INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

The ubiquitin/26 S proteasome pathway is a major route for the selective degradation of eukaryotic proteins. Through the removal of key regulatory components, the pathway helps control many aspects of cell homeostasis, growth, and development (1-4). Examples include cell cycle progression, maintenance of chromatin structure, DNA repair, enzymatic regulation, transcription, signal transduction, and programmed cell death. In addition, the ubiquitin pathway participates in cellular housekeeping and the stress response by removing abnormal and denatured proteins.

In the ubiquitin pathway, proteins are first enzymatically tagged for breakdown by the covalent attachment of one or more chains of ubiquitin monomers. This process is catalyzed by an enzymatic cascade, involving ubiquitin-activating enzymes (E1s),¹ ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s), that couples ATP hydrolysis to ubiquitin ligation (1-3). Attachment is via an isopeptide bond between the C-terminal glycine of ubiquitin and free lysines either in the target or in the preceding ubiquitin in the chain. Within the multiubiquitin chain, Lys⁴⁸ appears to be the preferred intermolecular linkage site (5, 6) but genetic evidence has implicated several other lysines as well (e.g. Lys²⁹ and Lys⁶³) (7-9). Once assembled, the multiubiquitin chain functions as a recognition signal for degradation of the substrate by the 26 S proteasome, a multisubunit complex specific for multiubiquitinated proteins (10). The tagged proteins are broken down into short peptides, while the ubiquitin moieties are released intact for reuse.

Specificity within the ubiquitin pathway is achieved by at least three mechanisms. The most important determines which proteins should be ubiquitinated by the E1/E2/E3 cascade of reactions. Here, substrate specificity is primarily regulated by a large family of E2 and E3 isozymes working alone or in combination to recognize key degradation signals within the targets (1-3, 11). The second regulatory mechanism involves control of the steady-state level of ubiquitin-protein conjugates prior to breakdown. Conjugate levels are affected not only by the rate of ubiquitination but also by the rate of deubiquitination; a reaction catalyzed by a diverse family of ubiquitin-specific proteases that cleaves the junction between ubiquitin and the protein moiety (2). Through such deubiquitination, proteins can be rescued from degradation (e.g. see Refs. 12-14).

The third mechanism to achieve specificity is the association and breakdown of ubiquitin-protein conjugates by the 26 S proteasome. The 26 S proteasome is composed of two subcomplexes, designated the 19 S regulatory complex and the 20 S proteasome (4, 10, 15, 16). The 20 S proteasome contains the catalytic core of the protease; it exists as a hollow cylinder, created by the assembly of four stacked polypeptide rings, and confines the protease active sites within the lumen (17, 18). The 19 S regulatory complex binds to one or both ends of the 20 S particle. It contains ~15 subunits and confers both ATP and ubiquitin dependence to the holoenzyme complex. The function(s) of most of these subunits are unknown; six belong to the AAA family of ATPases (19, 20). Presumably, the 19 S complex recognizes appropriate targets through the multiubiquitin chain, unfolds the target moiety, and directs the unfolded polypeptide into the lumen of the 20 S complex for breakdown (4, 10). During or after this process, the multiubiquitin chain is disassembled by ubiquitin-specific proteases.

Recognition of ubiquitinated substrates by the 26 S proteasome is proposed to be mediated by one or a few common multiubiquitin chain receptors located in the 19 S particle. We recently identified a candidate for one such receptor from diverse species, designated here as Mcb1 for Multiubiquitin chain-binding protein, based on its ability to bind Lys⁴⁸-linked multiubiquitin chains and its presence in the 26 S proteasome (21, 22). (Additional names include Mbp1 (21), ASF-1 and S5a (23, 24), Sun1 (25), and p54 (26) for the Arabidopsis, human, yeast (Saccharomyces cerevesiae), and Drosophila homologs, respectively.) Most of these Mcb1 polypeptides range from 376 to 414 amino acids long, the exception being yeast Mcb1 (268 amino acids), which is missing a portion of the C-terminal end present in the other Mcb1 proteins (21, 22). Consistent with a role in ubiquitin conjugate recognition, Mcb1 proteins preferentially associate with multiubiquitin chains versus the ubiquitin monomer in vitro, especially those chains containing three or more ubiquitins (21, 22, 27, 28).

Genetic studies in yeast revealed that Mcb1 may not be the only ubiquitin receptor. This is based on the observations that yeast Mcb1 knockout strains display a mild phenotype. Unlike mutants in other essential ubiquitin components (2, 4), mcb1 strains are viable, have near-wild-type growth rates, degrade the bulk of short-lived proteins (including an N-terminal end rule substrate) normally, and are not sensitive to UV radiation or heat stress (22, 25). However, they are more sensitive to amino acid analogs and cold than wild-type yeast (22).² In addition, mcb1 mutants cannot degrade ubiquitin-proline--galactosidase (Ub-Pro--gal), an artificial substrate that is degraded by a subpathway in the ubiquitin system (ubiquitin fusion degradation (UFD) pathway) (9). Taken together, the results suggest that Mcb1 proteins are involved in the recognition and degradation of only a subset of ubiquitin/26 S proteasome substrates.

To further define the role of Mcb1 in conjugate recognition and to identify the site(s) of multiubiquitin chain binding, we analyzed here a series of deletion and amino acid substitution mutants of yeast and Arabidopsis Mcb1. A stretch of highly conserved hydrophobic residues was found to be critical for recognizing Lys⁴⁸-linked multiubiquitin chains in vitro. However, when the various Mcb1 derivatives were tested for their ability to complement yeast mcb1, the multiubiquitin chain recognition motif was found not to be required for conferring resistance to amino acid analogs or for restoring degradation of Ub-Pro--gal. Instead, a conserved region near the N terminus was essential for these functions. These data show that a domain near the N terminus, and not the multiubiquitin chain-binding site, is most critical for Mcb1 function in vivo.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

Yeast Strains and Media-- Yeast mcb1 strain (SV1-MCB1; haploid MATa) was constructed previously using strain DF5 (MATa/MAT lys2-801/lys2-801 leu2-3, 112/leu2-3, 112 ura3-52/ura3-52 his3-200/his3200 trp1-1/trp1-1) (22). The congenic MATa wild-type yeast strain (SV1) used throughout was derived from tetrad dissection during construction of mcb1 yeast strain. Synthetic medium consisted of 0.7% yeast nitrogen base (Difco) supplemented with uracil, adenine, 2% glucose, and amino acids as described previously (29). Tryptophan was omitted from the synthetic medium for selection. Arginine and phenylalanine were omitted from the selection medium supplemented with canavanine and p-fluorophenylalanine, and methionine was omitted from the synthetic medium used for pulse-labeling experiments. Yeast transformation was carried out as described by Gietz et al. (30), and cultures were grown at 30 °C.

Construction of the Yeast and Arabidopsis Mcb1 Mutants-- Constructions encoding the yeast and Arabidopsis Mcb1 derivatives (see Fig. 2) were made in the Escherichia coli expression vector pET28a (Novagen, Madison, WI) by PCR strategies. The derived genes were verified as correct by DNA sequence analysis. The 5-amplification oligonucleotides were designed to add an NdeI site at the native start codon or, for N-terminal-deleted constructions, at the deletion point to create a new start codon. For the C-terminal-deleted constructions, the 3-amplification oligonucleotides were designed to add an internal stop codon. Introduced restriction sites and stop codons in the various oligonucleotides listed below are underlined and italicized, respectively. Positions of new start and stop codons for the terminal-deleted constructions are indicated in Fig. 2. The PCR products were cloned either directly or through intermediate vectors into pET28a using the NdeI site at the 5 ends and a 3 site which was created by the design of the 3-amplification oligonucleotide (EcoRI, underlined) or derived from intermediate cloning vectors (EcoRI, HindIII, SalI, or NdeI).

In Vitro Multiubiquitin Chain Binding Activity Assay-- All yeast and Arabidopsis Mcb1 proteins were expressed in E. coli strain BL21 (DE3) as His₆-tagged versions using pET28a. The His₆ tag, containing the amino acid sequence MGSSHHHHHHSSGLVPRGSH, was encoded by a nucleotide sequence 5 to the NdeI site in the pET28a vector. Induction of protein expression and preparation of bacterial lysates were performed according to manufacturer's protocols (Novagen). Total protein from cell lysates was fractionated by SDS-polyacrylamide gel electrophoresis (PAGE) and electroblotted onto nitrocellulose membranes (Millipore, Bedford, MA). The membranes were washed for 5 min in Tris-buffered saline (TBS; 20 mM Tris·HCl (pH 7.5, 25 °C), 0.5 M NaCl), blocked for 2 h in TBS containing 10 mg/ml of bovine serum albumin and washed for 5 min in TBS. The membranes were incubated for 1-2 h at room temperature in TBS containing 10 mg/ml bovine serum albumin and 3.5 × 10⁵ cpm/ml of Lys⁴⁸-linked multiubiquitin chains labeled with ¹²⁵I. The membranes were then washed in TBS for 1-2 h and subjected to autoradiography. The Lys⁴⁸-linked multiubiquitin chains were prepared with ZmUbc7 enzyme and were radiolabeled with carrier-free Na¹²⁵I (Amersham Corp.) using IODO-BEAD (Pierce) as described previously (6).

Amino Acid Analog Sensitivity Assays-- The various MCB1 derivatives were moved from pET28a vector into a high copy 2µ yeast shuttle vector pRS424 (32) and expressed without the His₆ tag under the direction of the yeast ScMCB1 promoter. pRS424 was first modified to include the ScMCB1 promoter immediately followed by NdeI and EcoRI sites. The ScMCB1 promoter, containing 552 bp upstream of the start codon, was isolated from genomic DNA by PCR using oligonucleotides TGCATCATTGCGAATACCGAG and CTGTAGCTTCCAATACCATATGGCGGTTACTGC. With the exception of the gene encoding Arabidopsis C2, the various MCB1 derivatives were moved from pET28a into the modified pRS424 using the 5 NdeI site and a 3 EcoRI site. Arabidopsis C2 construction was moved using the 5 NdeI site and a 3 SalI (filled in) into the modified pRS424 digested with NdeI and EcoRI (filled in).

Immunological Techniques-- Yeast cultures were grown in liquid selection medium to late logarithmic phase. Cells were collected by centrifugation and lysed by vortexing with glass beads in 50 mM Tris-HCl (pH 8.0; 4 °C), 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 14 mM -mercaptoethanol, 2 mM Na₄EDTA), with the addition of 0.5 mM phenylmethylsulfonyl fluoride and 100 nM pepstatin A just before use. Proteins were resolved by SDS-PAGE and electroblotted onto polyvinylidene difluoride membranes (Immobilon-P; Millipore). Immunoblot analyses were performed with rabbit antisera against Arabidopsis or yeast Mcb1 (21, 22) in conjunction with alkaline phosphatase-labeled goat anti-rabbit immunoglobulins (Kirkegaard & Perry Laboratories, Gaithersburg, MD) and the substrates nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate.

Degradation Assays-- The plasmid directing the expression of Ub-Pro--gal was that described by Bachmair et al. (33). Turnover of Ub-Pro--gal was measured as described previously (22). Cells were grown to exponential phase at 30 °C in synthetic medium containing 2% raffinose, 2% galactose, and amino acids, and pulsed-labeled for 5 min with [³⁵S]methionine. The chase was performed in freshly prepared synthetic medium containing 2% raffinose, 2% galactose, amino acids, 1 mg/ml nonlabeled methionine, and 0.5 mg/ml cycloheximide. Ub-Pro--gal was immunoprecipitated with anti--galactosidase antibodies (Promega) and subjected to SDS-PAGE. Radioactivity present in Ub-Pro--gal was quantitated by PhosphorImager analysis.

Purification of the Yeast 26 S Proteasome-- The 26 S proteasome was partially purified from wild-type and mcb1 yeast strains by conventional chromatography as described previously (34). The peak of hydrolytic activity (as measured using the substrate Suc-LLVY) from the DEAE-Affi-Gel blue column (Bio-Rad) was loaded onto a MonoQ column (Pharmacia Biotech Inc.). Protein was eluted using a linear gradient from 200 mM to 450 mM NaCl. Fractions were collected and assayed for peptidase activity and the presence of Mcb1 and Sug1/Cim3 (34). The peak of peptidase activity eluted at around 350 mM NaCl.

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Mutational Analysis of Yeast and Arabidopsis Mcb1-- To identify domains in Mcb1 necessary for multiubiquitin chain recognition, association with the 26 S proteasome, and in vivo functions, a parallel structure/function analysis of yeast and Arabidopsis Mcb1 was initiated by constructing various deletion and amino acid substitution mutants. Amino acid sequence comparisons of Mcb1 homologs from Arabidopsis (21), Drosophila (26), humans (24), and moss³ revealed four highly conserved regions that may function in these capacities (designated domains I-IV, Fig. 1, A and B). Whereas the Drosophila, human, and moss sequences average 47% identity to Arabidopsis Mcb1 over their entire length, the four conserved domains average 72% identity. Yeast Mcb1 also contains the first three conserved domains but is lacking the C-terminal region that includes domain IV (22). Among all five proteins, domain III exhibits the greatest conservation (82% identity). It contains a short stretch of conserved hydrophobic residues (LAL/MALRL/V) surrounded by charged amino acids and is preceded by an invariant sequence GVDP (Fig. 1C). Beal et al. (36) previously proposed, from binding studies of mutant multiubiquitin chains with the 26 S proteasome, that repeated hydrophobic patches formed within assembled multiubiquitin chains are important for binding to the complex. Based on their data, we have suggested that this conserved hydrophobic patch within Mcb1 could participate in this association (21). Moreover, because Arabidopsis Mcb1 also contains a second LALAL patch near the C terminus of the protein (residues 310-314), it was possible that multiubiquitin chain binding was strengthened by the cooperative action of these motifs.

View larger version (24K): [in this window] [in a new window]   Fig. 1.   Amino acid sequence comparisons of the multiubiquitin chain-binding protein Mcb1 from various species. Mcb1 amino acid sequences were from the following sources: Arabidopsis (21), human (24), Drosophila (26), yeast (22), and moss (Physcomitrella patens) (H. Fu, P. Girod, and R. D. Vierstra, unpublished results). A, dot blot analysis comparing the amino acid sequence similarity of Arabidopsis and human Mcb1. The plot was generated from the UW-GCG programs COMPARE and DOTPLOT based on a window of 55 and a stringency of 55. From pairwise comparisons of all five Mcb1 proteins, four conserved domains were identified and designated I-IV. B, percent amino acid sequence identities of domains I-IV in Drosophila, human, moss, and yeast Mcb1s as compared with Arabidopsis Mcb1. C, amino acid sequence alignment of domain III. The comparison was generated with the computer program BoxShade 2.7; identical and similar residues are shaded with black and gray boxes, respectively. The consensus sequence denotes hydrophobic residues by a dash (-), charges residues by , and prolines by P. Arrows indicate the hydrophobic residues which were identified as necessary for the binding of multiubiquitin chains in vitro (see Fig. 3). In B and C, coordinates refer to the amino acid sequence positions of Arabidopsis Mcb1.

View larger version (32K): [in this window] [in a new window]   Fig. 2.   Schematic diagrams of yeast and Arabidopsis Mcb1 mutants. Various yeast (ScMcb1) and Arabidopsis (AtMcb1) Mcb1 derivatives were constructed using PCR strategies (see "Experimental Procedures"). Names of various mutants are designated to the left. The numbering indicates the position of the initiator methionine, the position of the C-terminal residue, or the site of amino acid substitutions. Gray boxes identify the conserved regions (domains I-IV) defined in Fig. 1. The black boxes show the hydrophobic patch, the sequences of which are described above the boxes. The hatched boxes indicate the second LALAL box in AtMcb1. Amino acid sequence alterations in the hydrophobic patch are shown above the box in the corresponding mutants. The ability of various Mcb1 derivatives to bind multiubiquitin chains (see Fig. 3), to confer amino acid analog resistance to the yeast mcb1 mutant (see Fig. 5), and to degrade Ub-Pro--gal (see Fig. 8) are summarized to the right. Assay for Ub-Pro--gal degradation was performed only with the yeast Mcb1 proteins. ND, not determined.

The Conserved Hydrophobic Sequence in Mcb1 Is Critical for Binding Multiubiquitin Chains-- Evaluating the chain binding activity of the various yeast and Arabidopsis Mcb1 derivatives was facilitated by the discovery that each derivative accumulated to high levels in a soluble form when expressed in E. coli (Fig. 3A). Similar to the parental molecules (21, 22), the apparent molecular mass (as measured by SDS-PAGE) of the various deletions was substantially greater than their presumed mass. This discrepancy was especially strong for the N-terminal deletions, suggesting that the C-terminal portion has an unusual structure in the presence of SDS. The site-directed mutants that replaced all five of the LAL/MAL residues in domain III with either aspartic acid or asparagine (D5/G, N5/G, D5, and N5) (see Fig. 3) also migrated noticeably slower than the parental polypeptides.

View larger version (63K): [in this window] [in a new window]   Fig. 3.   In vitro multiubiquitin chain binding activity of various Mcb1 mutants. A, expression of various yeast (ScMcb1) and Arabidopsis (AtMcb1) Mcb1 derivatives in E. coli. Total proteins from cell lysates of E. coli BL21 (DE3) strains expressing various Mcb1 mutants were subjected to SDS-PAGE and stained with Coomassie Brilliant Blue. Descriptions of various mutants are shown in Fig. 2. Protein loads were adjusted to provide near equal amounts of the various Mcb1 derivatives as determined by protein staining. pET28 represents an extract of E. coli harboring an unmodified pET28a plasmid. B, in vitro multiubiquitin chain binding activity of the various Mcb1 derivatives. Duplicate samples as in panel A were electroblotted onto nitrocellulose membranes, probed with heterogeneous mix of Lys48-linked multiubiquitin chains labeled with 125I, and subjected to autoradiography. For yeast N3 and Arabidopsis N3, N4, I1, I2, and I3, less transfer current and time were used to ensure similar transfer onto the membranes as compared with the other mutants. Transfer efficiency was monitored by protein staining of duplicate membranes (data not shown).

View larger version (46K): [in this window] [in a new window]   Fig. 4.   Profile of Lys48-linked multiubiquitin chains bound to yeast Mcb1 and deletions N2 and N3. Yeast Mcb1 (ScMcb1), N2, and N3 (see Fig. 2) were expressed in E. coli, subjected to SDS-PAGE, and transferred onto nitrocellulose membranes. The membranes were incubated with a mixture of monomeric ubiquitin and Lys48-linked multiubiquitin chains labeled with 125I (Ub1-Ubn). Regions of the membrane containing the Mcb1 proteins were excised, and the bound radioactivity was eluted by boiling in SDS-PAGE sample buffer. The eluted material was then subjected to SDS-PAGE and autoradiography. Radioactivity eluted from an equal amount of nitrocellulose membrane was subjected to SDS-PAGE for each mutant. Background denotes the profile of chains eluted from an equivalent amount of nitrocellulose membrane not containing Mcb1 protein. The left lane shows the profile of the 125I-labeled multiubiquitin chains (Ub chains) used in the assay.

The N-terminal Region of Mcb1 Is Required for Amino Acid Analog Resistance-- Although MCB1 is not essential in yeast, deletion of this gene results in several phenotypes (22). The most notable is an enhanced growth sensitivity to amino acid analogs, presumably due to the accumulation of abnormal proteins that are normally removed by the ubiquitin pathway (38). To identify region(s) of Mcb1 required for this function, we expressed a number of the yeast and Arabidopsis Mcb1 derivatives (see Fig. 2) in the yeast mcb1 strain and examined their ability to complement the growth defect on analog-containing medium.

View larger version (47K): [in this window] [in a new window]   Fig. 5.   Ability of various Mcb1 derivatives to complement the growth sensitivity of the yeast mcb1 mutant to amino acid analogs. A, expression of various yeast (ScMcb1) and Arabidopsis (AtMcb1) Mcb1 derivatives in yeast. Crude extracts (15 µg) from wild-type (WT) yeast, the mcb1 strain, or the mcb1 strain expressing various Mcb1 derivatives (see Fig. 2) were subjected to SDS-PAGE and immunoblotted with an Arabidopsis Mcb1 antiserum. The migration positions of the various Mcb1 proteins are indicated by asterisks. B, colonies formed by wild-type yeast and the various mcb1 strains on medium containing the amino acid analogs, canavanine, and p-fluorophenylalanine (1.5 and 25 µg/ml, respectively). Cultures were grown in analog-free medium, resuspended in analog-containing medium to an A600 = 1.0, and then spotted in 10-fold serial dilutions (left to right) onto solidified medium supplemented with the analogs. Colony growth was observed after 6 days.

View larger version (34K): [in this window] [in a new window]   Fig. 6.   Amino acid analog sensitivity of yeast mcb1 expressing various Mcb1 derivatives as measured by cell survival. Wild-type yeast, the mcb1 strain, or the mcb1 strain carrying various yeast (ScMcb1) and Arabidopsis (AtMcb1) Mcb1 derivatives (see Fig. 2) were grown in analog-free liquid medium, washed, and plated onto solidified medium with or without the amino acid analogs, canavanine and p-fluorophenylalanine (1.5 and 25 µg/ml, respectively). After a 14-day incubation, cell survival rate was calculated by dividing the number of colonies formed on medium containing analogs by the number of colonies formed on medium without the analogs. A, percent cell survival rates of yeast mcb1 strains carrying the various Mcb1 derivatives. B, expanded version of panel A focusing on the increased analog sensitivity of the mcb1 strains expressing various N-terminal deletion mutants of Mcb1. Mutants N1/G combined the N1 deletion with the yeast Leu232 or Arabidopsis Val234 to Gly substitution (see Fig. 2). Error bars indicate the S.D.

View larger version (33K): [in this window] [in a new window]   Fig. 7.   N1 does not increase amino acid analog sensitivity of wild-type yeast. Yeast Mcb1 (ScMcb1) or the N-terminal deletion N1 were expressed in wild-type (WT) yeast from the high copy 2µ vector. A, expression of the ScMcb1 and N1 proteins in yeast. Crude extracts (15 µg) from the mcb1 strain, wild-type yeast, and wild-type yeast ectopically expressing ScMcb1 or N1 proteins were subjected to SDS-PAGE and immunoblotted with an Arabidopsis Mcb1 antiserum. The migration positions of the ScMcb1 and N1 proteins are indicated by arrows. B, colonies formed by the various yeast strains when plated on medium containing the amino acid analogs, canavanine and p-fluorophenylalanine (1.5 and 25 µg/ml, respectively). Cultures were grown initially in analog-free medium, resuspended in analog-containing medium to an A600 = 1.0, and then spotted in 10-fold serial dilutions (left to right) onto solidified medium supplemented with the analogs. Colony growth was observed after 6 days.

N-terminal Domain Is Required for Degradation of Ub-Pro--Gal-- Prior phenotypic analysis of mcb1 (22) showed that ScMcb1 is essential for the breakdown of Ub-Pro--gal, a synthetic ubiquitin fusion degraded by the ubiquitin pathway. Unlike ubiquitin fusion substrates bearing other amino acids besides proline at the junction, the ubiquitin moiety in Ub-Pro--gal is not cleaved following synthesis (33). This ubiquitin then serves as an acceptor site for further ubiquitination by the UFD subpathway involving the E2/E3 pair encoded by UBC4/5 and UFD4 (9). To identify the domains within Mcb1 required for this breakdown, the stability of Ub-Pro--gal was examined by pulse-labeling in mcb1 strains expressing various yeast Mcb1 derivatives. Whereas Ub-Pro--gal was extremely stable in the mcb1 strain, it was rapidly degraded when the ScMCB1 gene was reintroduced (t_1/2 ~ 12 min (Fig. 8)]. This instability was similar to that obtained with wild-type yeast and was independent of whether a high copy 2µ (pRS424) or a low copy CEN plasmid (pRS314) was used for expression (data not shown and Fig. 8). Each of the modifications tested that deleted or altered the hydrophobic patch in domain III (C1, N5, and G) also restored rapid degradation of Ub-Pro--gal to a rate nearly equivalent to that seen with ScMcb1 (Fig. 8). In contrast, Ub-Pro--gal remained stable in strains expressing N1. These results were consistent with those obtained with the amino acid analog sensitivity assays, suggesting that the N-terminal region containing domain I is required for both functions.

View larger version (24K): [in this window] [in a new window]   Fig. 8.   Degradation of Ub-Pro--gal in yeast mcb1 strains containing various ScMcb1 derivatives. Various ScMcb1 derivatives were introduced into a mcb1 yeast strain expressing the Ub-Pro--gal reporter protein. Descriptions of the various Mcb1 mutants are shown in Fig. 2. The metabolic stability of the reporter protein was determined by pulse-chase analysis as described previously (22). Ub-Pro--gal was immunoprecipitated from cell lysates and subjected to SDS-PAGE. The level of Ub-Pro--gal was quantitated by PhosphorImager analysis and expressed as a percentage of that present at t = 0. In the data shown here, ScMcb1 and mutant derivatives were expressed from a high copy 2µ vector (pRS424) (31). For ScMcb1 and the site-directed mutant N5, similar results were obtained (data not shown) with a low copy CEN vector (pRS314) (43).

Assembly of Mutant Mcb1 Proteins into the 26 S Proteasome-- One possible way to block Mcb1 function is to interfere with its association with the 26 S proteasome. To test for such an assembly defect, we isolated the 26 S proteasome from mcb1 strains expressing various yeast Mcb1 derivatives and assayed for the presence of the mutant proteins. The 26 S proteasome was partially purified by DEAE-Affi-Gel blue chromatography and then analyzed by nondenaturing PAGE. Migration positions of the 26 S proteasome in the polyacrylamide gels were determined by a peptidase overlay assay using the fluorogenic 20 S proteasome substrate Suc-LLVY-AMC (35). As shown in Fig. 9A, the yeast 26 S proteasome migrates as two species (26S_a and 26S_b) on nondenaturing PAGE, corresponding to 20 S catalytic core particles capped by two or one regulatory particles (35).⁴ The mobility and peptidase activity of both species were similar in wild-type and mcb1 strains and in mcb1 strains expressing yeast C1 or N1, indicating that none of the derivatives substantially impaired assembly or the peptidase activity of the holoenzyme complex.

View larger version (40K): [in this window] [in a new window]   Fig. 9.   Analysis of the 26 S proteasome in wild-type yeast and mcb1 strains expressing the yeast deletions N1 or C1. Equal amounts of yeast cells from wild-type, mcb1, and mcb1 strains expressing Mcb1 deletion C1 or N1, were lysed and fractionated by DEAE-Affi-Gel blue chromatography. Equal amounts of protein, as determined by Bradford assay, from fractions containing the 26 S proteasome were resolved by nondenaturing PAGE on a 4% acrylamide gel (panels A and B). DEAE-Affi-Gel blue fractions, containing the 26 S proteasome from the wild-type yeast and mcb1 strain expressing N1, were further fractionated by MonoQ FPLC using a linear 200-450 mM NaCl gradient (panels C-E for N1 expressing strain). MonoQ FPLC fractions, containing equal amount of protein from wild-type yeast and mcb1 strain expressing N1, were resolved by nondenaturing PAGE and subjected to immunoblot analyses (panel F). A, peptidase overlay assay of the 26 S proteasome preparations from wild-type, C1, N1, and mcb1 strains using the fluorogenic substrate Suc-LLVY-AMC (lanes 1-4, respectively). B, immunoblot of the gel shown in panel A using yeast Mcb1 antisera. Migration position of the two 26 S proteasome species (26Sa and 26Sb) as well as the 20 S proteasome (20S) are indicated. C-E, fractions from the MonoQ FPLC, prepared from the mcb1 strain expressing N1, were analyzed for the 26 S proteasome by peptidase assay using the substrate Suc-LLVY (C) and for the presence of Sug1/Cim3 (D) and N1 protein (E) by immunoblot analysis. F, immunoblot of a native PAGE gel using yeast Mcb1 antisera. Lanes 1 and 2 correspond to the peak peptidase fractions from the MonoQ FPLC prepared from wild-type yeast and mcb1 strain expressing N1, respectively. Migration positions of the two forms of the 26 S proteasome (26Sa and 26Sb) are indicated.

	DISCUSSION

Top Abstract