|
Glucocorticoids Stimulate p21 Gene Expression by Targeting
Multiple Transcriptional Elements within a Steroid Responsive Region of
the p21waf1/cip1 Promoter in Rat Hepatoma Cells*
Helen H.
Cha ,
Erin J.
Cram ,
Edward C.
Wang,
Art J.
Huang,
Herbert G.
Kasler, and
Gary L.
Firestone§
From the Department of Molecular and Cell Biology and The Cancer
Research Laboratory, University of California,
Berkeley, California 94720
 |
ABSTRACT |
Glucocorticoids can induce a G1
arrest in the cell cycle progression of BDS1 rat hepatoma cells. In
these cells, dexamethasone, a synthetic glucocorticoid, stimulated a
rapid and selective increase in expression of the p21
cyclin-dependent kinase (CDK) inhibitor mRNA and
protein and virtually abolished CDK2 phosphorylation of the
retinoblastoma protein. Expression of the p27 CDK inhibitor, and other
G1-acting cell cycle proteins, remained unaffected. Dexamethasone stimulated p21 promoter activity in a p53-independent manner that required functional glucocorticoid receptors. Transforming growth factor- , which also induced a G1 cell cycle
arrest of the hepatoma cells, failed to elicit this response. Analysis
of 5 deletions of the p21 promoter uncovered a glucocorticoid
responsive region between nucleotides 1481 and 1184, which does not
contain a canonical glucocorticoid response element but which can
confer dexamethasone responsiveness to a heterologous promoter. Fine mapping of this region uncovered three distinct 50-60-base pair transcriptional elements that likely function as targets of
glucocorticoid receptor signaling. Finally, ectopic expression of p21
had no effect on hepatoma cell growth in the absence of glucocorticoids but facilitated the ability of dexamethasone to inhibit cell
proliferation. Thus, our results have established a direct
transcriptional link between glucocorticoid receptor signaling and the
regulated promoter activity of a CDK inhibitor gene that is involved in
the cell cycle arrest of hepatoma cells.
 |
INTRODUCTION |
Glucocorticoids regulate the transcription of a network of genes
that trigger characteristic responses in specific target cells (1-3).
The direction and strength of the transcriptional regulation depend on
steroid receptor interactions with specific DNA recognition sequences
(2, 4-6), protein-protein interactions with transcription factors and
accessory proteins (1, 7-9), the overall promoter context of the
regulated gene, and the availability of specific sets of
tissue-specific transcriptional regulators (4, 5, 9, 10). As a result
of these interactions, glucocorticoids can either inhibit or stimulate
the in vivo and in vitro growth of many types of
normal and transformed cells. Normal hepatocytes and certain hepatoma
cell lines display an acute sensitivity to the anti-proliferative
effects of glucocorticoids and can be utilized to examine the
mechanisms of steroid-induced growth suppression (11-17). The
glucocorticoid growth suppression response is controlled through
cellular cascades in which the receptor-mediated transcription of
primary response genes regulates the subsequent expression and/or
activity of a diverse set of genes including factors important for cell
cycle progression (5, 7, 18). However, the functional connection
between the steroid-regulated transcriptional events and the cell cycle
arrest of hepatic-derived cells is poorly understood at a molecular
level.
Most of the hormonal cues known to drive cells through critical cell
cycle transitions, or inhibit cell cycle progression, target components
that act within the G1 phase or at the G1/S boundary (19-21). Progression through the cell cycle is mediated by
the activation of the cyclin-dependent kinases
(CDKs)1 (21, 22). CDKs are
regulated by complex formation with a cyclin partner and by
phosphorylation at specific residues (23-25). Two families of proteins
associate with specific cyclin-CDK complexes and act as CDK inhibitors
(20, 23, 26) as follows: the p16 family (p16/Ink4, p15, p18, and p19),
which competes with cyclin D for binding to CDK4 and CDK6, thereby
negatively regulating kinase activity, and the p21 family (p21, p27,
and p57), which forms complexes with a wider range of cyclin-CDK
complexes (26, 27). The p21 protein has been shown to be a potent
inhibitor of CDK2 and CDK4 kinase activity in vitro (25, 28,
29). Binding of the CDK inhibitors prevents the CDK-mediated
phosphorylation of the retinoblastoma (Rb) protein, which functions to
sequester the E2F-1 transcription factor in an inactive complex
(30-32). In addition, p21 and p27 have been shown to block the
in vitro phosphorylation of CDK by the CDK-activating kinase
(33).
Several of the CDK inhibitors are targets of signaling pathways induced
by negative growth regulators. For example, in some transforming growth
factor- (TGF- ) growth-inhibited cells, cell cycle progression is
blocked in late G1 as a result of the association of p27
with newly formed cyclin E-CDK2 complexes and of an increase in p15
transcript levels (20, 25). Other studies have correlated the
expression of CDK inhibitors with cell cycle arrest and/or differentiation in many cell types after treatment with extracellular growth regulators, exposure to particular environmental conditions, or
by ectopic expression of intracellular modulators of the cell cycle
(27, 34). For example, p21 is under transcriptional control by the p53
tumor suppressor gene, vitamin D3 receptor (35), retinoic acid receptor
(36), the AP2 (37), E2A (38) Sp1, Sp3, and STAT1 transcription factors,
and TGF- 1 through their respective response elements in the p21
promoter (38-42). In specific osteosarcoma and fibroblast cell lines,
glucocorticoids increase the level of p21, although the mechanism of
transcriptional control of p21 was not characterized in these cell
types (43, 44). Recent studies have indicated that the transcriptional regulation of p21 is part of physiologically important proliferative, developmental, and differentiation processes. For example, strong signaling through Raf can lead to a G1 cell cycle arrest by
up-regulation of p21 (45, 46). Also, the targeted expression of p21 in
hepatocytes of transgenic mice resulted in a decreased number of adult
hepatocytes, a smaller liver, aberrant liver tissue organization, the
failure of partial hepatectomy to stimulate liver regeneration, and an observed inhibition of cyclin D-CDK4 activity with a resulting G1 cell cycle arrest (47). This result implicates p21 as an important target in the growth regulation of normal hepatic-derived cells and perhaps their transformed counterparts.
We have previously characterized glucocorticoid-sensitive and
-resistant hepatoma cell variants generated from Fu5 hepatoma cell
populations and have demonstrated that the dexamethasone growth
suppression response is a receptor-dependent process that does not affect cell viability (11, 12, 14). In Fu5-derived BDS1 cells,
dexamethasone induces an early G1 block in cell cycle progression (14) mediated, in part, by an increased expression of the
C/EBP transcription factor (48). Given the importance of p21 in
controlling progression through G1 in normal hepatic cell
types, and the known transcriptional regulatory pathways operating on
the p21 gene, the regulation of p21 may be part of the signal
transduction pathway through which glucocorticoids mediate their
tissue-specific anti-proliferative effects. In this study, we
demonstrate that the glucocorticoid G1 cell cycle arrest of
hepatoma cells is accompanied by the selective stimulation in p21
expression and activation of the p21 promoter through multiple transcription factor binding sites, within a defined
glucocorticoid-regulated region. The following companion
paper (82) establishes a functional role for the
glucocorticoid-induced expression of the C/EBP
transcription factor in the regulated expression and promoter
activity of p21 in hepatoma cells. The transcriptional control of p21
through at least two distinct pathways provides a basis for
understanding the anti-proliferative mechanism of glucocorticoids.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Dulbecco's modified Eagle's/F12 (1:1) medium,
fetal bovine serum, calcium- and magnesium-free phosphate buffered
saline (PBS), and trypsin-EDTA were supplied by BioWhittaker
(Walkersville, MD). Dexamethasone was obtained from Sigma.
[3H]Thymidine (84 Ci/mmol), [3H]acetyl
coenzyme A (200 mCi/mmol), [ -32P]dCTP (3,000 Ci/mmol),
and [ -32P]dATP (3,000 Ci/mmol) were obtained from NEN
Life Science Products. Anti-p21, anti-p27, anti-CDK2, anti-CDK4,
anti-CDK6, anti-cyclin D1, and horseradish peroxidase (HRP) donkey
anti-goat antibodies were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). HRP-conjugated goat anti-rabbit and goat anti-mouse
antibodies were purchased from Bio-Rad. The enhanced chemiluminescence
protein detection system and the Multiprime DNA labeling kit were
purchased from Amersham Corp. PCR reagents including Taq
polymerase, Taq polymerase buffer, and Perfect Match enzyme
were purchased from Boehringer Mannheim. The chimeric pGRE-CAT reporter
plasmid containing six glucocorticoid response elements linked to the
chloramphenicol acetyltransferase (CAT) reporter gene was a generous
gift from Dr. Keith R. Yamamoto (Dept. of Biochemistry and Biophysics,
University of California, San Francisco). The chimeric p21 promoter CAT
reporter plasmids containing deletions at 2.326 kb, 1.892 kb,
1.481 kb, 1.184 kb, 0.883 kb, 0.585 kb, and 0.291 kb, and the
p21-luciferase reporter plasmids were generous gifts from B. Vogelstein
(Molecular Genetics Laboratory, Johns Hopkins Oncology Center,
Baltimore) and have been described previously (41). Fine
mapping deletion constructs were PCR-amplified from the full-length
2.326p21 CAT reporter plasmid and cloned into pBLCAT2 (Promega). All
other reagents were of highest available purity.
Hepatoma Cell Lines and Methods of
Culture--
Glucocorticoid-sensitive BDS1 cells and
glucocorticoid-resistant EDR3 (receptor-defective) cells are epithelial
tumor cells derived from the rat Reuber hepatoma (12, 48). All cell
lines were routinely grown in Dulbecco's modified Eagle's
medium/F-12/10% fetal bovine serum at 37 °C in humidified air
containing 5% CO2. Cell culture medium was routinely
changed every 48 h. Dexamethasone was added to a final
concentration of 1 µM as indicated, and TGF- was added
to a final concentration of 2 ng/ml.
Assay of DNA Synthesis by [3H]Thymidine
Incorporation--
Triplicate samples of asynchronously growing BDS1
or EDR3 hepatoma cells were treated for the indicated times with
dexamethasone, pulse-radiolabeled for 2 h with 3 µCi of
[3H]thymidine (84 Ci/mmol), washed three times with
ice-cold 10% trichloroacetic acid, and lysed with 300 µl of 0.3 N NaOH. Lysates (100 µl) were transferred directly into
vials containing a liquid scintillation mixture; radioactivity was
quantitated by scintillation counting.
