
  32. Greer, C. L., Javor, B., and Abelson, J. (1983) Cell 33, 899-906[CrossRef][Medline] [Order article via Infotrieve]
  33. Arn, E. A., and Abelson, J. N. (1996) J. Biol. Chem. 271, 31145-31153[Abstract/Free Full Text]
  34. Lund, E., and Dahlberg, J. E. (1992) Science 255, 327-330[Abstract/Free Full Text]
  35. Tazi, J., Forne, T., Jeanteur, P., Cathala, G., and Brunel, C. (1993) Mol. Cell. Biol. 13, 1641-1650[Abstract/Free Full Text]
  36. Gu, J., Shumyatsky, G., Makan, N., and Reddy, R. (1997) J. Biol. Chem. 272, 21989-21993[Abstract/Free Full Text]
  37. Filipowicz, W., Strugala, K., Konarska, M., and Shatkin, A. J. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 1316-1320[Abstract/Free Full Text]
  38. Reinberg, D., Arenas, J., and Hurwitz, J. (1985) J. Biol. Chem. 260, 6088-6097[Abstract/Free Full Text]
  39. Vicente, O., and Filipowicz, W. (1988) Eur. J. Biochem. 176, 431-439[Medline] [Order article via Infotrieve]
  40. Filipowicz, W., and Vicente, O. (1990) Methods Enzymol. 181, 499-510[Medline] [Order article via Infotrieve]
  41. Genschik, P., Billy, E., Swianiewicz, M., and Filipowicz, W. (1997) EMBO J. 16, 2955-2967[CrossRef][Medline] [Order article via Infotrieve]
  42. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  43. Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1990) Current Protocols in Molecular Biology, Greene Publishing, New York
  44. Reitzer, L. J., and Magasanik, B. (1986) Cell 45, 785-792[CrossRef][Medline] [Order article via Infotrieve]
  45. Hunt, T. P., and Magasanik, B. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8453-8457[Abstract/Free Full Text]
  46. Hamilton, C. M., Aldea, M., Washburn, B. K., Babitzke, P., and Kushner, S. R. (1989) J. Bacteriol. 171, 4617-4622[Abstract/Free Full Text]
  47. Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T. (1987) Gene (Amst.) 61, 63-74[CrossRef][Medline] [Order article via Infotrieve]
  48. Ellis, K. J., and Morrison, J. F. (1982) Methods Enzymol. 87, 405-426[Medline] [Order article via Infotrieve]
  49. Cases, I., de Lorenzo, V., and Perez-Martin, J. (1996) Mol. Microbiol. 19, 7-17[CrossRef][Medline] [Order article via Infotrieve]
  50. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680[Abstract/Free Full Text]
  51. Felsenstein, J. (1989) Cladistics 5, 164-166
  52. Dodd, I. B., and Egan, J. B. (1990) Nucleic Acids Res. 18, 5019-5026[Abstract/Free Full Text]
  53. Morett, E., and Buck, M. (1989) J. Mol. Biol. 210, 65-77[CrossRef][Medline] [Order article via Infotrieve]
  54. Thöny, B., and Hennecke, H. (1989) FEMS Microbiol. Rev. 63, 341-358
  55. Merrick, M. J. (1993) Mol. Microbiol. 10, 903-909[Medline] [Order article via Infotrieve]
  56. Hoover, T.-R., Santero, E., Porter, S., and Kustu, S. (1990) Cell 63, 11-22[CrossRef][Medline] [Order article via Infotrieve]
  57. Collado-Vides, J., Magasanik, B., and Gralla, J. D. (1991) Microbiol. Rev. 55, 371-394[Abstract/Free Full Text]
  58. Gralla, J. D., and Collado-Vides, J. (1996) in Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology (Neidhardt, F. C., ed), Vol. 1, pp. 1232-1245, American Society of Microbiology, Washington, D. C.
  59. Magasanik, B. (1996) in Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology (Neidhardt, F. C., ed), Vol. 1, pp. 1344-1356, American Society of Microbiology, Washington, D. C.
  60. Kustu, S., North, A. K., and Weiss, D. S. (1991) Trends Biochem. Sci. 16, 397-402[CrossRef][Medline] [Order article via Infotrieve]
  61. Morett, E., and Segovia, L. (1993) J. Bacteriol. 175, 6067-6074[Free Full Text]
  62. North, A. K., Klose, K. E., Stedman, K. M., and Kustu, S. (1993) J. Bacteriol. 175, 4267-4273[Free Full Text]
  63. Alex, L. A., and Simon, M. I. (1994) Trends Genet. 10, 133-138[CrossRef][Medline] [Order article via Infotrieve]
  64. Shingler, V. (1996) Mol. Microbiol. 19, 409-416[CrossRef][Medline] [Order article via Infotrieve]
  65. Wintjens, R., and Rooman, M. (1996) J. Mol. Biol. 262, 294-313[CrossRef][Medline] [Order article via Infotrieve]
  66. Lee, J. L., Scholl, D., Nixon, B. T., and Hoover, T. (1994) J. Biol. Chem. 269, 20401-20409[Abstract/Free Full Text]
  67. Martin-Verstraete, I., Débarbouille, M., Klier, A., and Rapoport, G. (1994) J. Mol. Biol. 241, 178-192[CrossRef][Medline] [Order article via Infotrieve]
  68. Fernández, S., de Lorenzo, V., and Pérez-Martin, J. (1995) Mol. Microbiol. 16, 205-213[CrossRef][Medline] [Order article via Infotrieve]
  69. Shingler, V., and Pavel, H. (1995) Mol. Microbiol. 17, 505-513[CrossRef][Medline] [Order article via Infotrieve]
  70. Keseler, I. M., and Kaiser, D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1979-1984[Abstract/Free Full Text]
  71. Kustu, S., Santero, E., Keener, J., Popham, D., and Weiss, D. (1989) Microbiol. Rev. 53, 367-376[Free Full Text]
  72. Brun, Y. V., and Shapiro, L. (1992) Genes Dev. 6, 2395-2408[Abstract/Free Full Text]
  73. Wingrove, J. A., and Gober, J. W. (1994) Genes Dev. 8, 1839-1852[Abstract/Free Full Text]
  74. Gulati, P., Xu, D., and Kaplan, H. B. (1995) J. Bacteriol. 177, 4645-4651[Abstract/Free Full Text]
  75. Keseler, I. M., and Kaiser, D. (1995) J. Bacteriol. 177, 4638-4644[Abstract/Free Full Text]
  76. Kjems, J., and Garrett, R. A. (1988) Cell 54, 693-703[CrossRef][Medline] [Order article via Infotrieve]
  77. Amitsur, M., Levitz, R., and Kaufmann, G. (1987) EMBO J. 6, 2499-2503[Medline] [Order article via Infotrieve]
  78. Snyder, L. (1995) Mol. Microbiol. 15, 415-420[CrossRef][Medline] [Order article via Infotrieve]
  79. Uhlenbeck, O. C. (1983) Trends Biochem. Sci. 8, 94-96[CrossRef]
  80. Friedman, D. I. (1988) Cell 55, 545-554[CrossRef][Medline] [Order article via Infotrieve]
  81. Goodrich, J. A., Schwartz, M. L., and McClure, W. R. (1990) Nucleic Acids Res. 18, 4993-5000[Abstract/Free Full Text]