Flow Cytometric Analyses of DNA Content--
Hepatoma cells
(4 × 104) were plated onto Corning 6-well tissue
culture dishes and treated with or without 1 µM
dexamethasone or 2 ng/ml TGF- , and the medium was changed every
24 h. After 48 h, cells were hypotonically lysed in 1 ml of
DNA staining solution (0.5 mg/ml propidium iodide, 0.1% sodium
citrate, 0.05% Triton X-100). Nuclear emitted fluorescence was
measured with a Coulter Elite instrument with laser output adjusted to
deliver 15 milliwatts at 488 nm. Cell nuclei (104) were
analyzed from each sample at a rate of 300-500 nuclei/s. The
percentages of cells within the G1, S, and G2/M
phases of the cell cycle were determined by analysis with the
Multicycle computer program provided by Phoenix Flow Systems in the
Cancer Research Laboratory Microchemical Facility of the University of California, Berkeley.
Isolation of Poly(A)+ RNA and Northern Blot Analysis
of p21 mRNA Levels--
Logarithmically growing BDS1 cells were
treated with 1 µM dexamethasone and/or 10 µg/ml
cycloheximide for 8 h. Cells were then lysed, and
poly(A)+ RNA was isolated from hepatoma cells as described
previously (14). For Northern blot analysis, 2 µg of
poly(A)+ RNA was electrophoretically separated in a 6%
formaldehyde, 1% agarose gel, transferred onto Nytran nylon membranes
(Schleicher & Schuell), and cross-linked in a UV Stratalinker
(Stratagene). Membranes were preincubated with 100 µg/ml denatured
salmon sperm DNA and subsequently hybridized with cDNA probes
[ -32P]dCTP-labeled by random primer extension
(Amersham Corp.). For p21 mRNA detection, membranes were washed
twice with 2 × SSC, 0.1% SDS at room temperature and once for 30 min and then once for 1.5 h. The same procedure was then repeated
at 50 °C. For detection of GAPDH transcripts, membranes were washed
with 2 × SSC twice at room temperature for 10 min followed by two
30-min washes at 60 °C in 0.2 × SSC, 0.1% SDS. The membranes
were air-dried followed by autoradiographic exposure to x-ray film 1-5
days at 80 °C. p21 transcript expression was detected with a
purified 850-base pair (bp) EcoRI fragment 9C from mouse p21
cDNA. GAPDH mRNA was detected with a 560-bp
XbaI/HinD III fragment 3A of human cDNA.
Western Blot Analysis--
Hepatoma cells were cultured in
100-mm tissue culture plates and were treated for either 0, 6, 12, 24, or 48 h with 1 µM dexamethasone. Cells were
harvested in RIPA buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 1% sodium
deoxycholate) and protein concentrations determined by the Bradford
protein assay (Bio-Rad). For each sample, 30 µg of protein were mixed
with 15 µl of sample buffer (62.5 mM Tris-HCl, pH 6.8, 8% glycerol, 5% -mercaptoethanol, 3% SDS, 0.01% bromphenol blue)
and fractionated on 10% polyacrylamide, 0.1% SDS resolving gels by
electrophoresis. Proteins were electrically transferred to
nitrocellulose membranes (Micron Separations Inc., Westboro, MA) and
blocked overnight at 4 °C with TBS-T, 5% NFDM (10 mM
Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20, 5% nonfat
dry milk). Blots were subsequently incubated in TBST at room
temperature with 1 mg/ml rabbit p27, CDK6 or CDK4 IgG, 0.4 mg/ml rabbit
anti-CDK2 IgG, 1 mg/ml goat anti-p21 IgG, or 1 mg/ml mouse anti-cyclin
D1 IgG. Incubation times were 1 h for p27, CDK2, CDK4, and CDK6;
2 h for p21; and 12 h for cyclin D1. Membranes were then
washed twice with TBST and twice with TBST, 1% NFDM, for 15 min each.
HRP-conjugated goat anti-rabbit secondary antibodies were diluted in
TBST, 1% NFDM 1:5000 for CDK2, CDK4, and CDK6 and 1:2000 for p27, and
membranes were incubated with the diluted antibodies for 1 h at
room temperature. HRP-conjugated donkey anti-goat antibodies were
diluted in TBST, 1% NFDM 1:1000 for p21, and incubation time was
2 h. HRP-conjugated goat anti-mouse antibodies were diluted in
TBST, 1% NFDM 1:5000 for cyclin D1, and incubation time was 2 h.
Following incubation with secondary antibodies, blots were washed twice
with TBST, 1% NFDM, and twice with TBST for 15 min each.
Autoradiographic exposures were scanned with a UMAX UC630 scanner, and
band intensities were quantified using the NIH image program.
Autoradiographs from three independent experiments were scanned per
time point.
Immunoprecipitation and CDK2 Kinase Assay--
Hepatoma cells
were cultured for 0, 6, 12, 24, or 30 h in growth media with or
without 1 µM dexamethasone and then rinsed twice with
PBS, harvested, and stored as dry pellets at 70 °C. For the
immunoprecipitations, cells were lysed for 15 min in
immunoprecipitation buffer (50 mM Tris-HCl, pH 7.4, 200 mM NaCl, 0.1% Triton X-100) containing protease and
phosphatase inhibitors (50 µg/ml phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 5 µg/ml leupeptin, 0.1 µg/ml NaF, 10 µg/ml
-glycerophosphate, and 0.1 mM sodium orthovanadate). After centrifugation at 1.4 × 104 × g for
10 min at 4 °C, the total protein in each sample was determined by
Bradford assay. Samples were diluted to 400 µg of protein/ml of
immunoprecipitation buffer. Samples were pre-cleared for 2 h at
4 °C with 40 µl of protein A-Sepharose beads (Pharmacia Biotech,
Sweden) and 1 µg of rabbit IgG. After a brief centrifugation to
remove pre-cleared beads, 0.3 µg of anti-CDK2 antibody was added to
each sample and incubated on a rocking platform at 4 °C for 2 h. Subsequently, 10 µl of protein A-Sepharose beads were added to
each sample, and the slurries were incubated on the rocking platform at
4 °C for 30 min. The beads were then washed five times with ice-cold
IP buffer and twice with ice-cold kinase buffer (50 mM
HEPES, 10 mM MgCl2, 5 mM
MnCl2, 0.1 µg/ml NaF, 10 µg/ml -glycerophosphate,
and 0.1 mM sodium orthovanadate).
For the kinase assay, each immunoprecipitated sample was resuspended in
25 µl of kinase buffer containing 20 mM ATP, 5 mM dithiothreitol, 0.18 µg of Rb carboxyl-terminal domain
protein substrate (Santa Cruz Biotechnology), and 10 µCi of
[ -32P]dATP (6000 Ci/mmol). Reactions were incubated
for 15 min at 30 °C and stopped by adding an equal volume of 2 × loading buffer (10% glycerol, 5% -mercaptoethanol, 3% SDS,
62.5 mM Tris-HCl, pH 6.8, and bromphenol blue). Reaction
products were boiled for 10 min and then electrophoretically
fractionated in SDS-10% polyacrylamide gels. Gels were stained with
Coomassie Blue to monitor loading and de-stained overnight with 3%
glycerol. Subsequently, gels were dried and visualized by
autoradiography.
Transfection Procedures--
Logarithmically growing hepatoma
cells were transfected by electroporation as described previously (48).
Single cell suspensions were washed twice with sterile PBS and
resuspended in electroporation buffer (270 mM sucrose, 7 mM sodium phosphate buffer, pH 7.4, 1 mM
MgCl2). Cells (400 µl; 1-2 × 107
cells/sample) were dispensed into sterile cuvettes. In all transfection experiments, the cells and 14 µg of pBLCAT2 empty vector and 16 µg
of p21 promoter-CAT (or p21 promoter-luciferase) reporter construct or
30 µg of expression vector DNA were gently mixed, electrically pulsed
five times (400 V square wave pulse for 99 µs) using a BTX 800 Transfector apparatus (BTX Inc., San Diego, CA), and incubated on ice
for 10 min. Transfected cells were plated into pre-warmed Dulbecco's
modified Eagle's medium/F12, 10% fetal bovine serum in 100-mm tissue
culture dishes and propagated at 37 °C. Twenty-four-hour intervals
after transfection, cells were re-incubated with fresh medium with or
without 1 µM dexamethasone or 2 ng/ml TGF- and harvested after 48 h.
CAT Assays--
For CAT assays, cells were harvested, washed
twice in PBS, resuspended in 100 mM Tris-HCl, pH 7.8, and
lysed by alternating between an ethanol/dry ice bath and a 37 °C
water bath, 5 min per cycle. Cell lysates were heated at 68 °C for
15 min, centrifuged at 1.4 × 104 × g for
10 min, and the supernatant fractions were recovered. CAT activity in
the cell extracts containing 20-50 µg of lysate protein was measured
by a quantitative non-chromatographic assay (49). The enzyme assay was
carried out in 100 mM Tris-HCl, pH 7.8, 1 mM
aqueous chloramphenicol, and 1 µCi of [3H]acetyl
coenzyme A (final reaction volume of 250 µl). The reaction mixture
was gently overlaid with 4 ml of Econofluor water immiscible scintillation fluorochrome (NEN Life Science Products). CAT activity was monitored by direct measurement of radioactivity by liquid scintillation counting. The enzyme activity was expressed as a function
of 3H-acetylated chloramphenicol produced per µg of
protein present in corresponding cell lysates. For each assay
procedure, reaction mixtures were incubated at 37 °C for 3-8 h.
Mock transfected cells were used to establish basal level activity for
both assays.
Luciferase Assays--
For luciferase assays, cells were
harvested by washing twice in PBS and lysed in 1 ml of Promega lysis
buffer. Twenty µl of BDS1 cell lysate was added to 12 × 75-mm
cuvettes (Analytical Luminescence Laboratory) and subsequently loaded
into a luminometer (Monolight 2010, Analytical Luminescence
Laboratory). One hundred µl of luciferase substrate buffer (20 mM Tricine, 1.07 mM
(MgCO3)4 Mg(OH)2·5
H2O, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM dithiothreitol, 270 µM coenzyme A, 470 µM
D-luciferin sodium salt, 530 µM ATP disodium
salt, final pH 7.8) was injected by the machine into each sample, and
luminescence was measured as relative light units. The luciferase
specific activity was expressed as an average of relative light units
produced per µg of protein present in corresponding cell lysates as
measured by Bradford assay.
Construction of p21 Promoter-CAT Reporter Genes--
A p21-CAT
reporter plasmid containing 2.326 kb of the human p21 promoter sequence
upstream of the RNA start site was a gift from B. Vogelstein, and has
been previously described (41). For fine mapping, wild type internal
promoter fragments were cloned from the 2.326-kb p21 promoter using a
PCR cloning strategy, into a BamHI/HinD III site
on the pBLCAT2 vector which contains a thymidine kinase (tk) minimal
promoter. Each PCR reaction contained 1 unit of Taq
polymerase, Taq polymerase buffer (10 mM
Tris-HCl, 50 mM KCl, and 2.5 mM
MgCl2, pH 8.3), 0.1 unit of Perfect Match enzyme, and 20 µM primers specifically designed to amplify each internal fragment. The 297-bp fragment 1481/ 1184 was amplified using the following: 5 TAATTAAGCTTCTGTGTCCTCCCACCCCT3 and
5 AATTTGGATCCATCTACCTCACACCCCTGAC3 ; the 199-bp fragment 1383/ 1184
with 5 ACTGGAAGCTTGCATGTCTGGGCAGAGATTT3 and
5 AATTTGGATCCATCTACCTCACACCCCTGAC3 ; the 100-bp fragment 1481/ 1381 with 5 TAATTAAGCTTCTGTGTCCTCCCACCCCT3 and
5 TTATTGGATCCCCCAGTCTTCTTCCTCTAAC3 ; the 60-bp fragment 1441/ 1381
with 5 TTAGGAAGCTTCAGAGGAGAAAGAAGCCT3 and
5 TTATTGGATCCCCCAGTCTTCTTCCTCTAAC3 ; the 50-bp fragment 1481/ 1431 with 5 TAATTAAGCTTCTGTGTCCTCCCACCCCT3 and
5 GCAAAGGATCCTTCTCCTCTGCTGTGGGGAT3 ; and the 50-bp fragment
1383/ 1333 with 5 ACTGGAAGCTTGCATGTCTGGGCAGAGATTT3 and
5 GCAAAGGATCCTACTGACATCTCAGGCTG3 . Fragments were then cloned into the plasmid pTK-CAT by ligation with the Takara DNA ligation kit
(Panvera, Madison, WI). To verify each step in the cloning procedure,
BamHI/HindIII fragments larger than 60 bp were
resolved on 1% agarose gels and visualized by ethidium bromide
staining. BamHI/HindIII fragments between 50 and
60 bp in length were end-labeled using the Random Primed Labeling Kit
(Boehringer Mannheim) for 30 min at room temperature and then separated
on a 10% native polyacrylamide gel in 0.15 M NaCl, 0.017 M sodium citrate and exposed to autoradiography film for 30 min. All constructs were subsequently confirmed by DNA sequencing.
Cell Foci Assay--
To determine the effects of p21
overexpression on hepatoma cell growth, a cell foci assay was utilized
as described previously (48). BDS1 cells were cotransfected with 29 µg of the p21 expression vector, along with 2.7 µg of pCNot which
carries the neomycin resistance gene. A second set of hepatoma cells
was also cotransfected with a control vector and the pCNot neomycin
resistance plasmid. Forty-eight hours after transfection, cells were
washed twice with PBS and propagated with fresh medium containing G418
(400 µg/ml). Transfected cells were grown under G418 selection for 2 weeks. Single cell suspensions were made by trypsinization, and
104 cells were re-plated on 100-mm tissue culture dishes.
The transfected cells were cultured for 2 weeks in medium supplemented
with G418 (200 µg/ml) in the presence or absence of dexamethasone.
Cells were washed twice with PBS, fixed, and stained with 10%
formalin, 0.5% crystal violet. The foci area within each plate was
quantitated using the NIH image program after scanning each culture of
fixed hepatoma cells with a UMAX UC630 scanner.
 |
RESULTS |
Dexamethasone Stimulates p21 CDK Inhibitor Protein Levels and
Reduces CDK Activity in Growth Suppressible BDS1 Hepatoma
Cells--
We have previously shown that glucocorticoids induce a
G1 block in cell cycle progression in BDS1 rat hepatoma
cells (14, 48) which suggested that this steroid may selectively
regulate the expression of G1-acting cell cycle components.
As an initial test of the kinetic relationship between the expression
of cell cycle components and the glucocorticoid growth arrest of an
asynchronously growing population of BDS1 hepatoma cells, the rate of
DNA synthesis and the production of cell cycle proteins were monitored
over a 24-h time course of dexamethasone treatment. Western blot
analysis of total hepatoma cell extracts revealed that dexamethasone
strongly stimulated the level of the p21 CDK inhibitor protein but had no effect on p27 protein levels, a member of the same family of CDK
inhibitors (Fig. 1, upper
panels). Dexamethasone induced a relatively rapid increase in p21
protein production that peaked between 10 and 12 h. After 24 h of steroid treatment, the level of p21 protein still remained 2-fold
above basal levels (Fig. 1, lower panel). In contrast to p21
production, the protein levels of p27, CDK2, CDK4, CDK6, and cyclin D1,
other G1-acting cell cycle components, remained unchanged
after glucocorticoid treatment (Fig. 1). Time course analysis of
[3H]thymidine incorporation in the asynchronously growing
population of hepatoma cells revealed that the rise in p21 protein
approximately coincided with the dexamethasone-mediated inhibition of
DNA synthesis during the first 12 h of steroid treatment (Fig. 1,
lower panel). The peak of the dexamethasone induction
of p21 protein levels occurred prior to the observed maximal inhibition
of [3H]thymidine incorporation which suggests a causal
relationship between p21 production and the glucocorticoid-regulated
growth arrest of hepatoma cells.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Time course of the effects of dexamethasone
on the production of cell cycle proteins and DNA synthesis in hepatoma
cells. Top panels, BDS1 hepatoma cells were treated with or
without 1 µM dexamethasone for the indicated times, and
the protein production of p21, p27, CDK2, CDK4, CDK6, and cyclin D1 was
determined by Western blot analysis using specific antibodies. The same
cell extracts were utilized for the analysis of each cell cycle protein and for confirming equal sample loading by Coomassie staining of a
parallel SDS-polyacrylamide gel. Lower panel, cells were plated at 10,000 cells per well on 24-well tissue culture dishes (forming a subconfluent monolayer) and treated with 1 µM
dexamethasone for the indicated times. Cells were labeled with
[3H]thymidine for 2 h, and the incorporation into
DNA was determined by acid precipitation as described under
"Experimental Procedures." The reported values are representative
of four independent experiments of triplicate samples, and the
error bars indicate the standard deviation. The relative
level of p21 protein shown in the representative Western blot in the
upper panel, as well as from other Western blots, were
quantitated as described under "Experimental Procedures." The
reported values were calculated as the percentage of maximal induction
of p21 observed at 12 h of dexamethasone treatment.
|
|
The p21 protein is known to interact with and inhibit each of the
G1-acting cyclin-CDK complexes (23, 29). To functionally test if the glucocorticoid-mediated increase in p21 protein had an
effect on CDK activity, the ability of immunoprecipitated CDK2 to
phosphorylate the retinoblastoma protein (Rb) in vitro was examined throughout a 24-h time course of dexamethasone treatment. As
shown in Fig. 2, the level of
CDK2-mediated Rb phosphorylation activity was strongly inhibited by
dexamethasone in a manner consistent with the stimulation in p21
protein levels. Moreover, a greater amount of p21 protein
co-immunoprecipitated with CDK2 from dexamethasone-treated cells as
compared with untreated cells (data not shown). After 24 h in
dexamethasone, virtually no CDK2 activity was observed. Thus, the
glucocorticoid stimulation of p21 protein expression results in an
inhibition of the enzymatic activity of CDK2, which is likely to play a
role in the G1 cell cycle arrest observed in hepatoma
cells.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Dexamethasone inhibition of CDK2 kinase
activity. Cells were cultured with or without 1 µM
dexamethasone, and at the indicated times, CDK2 was immunoprecipitated
from cell lysates and assayed for in vitro kinase activity
using the carboxyl terminus of the Rb protein as a substrate. One
control immunoprecipitation contained rabbit anti-IgG with no added
anti-CDK2 antibodies (No IP). The kinase reaction mixtures
were electrophoretically fractionated, and the level of
[32P]Rb analyzed by autoradiography.
|
|
Dexamethasone Stimulation of p21 Transcript Levels Does Not Require
de Novo Protein Synthesis--
The relatively rapid increase in p21
protein production observed after dexamethasone treatment suggested
that this glucocorticoid response is due to the increased expression of
p21 mRNA. To determine if glucocorticoids stimulate p21 transcript
levels, poly(A)+ RNA was isolated from hepatoma cells
treated with or without dexamethasone for 4 h, and Northern blots
were hybridized with a p21-specific cDNA probe. As shown in Fig.
3, glucocorticoid-treated cells express
significantly higher levels of p21 transcripts than untreated cells.
GAPDH transcripts remained unchanged by dexamethasone and represent a
gel loading control. Thus, the glucocorticoid stimulation of p21
protein production can be accounted for by a corresponding induction of
p21 transcripts. Poly(A)+ RNA was also isolated from a
parallel set of glucocorticoid-treated and untreated cells incubated
with the protein synthesis inhibitor, cycloheximide. As shown in Fig.
3, the glucocorticoid induction of p21 transcripts occurred in the
absence of de novo protein synthesis, suggesting that the
regulation of p21 gene expression is mediated, in part, by one or more
pre-existing cellular components that are likely to be involved in the
transcriptional control of this gene.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of dexamethasone on the expression of
p21 transcripts in hepatoma cells treated with or without
cycloheximide. BDS1 hepatoma cells were treated with or without 1 µM dexamethasone (Dex) in the presence or in
the absence of 10 µg/ml cycloheximide (Chx) for 8 h.
The isolated poly(A)+ RNA was electrophoretically
fractionated, and Northern blots were probed for p21 transcripts (p21)
as described under "Experimental Procedures." As a loading control,
the Northern blots were reprobed for GAPDH which is a constitutively
expressed transcript.
|
|
Dexamethasone Stimulates p21 Promoter Activity in a p53 Independent
Manner That Requires the Presence of the Glucocorticoid
Receptor--
The kinetics of dexamethasone-induced p21 transcripts
and protein in BDS1 hepatoma cells suggested that this response is
mediated by the transcriptional activation of the p21 gene. However,
the p21 promoter does not contain a canonical glucocorticoid response element (44), indicating that the receptor signaling pathway likely
regulates the activity and/or expression of one or more transcription
factors that control expression of this CDK inhibitor gene. It is well
established that one such transcriptional regulator of the p21 promoter
is the p53 tumor suppressor protein which can cause a G1
cell cycle arrest of certain tumor cells (21, 39, 50). Moreover, we
have recently uncovered a functional interaction between p53 and
glucocorticoid receptor signaling in certain epithelial cell types
(51). Thus, it was important to determine if glucocorticoids can
stimulate p21 promoter activity and if this response can occur
independently of the key p53 DNA element. To examine directly these
possibilities, reporter plasmids were utilized that contain fragments
of the p21 promoter linked to the firefly luciferase reporter gene. The
2.4-kb p21 promoter fragment contains the functional p53 DNA-binding
site at 2.28 kb, whereas the other p21 promoter fragment is a 5
deletion ending at 2.256 kb (Fig. 4,
diagram) and is not responsive to the transcriptional effects of p53 (40). BDS1 hepatoma cells were transiently transfected with each reporter plasmid, treated with or without dexamethasone for
48 h, and assayed for luciferase specific activity. As shown in
Fig. 4, each p21 promoter fragment conferred glucocorticoid responsiveness to the luciferase reporter gene following dexamethasone stimulation. This result demonstrates that the p21 promoter is a
transcriptional target of glucocorticoid receptor signaling and that
regulation occurs independently of the critical p53 consensus sequence.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 4.
Dexamethasone stimulation of p21 promoter
activity does not require the p53 DNA binding element. BDS1
hepatoma cells were transiently transfected with either the
2.4p21-luc reporter plasmid which contains the p53 DNA-binding site
at 2.280 (see diagram) or with the 2.256p21-luc reporter
plasmid from which the p53 DNA-binding site has been deleted.
Transfected cells were treated with or without 1 µM
dexamethasone for 48 h and assayed for luciferase activity as
described under "Experimental Procedures." The relative light units
per µg of protein were calculated as an average of three independent
experiments of triplicate samples, and the error bars
indicate the standard deviation.
|
|
To test if the dexamethasone stimulation of p21 promoter activity
required the presence of functioning glucocorticoid receptors, the wild
type 2.4-kb p21-luciferase reporter plasmid was transfected into
glucocorticoid receptor-containing (GR+) BDS1 hepatoma cells or into
glucocorticoid receptor-deficient (GR ) EDR3 hepatoma cells originally
selected for their resistance to the glucocorticoid growth arrest (12).
Treatment with dexamethasone failed to induce p21 promoter activity in
GR-deficient EDR3 hepatoma cells under conditions in which this
promoter was inducible in GR-positive BDS1 cells (Fig. 4, top
panels), thereby demonstrating the receptor dependence of this
response. As controls, parallel cultures of either GR-containing BDS1
cells or GR-deficient EDR3 cells were either transiently transfected
with the pGRE-CAT reporter plasmid, which contains six copies of the
consensus glucocorticoid response element linked to the bacterial
chloramphenicol acetyltransferase (CAT) reporter gene, or examined for
the dexamethasone inhibition of [3H]thymidine
incorporation. As expected, dexamethasone strongly stimulated CAT
activity 50-100-fold and inhibited DNA synthesis of GR-containing BDS1
cells but had no effect on either response in the GR-deficient EDR3
cells (Fig. 5, middle and
lower panels). This observation implies that the
glucocorticoid induction of p21 promoter is a biologically significant
receptor-dependent response associated with the growth
regulation of hepatoma cells.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
Glucocorticoid stimulation of p21 promoter
activity requires expression of functional glucocorticoid
receptors. Glucocorticoid receptor-positive BDS1 hepatoma cells
and receptor-negative EDR3 hepatoma cells were transiently transfected
with the 2.4p21-luc reporter plasmid, treated with or without 1 µM dexamethasone for 48 h, and luciferase-specific
activity determined as described in Fig. 4. One parallel set of
hepatoma cells was transfected with the pGRE-CAT reporter plasmid to
assess general glucocorticoid responsiveness. Transfected cells were
treated with 1 µM dexamethasone for 48 h and assayed
for CAT-specific activity as described under "Experimental
Procedures." Another set of dexamethasone-treated and untreated cells
was examined for DNA synthesis by the incorporation of
[3H]thymidine as described under "Experimental
Procedures." Given values were calculated as an average of triplicate
experiments, and the error bars indicate the standard
deviation.
|
|
Activation of the p21 Promoter Is Specific for the Glucocorticoid
Cell Cycle Arrest of Hepatoma Cells--
BDS1 hepatoma cells can be
growth-inhibited by either glucocorticoids or by TGF- . This
phenotype allowed us to test if the regulation of p21 promoter activity
is a specific glucocorticoid receptor response or generally reflects
the growth-suppressed state of the cells. Parallel BDS1 cell cultures
were tested for the stimulation of p21 promoter activity and regulation
of DNA content by flow cytometry after treatment with either
dexamethasone or TGF- . To monitor p21 promoter activity, cells were
transiently transfected with the 2.326-kb p21-CAT reporter plasmid
that contains a fragment of the p21 promoter ( 2326 to +55) linked to
the CAT reporter gene. Cells were treated with dexamethasone or TGF- for 48 h, and cell lysates were assayed for CAT specific activity. As shown in Fig. 6, treatment with
dexamethasone, but not with TGF- , stimulated p21 promoter activity.
Importantly, flow analysis of nuclear DNA content after propidium
iodide staining confirmed that both dexamethasone and TGF- induced a
G1 block in cell cycle progression under the conditions of
our assay (Fig. 6, right panels). Thus, even though both
glucocorticoids and TGF- can induce a G1 cell cycle
arrest, the regulation of p21 gene expression is specific for the
glucocorticoid growth suppression pathway in BDS1 hepatoma cells.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
Dexamethasone stimulation of the p21 promoter
is not a general consequence of a G1 cell cycle arrest.
Left panel, BDS1 hepatoma cells were transiently transfected
with the 2.326 p21-CAT reporter plasmid and then incubated with 1 µM dexamethasone (Dex), 2 ng/ml TGF- , or
with no added hormones for 48 h, and CAT specific activity was
assayed using a quantitative method that measures the conversion of
[3H]acetyl coenzyme A into [3H]acetyl
chloramphenicol. CAT specific activity is the CAT activity produced per
µg of protein present in the corresponding cell lysates and is
described under "Experimental Procedures." The reported values are
an average of three independent experiments of triplicate samples, and
the error bars indicate standard deviation. Right panels, hepatoma cells were treated with 1 µM
dexamethasone (Dex), 2 ng/ml TGF- , or with no added
hormones for 48 h. Cells were then stained with propidium iodide,
and nuclei were analyzed for DNA content by flow cytometry with a
Coulter Elite Laser. A total of 10,000 nuclei was analyzed from each
sample. The percentages of cells within the G1, S, and
G2/M phases of the cell cycle were determined as described
under "Experimental Procedures."
|
|
Identification of the Glucocorticoid Responsive Region of the p21
Promoter by Deletion Analysis--
Sequence analysis of the p21
promoter revealed no obvious canonical glucocorticoid response
elements. To determine which region within the p21 promoter is
responsible for the glucocorticoid-mediated transcriptional activation,
BDS1 hepatoma cells were transfected with a series of p21-CAT reporter
genes containing a series of 5 deletions starting at 2326 bp
upstream of the p21 gene and terminating at +55 within the p21 gene.
BDS1 cells were treated with or without 1 µM
dexamethasone for 48 h and cell lysates assayed for CAT activity.
As shown in Fig. 7, dexamethasone
stimulated transcriptional activity of p21-CAT constructs containing
the three largest p21 promoter regions with deletions ending at 2326, 1892, and 1481 bp. Maximum stimulation (2-5-fold) of p21-CAT activity by dexamethasone was observed with these constructs. Glucocorticoid inducibility of the p21 promoter was lost in deletions beyond 1184 bp which indicates that promoter sequences between nucleotides 1481 and 1184 of the p21 promoter is the glucocorticoid responsive region. The minor inductions observed with these more extensive deletions were not statistically significant or reproducible between experiments. In addition, the observed variation in basal level
of CAT activity was likely to due to the selective elimination of
functional transcription factor binding sites depending on the deletion
construct or the relative efficiency of transfection.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 7.
Deletion analysis of the p21 promoter defines
a 297-bp glucocorticoid responsive region. BDS1 hepatoma cells
were transiently transfected with a series of p21-CAT reporter plasmids
that contain the indicated 5 deletions of the p21 promoter. Cells were
treated with or without 1 µM dexamethasone for 48 h,
and the CAT specific activity determined as the CAT activity produced
per µg of protein present in the corresponding cell lysates (see
"Experimental Procedures"). The reported values are an average of
four independent experiments of triplicate samples, and the error
bars indicate the standard deviation.
|
|
The Glucocorticoid Responsive Region of the p21 Promoter Alone Can
Confer Responsiveness to Dexamethasone and Contains Multiple DNA
Elements That Are under Glucocorticoid Control--
To functionally
test if the 297-bp glucocorticoid responsive region defined by the
deletion analysis can confer dexamethasone responsiveness to a
heterologous promoter, the 1.481- and 1.184-bp fragment was linked
immediately upstream of the tk minimal promoter sequences driving the
bacterial CAT gene (1481/ 1184p21-tkCAT). BDS1 hepatoma cells
were transiently transfected with 1481/ 1184p21-tkCAT, and
CAT activity was monitored in cell extracts isolated from dexamethasone-treated and untreated cells. As shown in Fig.
8, dexamethasone induced CAT expression
by approximately 3-fold compared with hepatoma cells not treated with
dexamethasone. Reporter gene activity in cells transfected with the
minimal promoter ptkCAT alone was low and unaffected by dexamethasone
treatment (data not shown). These results establish that the
glucocorticoid responsive region of the p21 promoter in transfected
hepatoma cells is located between 1481-bp and 1184-bp upstream of
the RNA start site.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 8.
Characterization of multiple transcriptional
elements within the glucocorticoid responsive region of the p21
promoter. BDS1 hepatoma cells were transiently transfected with
the indicated p21-tkCAT reporter plasmids that contain specific
fragments of the p21 promoter. Cells were treated with or without 1 µM dexamethasone (Dex) for 48 h, and
the CAT specific activity was determined as the CAT activity produced
per µg of protein present in the corresponding cell lysates. The
reported values are representative of three independent experiments of
triplicate samples, and the error bars indicate the standard
deviation.
|
|
To define the minimum number of transcriptional elements under steroid
control within the glucocorticoid responsive region of the p21
promoter, smaller promoter fragments from within the 1481 to
1184-bp region were generated either through convenient restriction
site deletions, PCR cloning, or by oligonucleotide synthesis. These
promoter fragments were each cloned into the ptkCAT reporter plasmid
and transfected into BDS1 hepatoma cells. CAT activity was subsequently
measured in dexamethasone-treated and untreated cells. Initially, two
p21 promoter fragments ( 1481 to 1381 and 1383 to 1184) were
generated that constitute the entire 297-bp glucocorticoid responsive
region. Both reporter plasmids ( 1481/ 1381p21-tkCAT and
1383/ 1184p21-tkCAT) were glucocorticoid inducible to approximately
the same extent as the full 297-bp glucocorticoid responsive region
(Fig. 8). The 1481 to 1381 p21 promoter fragment on the 5 side of
the glucocorticoid responsive region was further subdivided into two
fragments ( 1481 to 1431 and 1441 to 1381), and the activity of
both corresponding reporter plasmids ( 1481/ 1431p21-tkCAT and
1441/ 1381p21-tkCAT) was also dexamethasone inducible in transfected
hepatoma cells (Fig. 8). These results indicate the existence of at
least two functioning elements within the 1481 to 1381-bp fragment
of the p21 promoter that are direct or indirect targets of the
glucocorticoid receptor signaling pathway which may account for the
dexamethasone induction of p21 transcripts in the absence de
novo protein synthesis.
The 1383 to 1184-bp fragment of the p21 promoter also appears to
contain two distinct transcriptional elements under glucocorticoid control. The following paper (82) demonstrates the functional requirement for the C/EBP transcription factor and its corresponding DNA-binding site at 1270 (see diagram in Fig. 8) in the
glucocorticoid stimulation of p21 gene expression. A second regulated
element in the 1383- to 1184-bp fragment of the p21 promoter was
identified by transfection of a CAT reporter plasmid containing
nucleotides 1383 to 1333 bp (forming 1383/ 1333p21-tkCAT). As
also shown in Fig. 8, 1383/ 1333p21-tkCAT was dexamethasone
inducible in transfected BDS1 cells indicating the presence of a
regulated element within this 50-bp promoter fragment. Some differences were observed in the transcriptional efficiency of each of the tested
p21 promoter fragments which was likely due to the presence or absence
of DNA sites for regulatory factors that modulate basal promoter
activity. Taken together, these results indicated the presence of at
least three distinct glucocorticoid responsive transcriptional elements
within the p21 promoter (see map in Fig. 8).
Ectopic Expression of p21 Facilitates the Glucocorticoid Growth
Suppression Response--
As a functional test for the potential role
of the p21 CDK inhibitor in the glucocorticoid growth suppression
response, BDS1 hepatoma cells were cotransfected with either a p21
expression vector or with a vector control and the neomycin resistance
expression vector, pBCMGneo. After selection of positively transfected
cells by propagation for 2 weeks in 400 µg/ml G418, equal numbers of cells were re-plated in the presence or absence of dexamethasone and
assayed for cell growth by a transient cell foci assay. The efficiency
of cell foci formation was determined by calculating the average
integrated density of cells observed in each condition. Consistent with
our previous results (48), treatment with dexamethasone caused a
significant reduction in the number of cell foci (Fig. 9). Transfection of the p21 expression
vector in the absence of steroid had no apparent effect on the number
of hepatoma cell foci. However, expression of p21 significantly reduced
the formation of cell foci observed in the presence of glucocorticoids
(Fig. 9). Thus, ectopic expression of p21 facilitates the ability of glucocorticoids to inhibit the proliferation of hepatoma cells and
suggests that transcriptional control of this CDK inhibitor plays a
role in the G1 cell cycle arrest but that its regulation is
not sufficient to mediate the overall growth suppression response.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 9.
Analysis of the effects of ectopic expression
of p21 on the glucocorticoid growth suppression of hepatoma cells by a
cell foci assay. BDS1 hepatoma cells were cotransfected with
either a p21 expression vector or with vector control DNA and with the pCNot which carries the neomycin resistance gene. Transfected cells
were cultured for 2 weeks in G418 and then approximately 104 cells were re-plated on 100-mm tissue culture dishes
and cultured for 2 weeks in the presence or absence of 1 µM dexamethasone (Dex) and G418. Cells were
then washed and stained with formalin/crystal violet to visualize the
cell foci (A). The foci area within each plate was
quantitated using NIH Image as described under "Experimental Procedures." The average integrated densities were determined and
illustrated graphically in B. Error bars reflect
the standard deviation of three independent integrated density
measurements.
|
|
 |
DISCUSSION |
Our results have established a direct mechanistic link between the
glucocorticoid receptor-mediated G1 cell cycle arrest of hepatoma cells and the regulated promoter activity of the p21 CDK
inhibitor gene. The stimulation of p21 promoter activity is a specific
glucocorticoid receptor response that accounts for the selective
increase in p21 gene expression and inhibition of CDK kinase activity
in rat hepatoma cells. This observation indicates that glucocorticoids
induce an early G1 block in cell cycle progression (14,
48), in part through the regulation of p21 gene expression. Although
the glucocorticoid responsive region of the p21 promoter does not
contain a canonical glucocorticoid response element, glucocorticoid
responsiveness can be conferred to a heterologous promoter by several
closely linked sub-regions of the p21 promoter. We propose that
glucocorticoids stimulate the p21 promoter through a combination of two
distinct transcriptional mechanisms involving direct glucocorticoid
receptor-protein interactions with pre-existing promoter-bound
transcription factors and indirect glucocorticoid-induced expression of
the C/EBP transcription factor that targets the p21 gene (see model
in Ref. 82). This complex regulation of p21 transcription in hepatoma
cells may reflect the fine tuning of p21 gene transcription that is
needed to respond to the multiple regulatory pathways that influence
the proliferation and differentiated functions of liver-derived cells
(52-54). Our results suggest that the cell type, environmental and
hormonal conditions, and the availability of particular sets of
tissue-specific transcriptional regulators and accessory factors
influence the precise region of the p21 promoter that is targeted by
the glucocorticoid receptor signaling pathway.
Fine mapping studies uncovered several distinct promoter fragments of
50-60 bp within the glucocorticoid responsive region that can confer
steroid responsiveness to a heterologous promoter in transfected
hepatoma cells. Consistent with our observation that dexamethasone can
induce the level of p21 transcripts in the absence of de
novo protein synthesis, each of these glucocorticoid response
fragments encodes putative consensus DNA-binding sites for
transcription factors that are members of gene families known to
interact directly or functionally with the glucocorticoid receptor. These transcription factors include Ets 2, PEA 3, and GATA1 and GATA2
(55-57). Although mutation of the Ets 2 site located at 1365 did not
abrogate the dexamethasone induction of the promoter fragment, the
mutation decreased the basal activity of the promoter
4-fold,2 which indicates that
the Ets 2 transcription factor may be involved in some aspect of the
glucocorticoid activation of the p21 promoter. For example, the
glucocorticoid receptor could interact with pre-existing factors on
this region of the promoter or recruit factors through protein-protein
interactions to activate transcription through assembly of a
transcriptionally competent complex. We are currently attempting to
define each of the transcriptional regulators and to characterize the
potential combinatorial effects between these transcription factors and
the glucocorticoid receptor that mediate the steroid stimulation of p21
promoter activity and the G1 cell cycle arrest of hepatoma
cells. Our results suggest that glucocorticoids control the cell cycle
in these growth-suppressed cells, in part, by multifactorial control of
p21 transcription.
Ectopic expression of p21 facilitated the glucocorticoid suppression of
cell foci formation in transfected hepatoma cells but had no apparent
anti-proliferative effect in the absence of added steroid. This result
suggests that the glucocorticoid regulation of p21 gene expression may
be important for the cell cycle arrest of hepatoma cells but that p21
alone may not be sufficient to cause the growth arrest. Conceivably,
other gene targets of the same glucocorticoid-regulated transcription
factors that control p21 gene expression may play an important role in
the cell cycle arrest. Our results are consistent with the correlation
of the negative regulation of CDK activity by p21 with the growth
arrest of many different types of tumorigenic cells (58-62).
Expression of p21 may be important to control the growth and
differentiation of certain tumors. For example, the tumor suppressor,
BRCA1, requires p21 expression to inhibit S phase progression in human
colon cancer cells (63). In addition, the level of p21 protein is
reduced in some primary melanomas (64) and is up-regulated during the growth arrest observed during p53-deficient murine
erythroleukemia cell differentiation (65).
An emerging concept from numerous studies is that a key cellular
strategy for regulation of cell cycle progression, DNA replication, and
p53-dependent apoptosis is to alter the expression of p21 (39, 40, 50). It is well established that the p53 tumor suppressor
protein stimulates transcription of p21 through functional p53 response
elements in the p21 promoter (40), which may mediate the anti-apoptotic
and anti-oncogenic actions of this tumor suppressor protein (40, 66,
67). Mice homozygously null for p21 develop normally, but the embryonic
fibroblasts of these mice were not able to arrest in G1 in
response to DNA damage, a cellular response mediated by p53 (66). Many
transformed cell lines that lack p53 also lack p21 in CDK complexes
(68), suggesting that the basal level expression of p21 depends upon
p53 function. In contrast, p21 gene expression can be regulated in a
p53-independent manner by a variety of regulators in normal and
transformed cells (35, 42, 46, 69, 70-74). Similarly, we found that
the p21 promoter from which the primary functional p53 DNA-binding site
had been deleted remained dexamethasone responsive in transfected
hepatoma cells, which demonstrated that the glucocorticoid stimulation of p21 promoter activity occurs in a p53-independent manner. In addition, the functionally defined glucocorticoid responsive region of
the promoter does not include p53-regulated elements.
Given the diversity of signaling pathways influencing p21 transcription
(75), control of p21 gene expression may represent a general cellular
strategy for regulating p21 function. Our results have firmly
established that one such cellular cascade is the glucocorticoid growth
suppression response in hepatoma cells. The stimulation of p21 gene
expression and promoter activity are relatively specific for this CDK
inhibitor because the level of the related p27 protein did not change
after dexamethasone treatment. Several other studies have shown the
potential involvement of p21 in the receptor-mediated steroid hormone
control of cell growth, implicating a transcriptional mechanism. For
example, the anti-estrogen (76) or anti-progestin (77) inhibition of
cell cycle progression was accompanied by an increase in p21 expression
in T47D human breast cancer cells. Moreover, in certain osteosarcoma
and fibroblast cell lines, glucocorticoids increased the level of p21
gene products (43, 44). In these studies, neither the mechanism of
transcriptional control nor the effects of ectopic expression of p21
were evaluated, although a nuclear run-on analysis using fibroblasts
showed that glucocorticoids stimulate the rate of transcription of the
p21 gene (44). Several reports have established that the p21 promoter is specifically regulated during cellular differentiation. For example,
Sp3 is involved in the induction of p21 promoter activity during
keratinocyte differentiation (78). Both vitamin D3 and retinoic acid,
which act through members of the steroid/thyroid hormone receptor
family, induce myeloid cell differentiation and directly stimulate p21
transcription through their corresponding DNA-binding sites in the p21
gene promoter (35, 36).
Numerous studies have shown that glucocorticoids regulate gene
expression, cellular function, and proliferation of normal and
transformed hepatic derived tissue (10, 14, 15, 17, 48, 79). Our study
suggests a role for p21 gene expression in the glucocorticoid-regulated
cell cycle control of liver epithelial tumor cells and has provided
further evidence for the existence of a steroid-regulated
G1 restriction point in these transformed cells.
Conceivably, members of the p21 CDK inhibitor gene family may also play
a key tumor suppression role in hepatic derived tissues (80) and during
normal liver development (81). We have uncovered a direct mechanistic
link between glucocorticoid receptor signaling and the transcriptional
control of the p21 CDK inhibitor gene. The following paper (82)
describes the functional relationship between the glucocorticoid
stimulation of p21 promoter activity and the C/EBP transcription
factor, which plays a key role in regulating the tissue-specific
functions of the liver (52). Our future efforts will focus on
determining the precise receptor-protein interactions and functional
role for the p21 promoter-bound factors controlling the steroid
responsiveness of this gene and the glucocorticoid-mediated cell cycle
arrest of hepatoma cells and perhaps other glucocorticoid-sensitive
tumor cells.
 |
ACKNOWLEDGEMENTS |
We thank Ross A. Ramos, Carolyn M. Cover,
Anita C. Maiyar, Patricia Buse, and Doug Finkbeiner for their critical
evaluation of this manuscript and experimental suggestions. We also
thank the other members of the Firestone Laboratory for their helpful comments throughout the duration of this work. We thank Wei-Ming Kao,
Peter Schow, Khanh Tong, Vinh Trinh, and Linda Yu for their technical
assistance. We are also grateful to Jerry Kapler for excellent
photography and Anna Fung for help in the preparation of this
manuscript.
 |
FOOTNOTES |
*
This work was supported by American Cancer Society Grant
RPG-90-001-08-BE.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Contributed equally to this work.
§
To whom correspondence and reprint requests should be addressed:
Dept. of Molecular and Cell Biology, 591 LSA, University of California,
Berkeley, CA 94720. Tel.: 510-642-8319; Fax: 510-643-6791; E-mail:
glfire{at}uclink4.berkeley.edu.
1
The abbreviations used are: CDK,
cyclin-dependent kinase; TGF- , transforming growth
factor- ; C/EBP- , CCAAT/enhancer binding protein-h, Rb,
retinoblastoma protein; GRE, glucocorticoid response element; CAT,
chloramphenicol acetyltransferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NFDM, non-fat dry milk; PBS, phosphate-buffered saline;
GR glucocorticoid receptor; tk, thymidine kinase; bp, base pair; kb,
kilobase pair; HRP, horseradish peroxidase; PCR, polymerase chain
reaction; Tricine, N-[2-hydroxy-1,1-bis
(hydroxymethyl)ethyl]glycine.
2
E. C. Wang, E. J. Cram, and G. L. Firestone, unpublished results.
 |
REFERENCES |
-
Wahli, W.,
and Martinez, E.
(1991)
FASEB J.
5,
2243-2249[Abstract]
-
Gronemeyer, H.
(1992)
FASEB J.
6,
2524-2529[Abstract]
-
Bamberger, C. M.,
Schulte, H. M.,
and Chrousos, G. P.
(1996)
Endocr. Rev.
17,
245-261[Abstract/Free Full Text]
-
Tsai, M. J.,
and O'Malley, B. W.
(1994)
Annu. Rev. Biochem.
63,
451-486[CrossRef][Medline]
[Order article via Infotrieve]
-
Truss, M.,
and Beato, M.
(1993)
Endocr. Rev.
14,
459-479[Abstract/Free Full Text]
-
Zilliacus, J.,
Wright, A. P.,
Carlstedt, D. J.,
Gustafsson, J. A.
(1995)
Mol. Endocrinol.
9,
389-400[Free Full Text]
-
Parker, M. G.
(1993)
Curr. Opin. Cell Biol.
5,
499-504[CrossRef][Medline]
[Order article via Infotrieve]
-
Beato, M.,
and Sanchez, P. A.
(1996)
Endocr. Rev.
17,
587-609[Abstract/Free Full Text]
-
McEwan, I. J.,
Wright, A. P.,
and Gustafsson, J. A.
(1997)
BioEssays
19,
153-160[CrossRef][Medline]
[Order article via Infotrieve]
-
Nishio, Y.,
Isshiki, H.,
Kishimoto, T.,
and Akira, S.
(1993)
Mol. Cell. Biol.
13,
1854-1862[Abstract/Free Full Text]
-
Cook, P. W.,
Weintraub, W. H.,
Swanson, K. T.,
Machen, T. E.,
Firestone, G. L.
(1988)
J. Biol. Chem.
263,
19296-19302[Abstract/Free Full Text]
-
Cook, P. W.,
Swanson, K. T.,
Edwards, C. P.,
Firestone, G. L.
(1988)
Mol. Cell. Biol.
8,
1449-1459[Abstract/Free Full Text]
-
Goya, L.,
Edwards, C. P.,
Glennemeier, K. A.,
Firestone, G. L.
(1991)
Cancer Lett.
58,
211-219[CrossRef][Medline]
[Order article via Infotrieve]
-
Sanchez, I.,
Goya, L.,
Vallerga, A. K.,
Firestone, G. L.
(1993)
Cell Growth Differ.
4,
215-225[Abstract]
-
Huang, D. P.,
Schwartz, C. E.,
Chiu, J. F.,
Cook, J. R.
(1984)
Cancer Res.
44,
2976-2980[Abstract/Free Full Text]
-
Castellano, T. J.,
Schiffman, R. L.,
Jacob, M. C.,
Loeb, J. N.
(1978)
Endocrinology
102,
1107-1112[Abstract/Free Full Text]
-
Henderson, I. C.,
and Loeb, J. N.
(1974)
Endocrinology
94,
1637-1643[Abstract/Free Full Text]
-
Firestone, G. L.,
Maiyar, A. C.,
and Ramos, R. A.
(1995)
in
Hormones and Aging (Timiras, P. S., Quay, W. B., and Vernadakis, F. L., eds), pp. 325-359, CRC Press, Inc., Boca Raton, FL
-
Draetta, G. F.
(1994)
Curr. Opin. Cell Biol.
6,
842-846[CrossRef][Medline]
[Order article via Infotrieve]
-
Hunter, T.,
and Pines, J.
(1994)
Cell
79,
573-582[CrossRef][Medline]
[Order article via Infotrieve]
-
Sherr, C. J.
(1996)
Science
274,
1672-1677[Abstract/Free Full Text]
-
Stillman, B.
(1996)
Science
274,
1659-1664[Abstract/Free Full Text]
-
Morgan, D. O.
(1995)
Nature
374,
131-134[CrossRef][Medline]
[Order article via Infotrieve]
-
Pines, J.
(1993)
Trends Biochem. Sci.
18,
195-197[CrossRef][Medline]
[Order article via Infotrieve]
-
Russo, A. A.,
Jeffrey, P. D.,
and Pavletich, N. P.
(1996)
Nat. Struct. Biol.
3,
696-700[CrossRef][Medline]
[Order article via Infotrieve]
-
Harper, J. W.,
and Elledge, S. J.
(1996)
Curr. Opin. Genet. & Dev.
6,
56-64[CrossRef][Medline]
[Order article via Infotrieve]
-
Sherr, C. J.,
and Roberts, J. M.
(1995)
Genes Dev.
9,
1149-1163[Free Full Text]
-
Harper, J. W.,
Adami, G. R.,
Wei, N.,
Keyomarsi, K.,
and Elledge, S. J.
(1993)
Cell
75,
805-816[CrossRef][Medline]
[Order article via Infotrieve]
-
Xiong, Y.,
Hannon, G. J.,
Zhang, H.,
Casso, D.,
Kobayashi, R.,
and Beach, D.
(1993)
Nature
366,
701-704[CrossRef][Medline]
[Order article via Infotrieve]
-
Qin, X. Q.,
Livingston, D. M.,
Ewen, M.,
Sellers, W. R.,
Arany, Z.,
Kaelin, W. J.
(1995)
Mol. Cell. Biol.
15,
742-755[Abstract]
-
Weinberg, R. A.
(1995)
Cell
81,
323-330[CrossRef][Medline]
[Order article via Infotrieve]
-
Slansky, J. E.,
and Farnham, P. J.
(1996)
Curr. Top. Microbiol. Immunol.
208,
1-30[Medline]
[Order article via Infotrieve]
-
Aprelikova, O.,
Xiong, Y.,
and Liu, E. T.
(1995)
J. Biol. Chem.
270,
18195-18197[Abstract/Free Full Text]
-
Harper, J. W.,
and Elledge, S. J.
(1996)
Curr. Opin. Genet. & Dev.
6,
56-64
-
Liu, M.,
Lee, M. H.,
Cohen, M.,
Bommakanti, M.,
and Freedman, L. P.
(1996)
Genes Dev.
10,
142-153[Abstract/Free Full Text]
-
Liu, M.,
Iavarone, A.,
and Freedman, L. P.
(1996)
J. Biol. Chem.
271,
31723-31728[Abstract/Free Full Text]
-
Zeng, Y. X.,
Somasundaram, K.,
and El-Diery, W. S.
(1997)
Nat. Genet.
15,
78-82[CrossRef][Medline]
[Order article via Infotrieve]
-
Prabhu, S.,
Ignatova, A.,
Park, S. T.,
Sun, X.-H.
(1997)
Mol. Cell. Biol.
17,
5888-5896[Abstract]
-
El-Diery, W. S.,
Harper, J. W.,
O'Connor, P. M.,
Velculescu, V. E.,
Canman, C. E.,
Jackman, J.,
Pietenpol, J. A.,
Burrell, M.,
Hill, D. E.,
Wang, Y.,
Wiman, K. G.,
Mercer, W. E.,
Kastan, M. B.,
Kohn, K. W.,
Elledge, S. J.,
Kinzler, K. W.,
Vogelstein, B.
(1994)
Cancer Res.
54,
1169-1174[Abstract/Free Full Text]
-
El-Diery, W. S.,
Tokino, T.,
Velculescu, V. E.,
Levy, D. B.,
Parsons, R.,
Trent, J. M.,
Lin, D.,
Mercer, W. E.,
Kinzler, K. W.,
Vogelstein, B.
(1993)
Cell
75,
817-825[CrossRef][Medline]
[Order article via Infotrieve]
-
El-Diery, W. S.,
Tokino, T.,
Waldman, T.,
Oliner, J. D.,
Velculescu, V. E.,
Burrell, M.,
Hill, D. E.,
Healy, E.,
Rees, J. L.,
Hamilton, S. R.,
Kinzler, K. W.,
Vogelstein, B.
(1995)
Cancer Res.
55,
2910-2919[Abstract/Free Full Text]
-
Michieli, P.,
Chedid, M.,
Lin, D.,
Pierce, J. H.,
Mercer, W. E.,
Givol, D.
(1994)
Cancer Res.
54,
3391-3395[Abstract/Free Full Text]
-
Rogatsky, I.,
Trowbridge, J. M.,
and Garabedian, M. J.
(1997)
Mol. Cell. Biol.
17,
3181-3193[Abstract]
-
Ramalingam, A.,
Hirai, A.,
and Thompson, E. A.
(1997)
Mol. Endocrinol.
11,
577-586[Abstract/Free Full Text]
-
Sewing, A.,
Wiseman, B.,
Lloyd, A. C.,
Land, H.
(1997)
Mol. Cell. Biol.
17,
5588-5597[Abstract]
-
Woods, D.,
Parry, D.,
Cherwinski, H.,
Bosch, E.,
Lees, E.,
and McMahon, M.
(1997)
Mol. Cell. Biol.
17,
5598-5611[Abstract]
-
Wu, H.,
Wade, M.,
Krall, L.,
Grisham, J.,
Xiong, Y.,
and Van, D. T.
(1996)
Genes Dev.
10,
245-260[Abstract/Free Full Text]
-
Ramos, R. A.,
Nishio, Y.,
Maiyar, A. C.,
Simon, K. E.,
Ridder, C. C.,
Ge, Y.,
Firestone, G. L.
(1996)
Mol. Cell. Biol.
16,
5288-5301[Abstract]
-
Neumann, J. R.,
Morency, C. A.,
and Russian, K. O.
(1987)
BioTechniques
5,
444-448
-
Hinds, P. W.,
and Weinberg, R. A.
(1994)
Curr. Opin. Genet. & Dev.
4,
135-141[CrossRef][Medline]
[Order article via Infotrieve]
-
Maiyar, A. C.,
Phu, P. T.,
Huang, A. J.,
Firestone, G. L.
(1997)
Mol. Endocrinol.
11,
312-329[Abstract/Free Full Text]
-
Flodby, P.,
Barlow, C.,
Kylefjord, H.,
Ahrlund-Richter, L.,
and Xanthopoulos, K. G.
(1996)
J. Biol. Chem.
271,
24753-24760[Abstract/Free Full Text]
-
Taub, R.
(1996)
FASEB J.
10,
413-427[Abstract]
-
Cereghini, S.
(1996)
FASEB J.
10,
267-282[Abstract]
-
Espinas, M. L.,
Roux, J.,
Ghysdael, J.,
Pictet, R.,
and Grange, T.
(1994)
Mol. Cell. Biol.
14,
4116-4125[Abstract/Free Full Text]
-
Chang, T. J.,
Scher, B. M.,
Waxman, S.,
and Scher, W.
(1993)
Mol. Endocrinol.
7,
528-542[Abstract/Free Full Text]
-
Pajovic, S.,
Jones, V. E.,
Prowse, K. R.,
Berger, F. G.,
Baumann, H.
(1994)
J. Biol. Chem.
269,
2215-2224[Abstract/Free Full Text]
-
Schnier, J. B.,
Nishi, K.,
Goodrich, D. W.,
Bradbury, E. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
5941-5946[Abstract/Free Full Text]
-
Gorospe, M.,
and Holbrook, N. J.
(1996)
Cancer Res.
56,
475-479[Abstract/Free Full Text]
-
Gorospe, M.,
Wang, X.,
Guyton, K. Z.,
Holbrook, N. J.
(1996)
Mol. Cell. Biol.
16,
6654-6660[Abstract]
-
Datto, M. B.,
Li, Y.,
Panus, J. F.,
Howe, D. J.,
Xiong, Y.,
Wang, X. F.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5545-5549[Abstract/Free Full Text]
-
Fan, Z.,
Lu, Y.,
Wu, X.,
DeBlasio, A.,
Koff, A.,
and Mendelsohn, J.
(1995)
J. Cell Biol.
131,
235-242[Abstract/Free Full Text]
-
Somasundaram, K.,
Zhang, H.,
Zeng, Y. X.,
Houvras, Y.,
Peng, Y.,
Zhang, H.,
Wu, G. S.,
Licht, J. D.,
Weber, B. L.,
El-Diery, W. S.
(1997)
Nature
389,
187-190[CrossRef][Medline]
[Order article via Infotrieve]
-
Maelandsmo, G. M.,
Holm, R.,
Fodstad, O.,
Kerbel, R. S.,
Florenes, V. A.
(1996)
Am. J. Pathol.
149,
1813-1822[Abstract]
-
Macleod, K. F.,
Sherry, N.,
Hannon, G.,
Beach, D.,
Tokino, T.,
Kinzler, K.,
Vogelstein, B.,
and Jacks, T.
(1995)
Genes Dev.
9,
935-944[Abstract/Free Full Text]
-
Deng, C.,
Zhang, P.,
Harper, J. W.,
Elledge, S. J.,
Leder, P.
(1995)
Cell
82,
675-684[CrossRef][Medline]
[Order article via Infotrieve]
-
Waldman, T.,
Kinzler, K. W.,
and Vogelstein, B.
(1995)
Cancer Res.
55,
5187-5190[Abstract/Free Full Text]
-
Elledge, S. J.,
and Harper, J. W.
(1994)
Curr. Opin. Cell Biol.
6,
847-852[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, X. S.,
Rishi, A. K.,
Shao, Z. M.,
Dawson, M. I.,
Jong, L.,
Shroot, B.,
Reichert, U.,
Ordonez, J.,
Fontana, J. A.
(1996)
Cancer Res.
56,
5055-5062[Abstract/Free Full Text]
-
Elbendary, A.,
Berchuck, A.,
Davis, P.,
Havrilesky, L.,
Bast, R. J.,
Iglehart, J. D.,
Marks, J. R.
(1994)
Cell Growth Differ.
5,
1301-1307[Abstract]
-
Akashi, M.,
Hachiya, M.,
Osawa, Y.,
Spirin, K.,
Suzuki, G.,
and Koeffler, H. P.
(1995)
J. Biol. Chem.
270,
19181-19187[Abstract/Free Full Text]
-
Alpan, R. S.,
and Pardee, A. B.
(1996)
Cell Growth Differ.
7,
893-901[Abstract]
-
Fuse, T.,
Yamada, K.,
Asai, K.,
Kato, T.,
and Nakanishi, M.
(1996)
Biochem. Biophys. Res. Commun.
225,
759-763[CrossRef][Medline]
[Order article via Infotrieve]
-
Sheikh, M. S.,
Li, X. S.,
Chen, J. C.,
Shao, Z. M.,
Ordonez, J. V.,
Fontana, J. A.
(1994)
Oncogene
9,
3407-3415[Medline]
[Order article via Infotrieve]
-
Gartel, A. L.,
Serfas, M. S.,
and Tyner, A. L.
(1996)
Proc. Soc. Exp. Biol. Med.
213,
138-149[CrossRef][Medline]
[Order article via Infotrieve]
-
Watts, C. K.,
Brady, A.,
Sarcevic, B.,
De Fazio, A.,
Musgrove, E. A.,
Sutherland, R. L.
(1995)
Mol. Endocrinol.
9,
1804-1813[Abstract/Free Full Text]
-
Musgrove, E. A.,
Lee, C. S.,
Cornish, A. L.,
Swarbrick, A.,
Sutherland, R. L.
(1997)
Mol. Endocrinol.
11,
54-66[Abstract/Free Full Text]
-
Prowse, D. M.,
Bolgan, L.,
Molnar, A.,
and Dotto, G. P.
(1997)
J. Biol. Chem.
272,
1308-1314[Abstract/Free Full Text]
-
Koike, T.,
and Shiojiri, N.
(1996)
Differentiation
61,
35-43[CrossRef][Medline]
[Order article via Infotrieve]
-
Fredersdorf, S.,
Milne, A. W.,
Hall, P. A.,
Lu, X.
(1996)
Am. J. Pathol.
148,
825-835[Abstract]
-
Wu, H.,
Wade, M.,
Krall, L.,
Grisham, J.,
Xiong, Y.,
and Van, D. T.
(1996)
Genes Dev.
10,
245-260
-
Cram, E. J.,
Ramos, R. A.,
Wang, E. C.,
Cha, H. H.,
Nishio, Y.,
Firestone, G. L.
(1998)
J. Biol. Chem.
273,
2008-2014[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Ito, C. Herbert, J. S. Siegle, C. Vuppusetty, N. Hansbro, P. S. Thomas, P. S. Foster, P. J. Barnes, and R. K. Kumar
Steroid-Resistant Neutrophilic Inflammation in a Mouse Model of an Acute Exacerbation of Asthma
Am. J. Respir. Cell Mol. Biol.,
November 1, 2008;
39(5):
543 - 550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. C. Owen, S. J. Roberts, S. F. Ahmed, and C. Farquharson
Dexamethasone-induced expression of the glucocorticoid response gene lipocalin 2 in chondrocytes
Am J Physiol Endocrinol Metab,
June 1, 2008;
294(6):
E1023 - E1034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Bird, K. H. Tan, P. F. Olsson, M. Zieba, S. J. Flecknoe, D. R. Liddicoat, R. Mollard, S. B. Hooper, and T. J. Cole
Identification of glucocorticoid-regulated genes that control cell proliferation during murine respiratory development
J. Physiol.,
November 15, 2007;
585(1):
187 - 201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Harms, K. Albrecht, U. Harms, K. Seidel, L. Hauck, T. Baldinger, D. Hubner, G. Kronenberg, J. An, K. Ruscher, et al.
Phosphatidylinositol 3-Akt-Kinase-Dependent Phosphorylation of p21Waf1/Cip1 as a Novel Mechanism of Neuroprotection by Glucocorticoids
J. Neurosci.,
April 25, 2007;
27(17):
4562 - 4571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-G. Bladh, J. Liden, A. Pazirandeh, I. Rafter, K. Dahlman-Wright, S. Nilsson, and S. Okret
Identification of Target Genes Involved in the Antiproliferative Effect of Glucocorticoids Reveals a Role for Nuclear Factor-{kappa}B Repression
Mol. Endocrinol.,
March 1, 2005;
19(3):
632 - 643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Roth, P. R.A. Johnson, P. Borger, M. P. Bihl, J. J. Rudiger, G. G. King, Q. Ge, K. Hostettler, J. K. Burgess, J. L. Black, et al.
Dysfunctional Interaction of C/EBP{alpha} and the Glucocorticoid Receptor in Asthmatic Bronchial Smooth-Muscle Cells
N. Engl. J. Med.,
August 5, 2004;
351(6):
560 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Schrem, J. Klempnauer, and J. Borlak
Liver-Enriched Transcription Factors in Liver Function and Development. Part II: the C/EBPs and D Site-Binding Protein in Cell Cycle Control, Carcinogenesis, Circadian Gene Regulation, Liver Regeneration, Apoptosis, and Liver-Specific Gene Regulation
Pharmacol. Rev.,
June 1, 2004;
56(2):
291 - 330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Trotter and T. K. Archer
Reconstitution of Glucocorticoid Receptor-Dependent Transcription In Vivo
Mol. Cell. Biol.,
April 15, 2004;
24(8):
3347 - 3358.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Barzon, M. Boscaro, and G. Palu
Endocrine Aspects of Cancer Gene Therapy
Endocr. Rev.,
February 1, 2004;
25(1):
1 - 44.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. N. Cassel and M. Nord
C/EBP transcription factors in the lung epithelium
Am J Physiol Lung Cell Mol Physiol,
October 1, 2003;
285(4):
L773 - L781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Urban, T. Golden, I. V. Aragon, L. Cowsert, S. R. Cooper, N. M. Dean, and R. E. Honkanen
Identification of a Functional Link for the p53 Tumor Suppressor Protein in Dexamethasone-induced Growth Suppression
J. Biol. Chem.,
March 7, 2003;
278(11):
9747 - 9753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Fingerle-Rowson, P. Koch, R. Bikoff, X. Lin, C. N. Metz, F. S. Dhabhar, A. Meinhardt, and R. Bucala
Regulation of Macrophage Migration Inhibitory Factor Expression by Glucocorticoids in Vivo
Am. J. Pathol.,
January 1, 2003;
162(1):
47 - 56.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Lasa, S. M. Abraham, C. Boucheron, J. Saklatvala, and A. R. Clark
Dexamethasone Causes Sustained Expression of Mitogen-Activated Protein Kinase (MAPK) Phosphatase 1 and Phosphatase-Mediated Inhibition of MAPK p38
Mol. Cell. Biol.,
November 15, 2002;
22(22):
7802 - 7811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ma and N. Hernandez
Redundant Cooperative Interactions for Assembly of a Human U6 Transcription Initiation Complex
Mol. Cell. Biol.,
November 15, 2002;
22(22):
8067 - 8078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Greenberg, J. Hu, S. Basu, J. Hay, J. Reibman, T.-a. Yie, K. M. Tchou-Wong, W. N. Rom, and T. C. Lee
Glucocorticoids Inhibit Lung Cancer Cell Growth through Both the Extracellular Signal-Related Kinase Pathway and Cell Cycle Regulators
Am. J. Respir. Cell Mol. Biol.,
September 1, 2002;
27(3):
320 - 328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. CROCHEMORE, T. M. MICHAELIDIS, D. FISCHER, J.-P. LOEFFLER, and O. F. X. ALMEIDA
Enhancement of p53 activity and inhibition of neural cell proliferation by glucocorticoid receptor activation
FASEB J,
June 1, 2002;
16(8):
761 - 770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Stockand
New ideas about aldosterone signaling in epithelia
Am J Physiol Renal Physiol,
April 1, 2002;
282(4):
F559 - F576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. RUDIGER, M. ROTH, M. P. BIHL, B. C. CORNELIUS, M. JOHNSON, R. ZIESCHE, and L.-H. BLOCK
Interaction of C/EBP{alpha} and the glucocorticoid receptor in vivo and in nontransformed human cells
FASEB J,
February 1, 2002;
16(2):
177 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Li, M. Zhang, S. Kumar, L.-J. Zhu, D. Chen, M. K. Bagchi, and I. C. Bagchi
Identification and Implantation Stage-Specific Expression of an Interferon-{{alpha}}-Regulated Gene in Human and Rat Endometrium
Endocrinology,
June 1, 2001;
142(6):
2390 - 2400.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-Y. LIU, T.-Y. HAN, A. E. GIULIANO, and M. C. CABOT
Ceramide glycosylation potentiates cellular multidrug resistance
FASEB J,
March 1, 2001;
15(3):
719 - 730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Zahnow, R. D. Cardiff, R. Laucirica, D. Medina, and J. M. Rosen
A Role for CCAAT/Enhancer Binding Protein {beta}-Liver-enriched Inhibitory Protein in Mammary Epithelial Cell Proliferation
Cancer Res.,
January 1, 2001;
61(1):
261 - 269.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. A. Slomiany, K. L. D'Arigo, M. M. Kelly, and D. T. Kurtz
C/EBPalpha Inhibits Cell Growth via Direct Repression of E2F-DP-Mediated Transcription
Mol. Cell. Biol.,
August 15, 2000;
20(16):
5986 - 5997.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Radoja, M. Komine, S. H. Jho, M. Blumenberg, and M. Tomic-Canic
Novel Mechanism of Steroid Action in Skin through Glucocorticoid Receptor Monomers
Mol. Cell. Biol.,
June 15, 2000;
20(12):
4328 - 4339.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. K. R. Samuelsson, A. Pazirandeh, B. Davani, and S. Okret
p57Kip2, a Glucocorticoid-Induced Inhibitor of Cell Cycle Progression in HeLa Cells
Mol. Endocrinol.,
November 1, 1999;
13(11):
1811 - 1822.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Quaroni, J. Q. Tian, M. Goke, and D. K. Podolsky
Glucocorticoids have pleiotropic effects on small intestinal crypt cells
Am J Physiol Gastrointest Liver Physiol,
November 1, 1999;
277(5):
G1027 - G1040.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kim and H. Baumann
Dual Signaling Role of the Protein Tyrosine Phosphatase SHP-2 in Regulating Expression of Acute-Phase Plasma Proteins by Interleukin-6 Cytokine Receptors in Hepatic Cells
Mol. Cell. Biol.,
August 1, 1999;
19(8):
5326 - 5338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Rogatsky, A. B. Hittelman, D. Pearce, and M. J. Garabedian
Distinct Glucocorticoid Receptor Transcriptional Regulatory Surfaces Mediate the Cytotoxic and Cytostatic Effects of Glucocorticoids
Mol. Cell. Biol.,
July 1, 1999;
19(7):
5036 - 5049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sakai, T. Biwa, T. Matsumura, T. Takemura, H. Matsuda, Y. Anami, T. Sasahara, S. Kobori, and M. Shichiri
Glucocorticoid Inhibits Oxidized LDL-Induced Macrophage Growth by Suppressing the Expression of Granulocyte/Macrophage Colony-Stimulating Factor
Arterioscler. Thromb. Vasc. Biol.,
July 1, 1999;
19(7):
1726 - 1733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Lange, J. K. Richer, and K. B. Horwitz
Hypothesis: Progesterone Primes Breast Cancer Cells for Cross-Talk with Proliferative or Antiproliferative Signals
Mol. Endocrinol.,
June 1, 1999;
13(6):
829 - 836.
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Tian, J. A C Philp, and M. J Shipston
Glucocorticoid block of protein kinase C signalling in mouse pituitary corticotroph AtT20 D16:16 cells
J. Physiol.,
May 1, 1999;
516(3):
757 - 768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Y. Rots, A. Iavarone, V. Bromleigh, and L. P. Freedman
Induced Differentiation of U937 Cells by 1,25-dihydroxyvitamin D3 Involves Cell Cycle Arrest in G1 That Is Preceded by a Transient Proliferative Burst and an Increase in Cyclin Expression
Blood,
April 15, 1999;
93(8):
2721 - 2729.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Timchenko, M. Wilde, and G. J. Darlington
C/EBPalpha Regulates Formation of S-Phase-Specific E2F-p107 Complexes in Livers of Newborn Mice
Mol. Cell. Biol.,
April 1, 1999;
19(4):
2936 - 2945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Eickelberg, M. Roth, R. Lorx, V. Bruce, J. Rudiger, M. Johnson, and L.-H. Block
Ligand-independent Activation of the Glucocorticoid Receptor by beta 2-Adrenergic Receptor Agonists in Primary Human Lung Fibroblasts and Vascular Smooth Muscle Cells
J. Biol. Chem.,
January 8, 1999;
274(2):
1005 - 1010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Rogatsky, C. L. M. Waase, and M. J. Garabedian
Phosphorylation and Inhibition of Rat Glucocorticoid Receptor Transcriptional Activation by Glycogen Synthase Kinase-3 (GSK-3). SPECIES-SPECIFIC DIFFERENCES BETWEEN HUMAN AND RAT GLUCOCORTICOID RECEPTOR SIGNALING AS REVEALED THROUGH GSK-3 PHOSPHORYLATION
J. Biol. Chem.,
June 5, 1998;
273(23):
14315 - 14321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Cram, R. A. Ramos, E. C. Wang, H. H. Cha, Y. Nishio, and G. L. Firestone
Role of the CCAAT/Enhancer Binding Protein-alpha Transcription Factor in the Glucocorticoid Stimulation of p21waf1/cip1 Gene Promoter Activity in Growth-arrested Rat Hepatoma Cells
J. Biol. Chem.,
January 23, 1998;
273(4):
2008 - 2014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Smith, R. A. Redman, C. R. Logg, G. A. Coetzee, N. Kasahara, and B. Frenkel
Glucocorticoids Inhibit Developmental Stage-specific Osteoblast Cell Cycle. DISSOCIATION OF CYCLIN A-CYCLIN-DEPENDENT KINASE 2 FROM E2F4-p130 COMPLEXES
J. Biol. Chem.,
June 23, 2000;
275(26):
19992 - 20001.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hernandez
Small Nuclear RNA Genes: a Model System to Study Fundamental Mechanisms of Transcription
J. Biol. Chem.,
July 13, 2001;
276(29):
26733 - 26736.
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|