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
M. Y. Galperin and E. V. Koonin
'Conserved hypothetical' proteins: prioritization of targets for experimental study
Nucleic Acids Res., October 12, 2004; 32(18): 5452 - 5463.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
A. P. GMYL, S. A. KORSHENKO, E. V. BELOUSOV, E. V. KHITRINA, and V. I. AGOL
Nonreplicative homologous RNA recombination: Promiscuous joining of RNA pieces?
RNA, October 1, 2003; 9(10): 1221 - 1231.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
J. Jyot, N. Dasgupta, and R. Ramphal
FleQ, the Major Flagellar Gene Regulator in Pseudomonas aeruginosa, Binds to Enhancer Sites Located Either Upstream or Atypically Downstream of the RpoN Binding Site
J. Bacteriol., October 1, 2002; 184(19): 5251 - 5260.
[Abstract] [Full Text] [PDF]

Home page
 Microbiol. Mol. Biol. Rev.Home page
L. Reitzer and B. L. Schneider
Metabolic Context and Possible Physiological Themes of {sigma}54-Dependent Genes in Escherichia coli
Microbiol. Mol. Biol. Rev., September 1, 2001; 65(3): 422 - 444.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
V. Drewett, H. Molina, A. Millar, S. Muller, F. v. Hesler, and P. E. Shaw
DNA-bound transcription factor complexes analysed by mass-spectrometry: binding of novel proteins to the human c-fos SRE and related sequences
Nucleic Acids Res., January 15, 2001; 29(2): 479 - 487.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
M. Buck, M.-T. Gallegos, D. J. Studholme, Y. Guo, and J. D. Gralla
The Bacterial Enhancer-Dependent sigma 54 (sigma N) Transcription Factor
J. Bacteriol., August 1, 2000; 182(15): 4129 - 4136.
[Full Text]

Home page
 J. Bacteriol.Home page
D. J. Studholme, S. R. Wigneshwereraraj, M.-T. Gallegos, and M. Buck
Functionality of Purified sigma N (sigma 54) and a NifA-Like Protein from the Hyperthermophile Aquifex aeolicus
J. Bacteriol., March 15, 2000; 182(6): 1616 - 1623.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
E. Billy, D. Hess, J. Hofsteenge, and W. Filipowicz
Characterization of the Adenylation Site in the RNA 3'-Terminal Phosphate Cyclase from Escherichia coli
J. Biol. Chem., December 3, 1999; 274(49): 34955 - 34960.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Genschik, P.
Right arrow Articles by Filipowicz, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Genschik, P.
Right arrow Articles by Filipowicz, W.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement