|
|
|
|||||||
|
|||||||||
From the Divisions of Na+/H+ exchangers
(NHEs) mediate electroneutral exchange of Na+ for
H+ and thereby play a central role in pH regulation and
Na+ homeostasis. NHE3, the predominant epithelial isoform,
is found in apical membranes of renal and intestinal epithelial cells, where it contributes to NaCl (re)absorption. NHE activity has been
detected in endomembrane vesicles of epithelial cells, but the precise
compartment involved and its functional role have not been defined.
Many aspects of the targeting machinery that defines the
compartmentation and polarity of epithelia are also functional in
nonepithelial cells. We therefore compared the targeting of NHE1, the
basolateral isoform, with that of NHE3 in Chinese hamster ovary cells.
To circumvent the confounding effects of endogenous exchangers,
epitope-tagged constructs of NHE1 and NHE3 were stably expressed in
antiport-deficient (AP-1) cells. While NHE1 was found almost
exclusively in the surface membrane, NHE3 was also found
intracellularly, accumulating in a juxtanuclear compartment. Confocal
microscopy showed this compartment to be distinct from the Golgi,
trans-Golgi network, and lysosomes. Instead, NHE3
colocalized with transferrin receptors and with cellubrevin, markers of
recycling endosomes. The activity of NHE3 in endomembranes was assessed
by targeting pH-sensitive probes to the recycling endosomes using a
chimeric cellubrevin construct with an accessible extracellular
epitope. Fluorescence ratio imaging indicated that cellubrevin resides
intracellularly in an acidic compartment. In AP-1 cells,
endosomal acidification was unaffected by omission of Na+
but was dissipated entirely by concanamycin, a blocker of
H+-ATPases. In contrast, the cellubrevin compartment was
more acidic in NHE3 transfectants, and the acidification was only
partially reduced by concanamycin. Moreover, removal of extracellular
Na+ resulted in a significant alkalization of the endocytic
compartment. These results indicate that NHE3 is present and
active in recycling endosomes. By recruiting NHE3 to the plasma
membrane, modulation of vesicular traffic could contribute to the
regulation of Na+ reabsorption across epithelia.
To maintain the intracellular pH near neutrality, most mammalian
cells actively extrude H+ in exchange for extracellular
Na+, a process mediated by the
Na+/H+ exchanger
(NHE)1 or antiporter.
Exchange of Na+ for H+ across the plasma
membrane is a tightly coupled, electroneutral process that is generally
sensitive to inhibition by amiloride and benzoyl guanidinium
compounds. NHEs are integral membrane phospho(glyco)proteins with
10-12 predicted transmembrane domains and a sizable carboxyl-terminal
hydrophilic domain Ca2+ believed to face the cytoplasm (1,
2). Six members of the NHE family have been identified to date. NHE1,
thought to be the "housekeeping" isoform, is found on the plasma
membranes of virtually all animal cells, including the basolateral
membrane of epithelial cells, where it is believed to control cytosolic
pH (pHc) and to play a role in cell volume regulation (3).
NHE2, -3, -4, and -5 display a more restricted tissue distribution,
probably reflecting specialized functions, whereas NHE6 is expressed in all tissues examined to date. NHE3 is the best characterized of these
isoforms; it is predominantly expressed in kidney and gut, where it is
found on the apical membranes of polarized epithelial cells. This
isoform is thought to play a central role in transepithelial reabsorption of Na+.
NHE activity has been described in endosomes of the renal cortex, where
it was postulated to play a potential role in the maintenance of
endosomal pH (4, 5). While the early studies of renal subcellular
fractions did not identify the isoform detected functionally, they
demonstrated that the endosomal NHE was poorly sensitive to amiloride
(4, 5). Independent pharmacological studies have revealed that, of the
isoforms known to date, NHE3 is the least sensitive to pharmacological
antagonists (1, 3, 6), suggesting that this is the antiporter present
in renal endosomes. This assumption was recently substantiated by
immunolocalization studies using antibodies to NHE3, where this isoform
was detected not only on the brush border membrane of renal cells, but
also in intracellular vesicles (7).
Distinct apical and basolateral early endosomes have been described in
epithelial cells, but there is mounting controversy as to whether
specialized apical and basolateral recycling endosomes exist or whether
they are interconnected in a larger endosomal network (8-11). This
controversy stems, at least in part, from the lack of unique markers
for apical endosomes, which have been poorly characterized. This
contrasts with the extensive biochemical and morphological knowledge of
endosomes in nonpolarized cells, where sorting, recycling, and late
endosomes have been studied in detail (for reviews, see Refs. 12-14).
It has become apparent that, like epithelial cells, nonpolarized cells
also possess the targeting machinery to segregate apical and
basolateral proteins to distinct microdomains within the cell (15, 16).
When endotubulin, a protein found in apical endosomes of intestinal
cells, was expressed heterologously in fibroblasts, it was found to
distribute to a subpopulation of early endosomes, which are likely
analogous to apical endosomes (11). This suggests that nonpolarized
cells can be used as a simplified model system to study the targeting of epithelial proteins suspected of entering apical endosomes.
The purpose of the present experiments was to define the properties and
subcellular targeting of NHE3 using heterologous expression in
nonepithelial cells. For comparison, cells were also transfected with
NHE1, which is predominantly targeted to the basolateral membranes of
epithelial cells (1). To study the activity of the heterologously
transfected exchangers in isolation, we used cells that were deficient
in endogenous NHE activity (for details, see Refs. 17 and 18). We found
that, unlike NHE1, which is largely plasmalemmal, NHE3 concentrates in
an endomembrane compartment. The nature of this compartment and the
functionality of NHE3 therein were assessed using confocal
microscopy and fluorescence ratio imaging.
Reagents--
The acetoxymethyl ester of BCECF-, FITC-, or
TRITC-labeled transferrin (Tfn) and FITC-labeled dextran were purchased
from Molecular Probes, Inc. (Eugene, OR). Horseradish
peroxidase-conjugated goat anti-mouse Ab, Cy3-, and FITC-labeled donkey
anti-rabbit and anti-mouse Ab were obtained from Jackson Laboratories,
Inc. (West Grove, PA). FITC-labeled anti-T-cell antigen (CD25) Ab was from Serotec. FITC-labeled goat anti-human F(ab) fragments and mouse
monoclonal anti-HA Ab were bought from Cappel (Durham, NC) and BabCo
(Berkeley, CA), respectively. Rabbit polyclonal Ab to DNA Constructs--
Complementary DNA fragments of the
full-length rat NHE1 and NHE3, previously engineered to contain a
series of unique restriction sites (to facilitate mutagenic
manipulations), were subcloned into a modified eukaryotic expression
vector, pCMV (for construction details, see Ref. 19). One copy of an
influenza virus hemagglutinin (HA) peptide (YPYDVPDYA) was appended to
the carboxycytoplasmic tail of each protein by polymerase chain
reaction methodologies (called pNHE1-HA and pNHE3-HA; Fig.
1A). In addition, a NotI-NotI DNA
fragment containing three tandem copies of the HA epitope was inserted
in the proper reading frame into a NotI site that was
engineered by site-directed mutagenesis at the very carboxyl-terminal end of NHE3-3HA, followed by a TGA stop codon (20).
The Epithelial Sodium-Hydrogen Antiporter
Na+/H+ Exchanger 3 Accumulates and Is
Functional in Recycling Endosomes*
§,,
,,,¶¶||
Cell Biology and ** Respiratory
Research, Hospital for Sick Children, Toronto, Ontario M5G 1X8, Canada,
the ¶¶ Department of Biochemistry, University of Toronto,
Ontario M5S 1X8, Canada, the ¶ Department of Physiology, McGill
University, Montreal, Quebec H36 1Y6, Canada, the Department of
Cell Biology, University of California, Berkeley, California 94720, and
Bruce Rappaport Medical School, Technion,
Israel Institute of Technology, Haifa 31096, Israel
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-mannosidase
II and calnexin were kind gifts from Drs. K. W. Moremen and M. Farquhar (University of California at San Diego) and D. B. Williams (University of Toronto), respectively. -Minimal essential
medium and Dulbecco's minimal Eagle's medium/Ham's F12 (1:1) were
purchased from the Ontario Cancer Institute Tissue Culture
Service (Toronto, Canada). Fetal bovine serum was acquired from Cansera
(Toronto, Canada).
(CGCGGGAAGCTTGCCGCCACCATGTCTACAGGGGTGCCT) and 3
(CGCGGGGGATCCGAGACACACCACACAAT) ends. The primers were
designed to isolate the full coding sequence of Cbv and to generate 5
HindII and 3 BamHI restriction sites in the
resulting product. These sites were then used to place the Cbv cDNA
in the CD2B
1 expression vector (a pCDM8-derived plasmid containing
the CH2 and CH3 domains of the human IgG) to create an in-frame fusion
of the COOH terminus of Cbv and these two peptides. The resulting
chimeric Cbv-Ig cDNA was then transferred to the CD43/hsfi
vector
via HindIII and HpaI sites to create a plasmid
suitable for generating stable transfectants. Cd43/hsfi is a
pCDM8-derived plasmid that contains CD43 in the polylinker region,
confers resistance to hygromycin B, and has an inactivated SV40 origin
of replication. The expression plasmid for a chimera of the
trans-Golgi network protein TGN38 fused to the extracellular domain of the T-cell antigen (TGN38-CD25) was a generous gift of Dr.
J. S. Bonifacino (National Institutes of Health, Bethesda, MD).
Cell Lines--
AP-1 cells are CHO cells devoid of endogenous
NHE activity. They were generated by chemical mutagenesis followed by
selection using the H+ suicide technique (17), as described
by Rotin and Grinstein (18). These cells were cultured in -minimal
essential medium containing 10% fetal bovine serum and
NaHCO3. TRVb1 cells, a CHO cell line stably transfected
with human Tfn-R, were a generous gift of Dr. T. E. McGraw
(Cornell University Medical School, New York, NY). They were cultured
in McCoy's 5A medium supplemented with 5% fetal bovine serum,
NaHCO3, and 100 µg/ml G418. All cell lines were grown at
37 °C in a humidified 95% air, 5% CO2 atmosphere.
Transfection-- Cells were plated in 12-well plates and transfected by calcium phosphate precipitation (21). The NHE1-HA and NHE3-HA constructs were transfected into AP-1 cells. Stable transfectants (AP-1NHE3HA and AP-1NHE1HA) were selected by subjecting the cells to an acid challenge, as described by Pouyssegur et al. (17). Clonal lines were acid-challenged on a monthly basis to eliminate revertants and maintain stable functional expression of the exchanger. pCbv-Ig was co-transfected into AP-1 and AP-1NHE3HA cells with the plasmid pcDNA3, which confers resistance to G418. The TGN38-CD25 construct was also co-transfected with pcDNA3 into AP-1NHE3HA cells. Clonal lines (AP-1Cbv-Ig, AP-1NHE3HA/Cbv-Ig, and AP-1NHE3HA/TGN38) were selected in the presence of 250 µg/ml G418.
pNHE3HA was co-transfected into TRVb1 cells with the plasmid pMSCVhph, which contains a gene that confers resistance to hygromycin. To obtain stable expression of both TRVb1 and NHE3HA, cells were selected in the presence of 400 µg/ml hygromycin and by acid challenge. Because TRVb1 cells probably express endogenous NHE1, the acid challenge was performed in the presence of 1 µM HOE 693, a benzoyl guanidinium compound that at the concentration used selectively inhibits NHE1 but not NHE3 (1, 6).Immunoblotting-- Membranes were isolated from stably transfected cells grown to 80-90% confluence on 10-cm dishes as described previously (22). Samples containing about 25 µg of protein were subjected to SDS-PAGE in 7.5% acrylamide gels and transferred to nitrocellulose filters. Blots were blocked with 0.2% gelatin and exposed to the primary antibody (monoclonal anti-HA Ab; 1:10,000 dilution). Horseradish peroxidase-conjugated goat anti-mouse secondary Ab was applied (1:5000 dilution), and immunoreactive bands were visualized using enhanced chemiluminescence (Amersham Corp.).
Fluorescence Microscopy-- For fluorescence microscopy, cells expressing the constructs of interest were plated on 18-mm coverslips 48 h prior to immunostaining. To examine the subcellular localization of HA-tagged proteins, cells were fixed in 2% paraformaldehyde in PBS for 30 min, placed in 100 mM glycine in PBS for 15 min to scavenge any residual fixative, and then permeabilized with 0.1% Triton X-100 in PBS containing 0.1% bovine serum albumin for 15 min. The cells were next incubated in PBS with 5% donkey serum for 20 min. Fixation, permeabilization, and subsequent incubations were at room temperature. Permeabilized cells were then incubated for 1 h with the indicated primary Ab diluted in PBS with 5% donkey serum at the following dilutions: HA, 1:1000; mannosidase II, 1:500; calnexin, 1:200. Next, the cells were washed with PBS three times over 15 min and incubated for 1 h with either Cy3-labeled anti-mouse Ab, FITC-labeled anti-rabbit Ab, or both. Finally, cells were mounted with DAKO mounting medium.
To compare the distribution of NHE3HA and TGN38, AP-1NHE3HA/TGN38 cells were fixed, permeabilized, and labeled with the anti-HA Ab followed by Cy3-conjugated anti-mouse secondary Ab, as described above. Finally, the cells were stained with FITC-conjugated anti-CD25 Ab, washed, and mounted. To label lysosomes, AP-1NHE3HA cells were incubated with 30 mg/ml fixable FITC-conjugated dextran for 12 h at 37 °C. The dextran was then chased over a 4-h period. Cells were then fixed with 2% paraformaldehyde at 4 °C for 20 h and then permeabilized and stained for HA as described above. For Tfn-R localization experiments, cells were washed three times with serum-free medium and then incubated at 37 °C with the same medium containing 20 µg/ml of either FITC- or TRITC-labeled Tfn for 30 min. The cells were then washed, chased for 15-60 min, fixed, and permeabilized as above. To determine the distribution of Cbv, AP-1NHE3/Cbv-Ig cells were washed three times with serum-free medium and incubated at 37 °C with the same medium containing 100 µg/ml FITC-conjugated goat anti-human IgG for 30 min. Cells were next washed and incubated for 1 h in serum-free medium at 37 °C and then fixed and permeabilized as above. The distribution of Cbv was also examined by first fixing and permeabilizing the cells and then labeling with the FITC-conjugated Ab. Comparable results were obtained with both methods. Images were acquired using a Leica laser-confocal microscope with a × 100 plan-apochromat lens (1.4 N.A.). Digitized images were processed with Adobe Photoshop (Adobe Systems, Inc., Mountain View, CA) and assembled and labeled in PowerPoint (Microsoft, Seattle, WA).Fluorescence Ratio Imaging pH Measurements-- To determine endosomal pH (pHE), cells plated on a 25-mm glass coverslip (Fisher) 48 h prior to use were incubated with the FITC-conjugated F(ab) fragment of goat anti-human Ab or with FITC-labeled Tfn as described above. The coverslip was then placed in a Leiden CoverSlip Dish (Medical Systems Corp., Greenvale, NY) in a temperature-regulated perfusion chamber (Open Perfusion Micro-Incubator; Medical Systems Corp.) on the stage of an inverted microscope (Axiovert 135; Zeiss Oberkochen, Germany) equipped with a × 63 oil immersion objective and epifluorescence optics. An electronically controlled shutter and filter-wheel (Sutter Instruments Co., Novato, CA) was used to alternately position two excitation filters (490BP10 and 440BP10 nm) in front of a xenon lamp. The fluorescent signals were processed through a 535BP25 nm band-pass filter. The digitized images were captured on a cooled CCD camera (Princeton Instruments Inc., Princeton, NJ). Data were recorded every 60-120 s by irradiating the cells for 1 s at each wavelength. At the end of each experiment, calibration was obtained by equilibrating the cells in isotonic K+-rich medium buffered to varying pH values between 7.6 and 5.0 in the presence of the K+/H+ ionophore nigericin (5 µM), as described by Garcia-Cabado et al. (22). Metafluor Imaging System software (Universal Imaging Corp.) was used to control image acquisition, calculate the ratio of the dual excitation images, construct ratio/pH calibration curves, and determine the actual pH.
pHc was determined as described previously. Briefly, cells plated on coverslips were loaded with a 2 µg/ml concentration of the acetoxymethyl ester precursor of BCECF at 37 °C for 10 min, washed, and placed in Leiden CoverSlip holders as above. pHc was determined in a fashion identical to that described for endosomes with the exception that a much shorter excitation period (75 ms) and neutral density filters were used to minimize photolysis of the dye and the attendant cytotoxicity. NHE activity was assessed as the rate of Na+-induced recovery of pHc following an acid load imposed by preloading with NH4Cl (for details, see Ref. 22). Where specified, the cells were incubated at 37 °C in serum-free medium supplemented with colchicine (25 µM, 45 min), brefeldin A (5 µg/ml, 60 min), wortmannin (10 nM, 45 min), or forskolin (10 µM, 10 min) prior to loading with BCECF or before being fixed and permeabilized to examine the effects of these drugs on the subcellular distribution of NHE3.| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Functional Expression of Epitope-tagged NHE1 and NHE3-- To facilitate the detection of NHE3 in heterologous expression systems, an immunogenic epitope derived from the influenza virus HA was attached to the carboxyl terminus of the protein, yielding NHE3-HA. The site of attachment was chosen because truncation analyses showed earlier that this region of the antiporter is not essential for NHE3 function (22). To increase the availability and immunogenicity of the protein, a construct was also made expressing three tandem HA repeats (NHE-3HA). For comparison, the ubiquitous NHE1 isoform was tagged with a single HA epitope (NHE1-HA). Schematic representations of these constructs are shown in Fig. 1A. Such constructs were stably transfected into an antiport-deficient CHO cell line, termed AP-1, and the expression and intactness of the protein were assessed by immunoblotting with anti-HA Ab. Typical results are shown in Fig. 1B. Immunoreactive bands of the predicted molecular mass (~100 kDa for NHE1-HA; ~85 and 88 kDa for NHE3-HA and NHE3-3HA, respectively) were readily detectable in whole-cell extracts. Cells transfected with untagged NHE1 or NHE3 failed to react with the Ab, implying that the immunoreactivity is specific to the HA epitope.
|
|
Subcellular Distribution of NHE1-HA and NHE3-HA-- Immunofluorescence confocal microscopy was used to define the subcellular distribution of NHE1 and NHE3 in AP-1 cells. As described earlier for the unmodified form of NHE1, the epitope-tagged protein was found predominantly at the surface membrane (Fig. 3A). Transverse (x versus z) reconstructions confirmed the superficial staining and additionally showed some accumulation at or near lamellipodia, consistent with an earlier report (23) and with the notion that epithelial basolateral proteins expressed in nonepithelial cells concentrate in lamellipodia (24). Only a small fraction of NHE1-HA appeared to be intracellular, possibly reflecting immature protein that can occasionally be detected by SDS-polyacrylamide gel electrophoresis as a lower molecular weight, nonglycosylated species.
|
-mannosidase II, a marker of medial and trans-Golgi
cisternae (25) (Fig. 4, A versus D). However, the location
and morphology of the Golgi cisternae are distinct from that of
NHE3-HA, implying that the antiporter resides in a separate
compartment. Similarly, the trans-Golgi network marker TGN38
(26) was found adjacent to NHE3-HA, in a neighboring but separate
compartment (Fig. 4, B versus E). The site of NHE3-HA
accumulation was also readily discernible from lysosomes, which in CHO
cells distribute randomly throughout the cell (Fig. 4, C and
F).
|
|
Effect of Colchicine on NHE3-HA Distribution and Activity-- Recycling endosomes are thought to accumulate in the vicinity of the nucleus by centripetal movement along microtubules (27). To confirm that NHE3-HA is located in juxtanuclear endosomes, cells were treated with colchicine, an agent known to disassemble microtubules. As illustrated in Fig. 6A, colchicine induced an extensive dispersal of NHE3-HA, yielding a fine punctate distribution with disappearance of the juxtanuclear accumulation. The effect of colchicine on NHE3-HA function, a measure of the number of plasmalemmal transporters, was assessed in acid-loaded cells, as above. Fig. 6B shows that, despite the noticeable rearrangement of intracellular NHE3-HA, transport activity at the surface membrane was unaffected. These findings are in good agreement with earlier observations that, while microtubule disruption results in a dispersion of the recycling endosomal compartment, it has no effect on the recycling of Tfn-R (27).
|
Effect of Brefeldin A on NHE3-HA Distribution and Activity-- Treatment of cells with the fungal metabolite brefeldin A causes tubulation of the vesicular compartment where the Tfn-R is accumulated, ostensibly due to a compaction of the recycling endosomes and the trans-Golgi network (28, 29). To further characterize the compartment where NHE3-HA is localized, we treated cells with brefeldin A (5 µg/ml for 1 h) and examined the subcellular distribution and transport activity of the antiporter. Brefeldin promoted compaction and tubulation of the NHE3-HA compartment, as described earlier for endosomes (Fig. 7A). It also increased the staining at or near the surface membrane. As shown in Fig. 7B, this was accompanied by an increase in the rate of Na+-induced recovery from an acid load (initial rate = 0.24 ± 0.05 pH units/min after brefeldin A versus 0.12 ± 0.01 pH units/s in control; means ± S.E. of four determinations). Although a change in the intrinsic activity of the transporters cannot be ruled out, the data are more readily explained by an increased number of plasmalemmal exchangers, consistent with the enhanced superficial staining. It is noteworthy that while brefeldin reportedly decreases the number of Tfn-R in the membrane, it increases the amount of other recycling proteins at the surface (30-32).
|
NHE3-HA Is Functional in Endosomes-- To determine if NHE3-HA in the endomembrane compartments is functional, we took advantage of its colocalization with Cbv. Although it is accumulated primarily in endosomes, Cbv has the propensity to cycle to the plasma membrane (35). This constitutive translocation process was harnessed to deliver a pH-sensitive fluorophore specifically into the recycling compartment (see Fig. 8A for a schematic representation of this strategy). Cells expressing NHE3-HA and the Cbv-IgGH chimera described above were incubated with FITC-conjugated F(ab) fragments of antibodies to human IgGH. After binding to the extracellular domain of the chimera, the labeled antibodies were internalized and ferried retrogradely to the recycling endosomes, where they accumulate. The fluorescein moiety attached to the antibody then serves as a spectroscopic reporter of the luminal pH of the endosomal compartment, which was monitored by dual excitation ratio imaging, as detailed under "Materials and Methods." Typical results are presented in Fig. 8, B and C. The steady-state pH of the endocytic Cbv-containing compartment (pHE) averaged 6.77 ± 0.06 (mean ± S.E., n = 4) in antiport-deficient AP-1 cells, in the range reported earlier for recycling endosomes using other approaches (12, 36). As expected, the moderate endosomal acidification was fully dissipated by the addition of concanamycin, a selective inhibitor of vacuolar H+ pumps. Similar results were obtained using fluoresceinated transferrin in TrVb1 cells (Table I).
|
|
HA (TrVb1/NHE3HA cells), using
FITC-Tfn as the probe (Table I). The acidification of the endosomal
lumen of these cells was maintained in part by the vacuolar
H+ pump, as indicated by the partial dissipation observed
upon the addition of concanamycin (Fig. 8B). However, a
sizable component of the acidification persisted in the presence of
concanamycin. Because this additional component was observed only in
cells expressing NHE3-HA, we hypothesized that it might be attributable
to luminal accumulation of H+ as a result of
Na+/H+ exchange. In support of this notion, we
found that removal of extracellular Na+ rendered the
pHE of NHE3-transfected cells indistinguishable from
that of untransfected AP-1 cells (Table I). Omission of Na+
from the medium had no effect on pHE in the NHE-deficient
AP-1 cells. These findings indicate that the NHE3 resident in endosomes is functional and contributes measurably to the acidification of
pHE. The relative insensitivity of NHE3 to amiloride and
its analogs precluded pharmacological confirmation of this
conclusion.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Measurements of Na+ flux or pH in subcellular fractions of epithelial cells had earlier demonstrated NHE activity in endomembrane vesicles (4, 5, 37). However, neither the type of exchanger involved nor the precise intracellular compartment is known. This is likely due to the coexistence of multiple isoforms of NHE and the complex subcellular architecture of epithelial cells. In the present study, we tried to circumvent these difficulties by transfecting individual isoforms of the exchangers into AP-1 cells. These cells are antiport-deficient, eliminating the confounding effects of multiple NHE isoforms. Moreover, AP-1 cells, which were derived from CHO cells, are nonpolar and relatively flat, facilitating visualization of intracellular compartments.
We found by immunofluorescence that NHE1 was largely present on the surface membrane of AP-1 cells (Fig. 2). This observation is consistent with results of biochemical experiments, where the predominant glycosylated form of NHE1 was quantitatively degraded by extracellular chymotrypsin2 and was readily accessible to impermeant biotin derivatives (38). By contrast, NHE3 was largely inaccessible to impermeant probes (not shown). While this may reflect a paucity of extracellularly oriented side chains, it could instead indicate that this isoform is localized predominantly in intracellular compartments. The latter interpretation is supported by the microscopic visualization of epitope-tagged antiporters, which revealed that NHE3 is located in endomembrane structures, some of which accumulate in a juxtanuclear location. Like the Golgi and TGN, the latter are maintained in a pericentriolar pattern by centripetal transport along microtubules. However, dual labeling experiments showed that the NHE3-containing vesicles are morphologically distinct from the TGN and Golgi complex (Fig. 4, A versus C and B versus E). Furthermore, treatment with brefeldin A to disperse the Golgi stacks by retrograde fusion with the endoplasmic reticulum failed to scatter the NHE3-containing vesicles.
Several lines of evidence suggest that the organelles containing NHE3 are endosomes. First, HA-tagged NHE3 was found to colocalize with Cbv and with Tfn-R, the best available endosomal markers. Secondly, like endosomes, the NHE3-containing vesicles showed juxtanuclear coalescence and tubulation upon treatment with brefeldin A. Similarly, the enlargement of endosomes reported in wortmannin-treated cells occurred also in the case of NHE3 vesicles. Treatment with this drug reportedly reduces the surface exposure of Tfn-R by increasing the rate of internalization while simultaneously inhibiting exocytosis (33, 34). The inhibition of transport noted in Fig. 8B is consistent with a parallel reduction in the number of surface NHE3 molecules. Jointly, these observations indicate that NHE3 is abundant in endosomes, accumulating in a pericentriolar subpopulation, which is likely to be the recycling compartment. In this regard, it is noteworthy that the cytosolic tail of NHE3 contains a consensus endocytic sequence (YXXL), which is not present in NHE1. Endosomal accumulation is unlikely to result from overexpression of NHE3 because NHE1, which was expressed at comparable levels (Fig. 1B), was restricted to the plasmalemma. Moreover, overexpression of proteins with endocytic sequences promotes their accumulation in the surface membrane and not in endosomes (39).
There is precedent for the colocalization of Cbv with transporters believed to reside in apical endosomes. Aquaporin-2, an epithelial isoform of the water channel, was reported to be present in vesicles also expressing Cbv (40). The colocalization of NHE3 with Tfn-R is, at first glance, unexpected. In epithelial cells, the bulk of the Tfn-R is found in basolateral membranes and endosomes. In these cells, separate subpopulations of basolateral and apical endosomes have been postulated to exist (11, 13). However, this notion has been recently challenged in studies that reported mixing of the two types of endosomes (8, 10). Finally, the apical endosomal protein endotubulin was also found to co-segregate with Tfn-R in pericentriolar endosomes (11). Thus, the colocalization of NHE3 with Tfn-R in heterologous expression systems possibly reflects the endosomal localization of this exchanger in native systems.
Measurements of pHE using two different probes indicated that NHE3 is active in endosomes, transporting luminal Na+ in exchange for cytosolic H+. Sustained endosomal acidification via NHE requires a continuous supply of luminal Na+. Luminal Na+ could be provided by the Na+/K+-ATPase, which has been reported to be active in the endosomal membrane (41, 42). However, this is not a universal observation (4), and a recent report using Cbv constructs could not detect Na+ pump activity in recycling endosomes (43). Alternatively, Na+ could be continuously provided by pinocytosis of Na+-rich extracellular fluid. The latter possibility is consistent with the rapid dissipation of the bafilomycin-insensitive component of endosomal acidification upon removal of the extracellular Na+ (Table I). Whether NHE3 contributes to endosomal acidification in epithelial cells awaits direct confirmation; however, an amiloride-insensitive NHE has been shown to modulate the acidification of rat liver endocytic vesicles immediately after their formation (37).
The observation that NHE3 can reside in recycling endosomes raises the possibility that regulation of its activity may be mediated by recruitment of transporters to and from the plasma membrane. A similar mechanism has been proposed for the regulation of epithelial water and H+ transport by aquaporin-2 and H+/K+-ATPases, respectively (44, 45). In accordance with this notion, Mircheff and colleagues (46-48) have reported a shift in the density of the vesicular compartment expressing NHE3 following treatment of renal cells with parathyroid hormone or after the induction of hypertension. These observations are consistent with an intracellular redistribution of the exchangers following treatment with agents that reduce the rate of transport. Moreover, stimulation of NHE3 by epidermal growth factor was found to be sensitive to wortmannin (49), suggesting that vesicular traffic may be involved. This conclusion should be tempered by earlier findings that phosphatidylinositol 3-kinase also participates in the growth factor activation of NHE1, an isoform present almost exclusively at the surface membrane (50). Nevertheless, the possibility that NHE3 may be regulated by modulation of vesicular traffic is attractive.
| |
FOOTNOTES |
|---|
* This study was supported by operating grants from the Medical Research Council of Canada (to J. O. and S. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by a fellowship from the Medical Research Council of Canada.
§§ Supported by a scholarship from the Fonds de la Recherche en Sante du Quebec.
|| An International Scholar of the Howard Hughes Medical Institute. To whom correspondence should be addressed: Division of Cell Biology, 555 University Ave., Toronto, Ontario M5G 1X8, Canada. Tel.: 416-813-5727; Fax: 416-813-5028; E-mail: sga{at}sickkids.on.ca.
1
The abbreviations used are: NHE,
Na+/H+ exchanger; Cbv, cellubrevin; CHO,
Chinese hamster ovary; HA, hemagglutinin; pHE, endosomal pH; pHc, cytosolic pH; Tfn, transferrin; Tfn-R, transferrin
receptor; FITC, fluorescein isothiocyanate; Ab, antibody; PBS,
phosphate-buffered saline; TGN, trans-Golgi network; BCECF,
5,7-bis(carboxyethyl)carboxyfluorescein; TRITC, tetramethylrhodamine
isothiocyanate.
2 L. Shrode, J. Orlowski, and S. Grinstein, unpublished observations.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
-
Noel, J.,
and Pouyssegur, J.
(1995)
Am. J. Physiol.
268,
C283-C296
[Abstract/Free Full Text] -
Yun, C. H.,
Tse, C. M.,
Nath, S. K.,
Levine, S. A.,
Brant, S. R.,
Donowitz, M.
(1995)
Am. J. Physiol.
269,
G1-G11
[Abstract/Free Full Text] -
Orlowski, J.,
and Grinstein, S.
(1997)
J. Biol. Chem.
272,
22373-22376
[Free Full Text] -
Hilden, S. A.,
Ghoshroy, K. R.,
and Madias, N. E.
(1990)
Am. J. Physiol.
258,
F1311-F1319
[Abstract/Free Full Text] -
Sabolic, I.,
and Brown, D.
(1990)
Am. J. Physiol.
258,
F1245-F1253
[Abstract/Free Full Text] - Soleimani, M., and Singh, G. (1995) J. Invest. Med. 43, 419-430 [Medline] [Order article via Infotrieve]
- Biemesderfer, D., Rutherford, P. A., Nagy, T., Pizzonia, J. H., Abu-Alfa, A. K., Aronson, P. S. (1995) J. Am. Soc. Nephrol. 6, 372 (Abstr. 455)
-
Apodaca, G.,
Katz, L. A.,
and Mostov, K. E.
(1994)
J. Cell Biol.
125,
67-86
[Abstract/Free Full Text] - Knight, A., Hughson, E., Hopkins, C. R., Cutler, D. F. (1995) Mol. Biol. Cell. 6, 597-610[Abstract]
-
Odorizzi, G.,
Pearse, A.,
Domingo, D.,
Trowbridge, I. S.,
Hopkins, C. R.
(1996)
J. Cell Biol.
135,
139-152
[Abstract/Free Full Text] -
Wilson, J. M.,
and Colton, T. L.
(1997)
J. Cell Biol.
136,
319-330
[Abstract/Free Full Text] - Gruenberg, J., and Maxfield, F. R. (1995) Curr. Opin. Cell Biol. 7, 552-563[CrossRef][Medline] [Order article via Infotrieve]
- Matter, K., and Mellman, I. (1994) Curr. Opin. Cell Biol. 6, 545-554[CrossRef][Medline] [Order article via Infotrieve]
- Mellman, I. (1996) Annu. Rev. Cell. Dev. Biol. 12, 575-625 [CrossRef][Medline] [Order article via Infotrieve]
-
Musch, A.,
Xu, H.,
Shields, D.,
and Rodriguez-Boulan, E.
(1996)
J. Cell Biol.
133,
543-558
[Abstract/Free Full Text] -
Yoshimori, T.,
Keller, P.,
Roth, M. G.,
Simons, K.
(1996)
J. Cell Biol.
133,
247-256
[Abstract/Free Full Text] -
Pouyssegur, J.,
Sardet, C.,
Franchi, A.,
L'Allemain, J.,
and Paris, S.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
4833-4837
[Abstract/Free Full Text] -
Rotin, D.,
and Grinstein, S.
(1989)
Am. J. Physiol.
257,
C1158-C1165
[Abstract/Free Full Text] -
Orlowski, J.,
and Kandasamy, R.
(1996)
J. Biol. Chem.
271,
19922-19927
[Abstract/Free Full Text] - Deng, W. P., and Nickoloff, J. A. (1992) Anal. Biochem. 200, 81-88[CrossRef][Medline] [Order article via Infotrieve]
-
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell Biol.
7,
2745-2752
[Abstract/Free Full Text] -
Garcia-Cabado, A. G.,
Yu, F. H.,
Kapus, A.,
Lukacs, G.,
Grinstein, S.,
and Orlowski, J.
(1996)
J. Biol. Chem.
271,
3590-3599
[Abstract/Free Full Text] - Grinstein, S., Woodside, M., Waddell, T. K., Downey, G. P., Orlowski, J., Pouyssegur, J., Wong, D. C., Foskett, J. K. (1993) EMBO J. 12, 5209-5218[Medline] [Order article via Infotrieve]
-
Peranen, J.,
Auvinen, P.,
Virta, H.,
Wepf, R.,
and Simons, K.
(1996)
J. Cell Biol.
135,
153-167
[Abstract/Free Full Text] -
Velasco, A.,
Hendricks, L.,
Moremen, K. W.,
Tulsiani, D. R.,
Touster, O.,
Farquhar, M. G.
(1993)
J. Cell Biol.
122,
39-51
[Abstract/Free Full Text] -
Shapiro, J.,
Sciaky, N.,
Lee, J.,
Bosshart, H.,
Angeletti, R. H.,
Bonifacino, J. S.
(1997)
J. Histochem. Cytochem.
45,
3-12
[Abstract/Free Full Text] - Thatte, H. S., Bridges, K. R., and Golan, D. E. (1994) J. Cell. Physiol. 160, 345-357[CrossRef][Medline] [Order article via Infotrieve]
- Cole, N. B., and Lippincott-Schwartz, J. (1995) Curr. Opin. Cell Biol. 7, 55-64[CrossRef][Medline] [Order article via Infotrieve]
-
Wood, S. A.,
and Brown, W. J.
(1992)
J. Cell Biol.
119,
273-285
[Abstract/Free Full Text] - Damke, H., Klumperman, J., von Figura, K., Braulke, T. (1992) Biochem. Biophys. Res. Commun. 185, 719-727[CrossRef][Medline] [Order article via Infotrieve]
-
Wan, J.,
Taub, M. E.,
Shah, D.,
and Shen, W. C.
(1992)
J. Biol. Chem.
267,
13446-13450
[Abstract/Free Full Text] - Schonhorn, J. E., and Wessling-Resnick, M. (1994) Mol. Cell. Biochem. 135, 159-169[CrossRef][Medline] [Order article via Infotrieve]
-
Shpetner, H.,
Joly, M.,
Hartley, D.,
and Corvera, S.
(1996)
J. Cell Biol.
132,
595-605
[Abstract/Free Full Text] -
Martys, J. L.,
Wjasow, C.,
Gangi, D. M.,
Kielian, M. C.,
McGraw, T. E.,
Backer, J. M.
(1996)
J. Biol. Chem.
271,
10953-10962
[Abstract/Free Full Text] - McMahon, H. T., Ushkaryov, Y. A., Edelmann, L., Link, E., Binz, T., Niemann, H., Jahn, R., and Sudhof, T. C. (1993) Nature 364, 346-349[CrossRef][Medline] [Order article via Infotrieve]
- Dunn, K. W., Mayor, S., Myers, J. N., Maxfield, F. R. (1994) FASEB J. 8, 573-582[Abstract]
-
Van Dyke, R. W.
(1995)
Am. J. Physiol.
269,
C943-C954
[Abstract/Free Full Text] -
Goss, G. G.,
Woodside, M.,
Wakabayashi, S.,
Pouyssegur, J.,
Waddell, T.,
Downey, G. P.,
Grinstein, S.
(1994)
J. Biol. Chem.
269,
8741-8748
[Abstract/Free Full Text] -
Marks, M. S.,
Woodruff, L.,
Ohno, H.,
and Bonifacino, J. S.
(1996)
J. Cell Biol.
135,
341-354
[Abstract/Free Full Text] -
Franki, N.,
Macaluso, F.,
Schubert, W.,
Gunther, L.,
and Hays, R. M.
(1995)
Am. J. Physiol.
269,
C797-C801
[Abstract/Free Full Text] -
Cain, C. C.,
Sipe, D. M.,
and Murphy, R. F.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
544-548
[Abstract/Free Full Text] -
Fuchs, R.,
Schmid, S.,
and Mellman, I.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
539-543
[Abstract/Free Full Text] - Teter, K., Pereyra, K., Chandy, G., Machen, T. E., Moore, H.-P. H. (1996) Mol. Biol. Cell. 7, 327 (Abstr. 1898)
- Brown, D., and Sabolic, I. (1993) J. Cell Sci. (Suppl.) 17, 49-59[Medline] [Order article via Infotrieve]
- Courtois-Coutry, N., Roush, D., Rajendran, V., Geibel, J., Kashgarian, M., and Caplan, M. J. (1996) Mol. Biol. Cell. 7, 80 (Abstr. 465)
-
Hensley, C. B.,
Bradley, M. E.,
and Mircheff, A. K.
(1989)
Am. J. Physiol.
257,
C637-C645
[Abstract/Free Full Text] - Zhang, Y., Magyar, M. F., Holstein-Rathlou, N. H., Mircheff, A. K., McDonough, A. A. (1996) J. Am. Soc. Nephrol. 7, 1265 (Abstr. 0083)
-
Zhang, Y.,
Mircheff, A. K.,
Hensley, C. B.,
Magyar, C. E.,
Warnock, D. G.,
Chambrey, R.,
Yip, K. P.,
Marsh, D. J.,
Holstein-Rathlou, N. H.,
McDonough, A. A.
(1996)
Am. J. Physiol.
270,
F1004-F1014
[Abstract/Free Full Text] -
Khurana, S.,
Nath, S. K.,
Levine, S. A.,
Bowser, J. M.,
Tse, C. M.,
Cohen, M. E.,
Donowitz, M.
(1996)
J. Biol. Chem.
271,
9919-9927
[Abstract/Free Full Text] -
Ma, Y.-H.,
Reusch, H. P.,
Wilson, E.,
Escobedo, J. A.,
Fantl, W. J.,
Williams, L. T.,
Ives, H. E.
(1994)
J. Biol. Chem.
269,
30734-30739
[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. T. Alexander and S. Grinstein Tethering, recycling and activation of the epithelial sodium-proton exchanger, NHE3 J. Exp. Biol., June 1, 2009; 212(11): 1630 - 1637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Donowitz, S. Mohan, C. X. Zhu, T.-E Chen, R. Lin, B. Cha, N. C. Zachos, R. Murtazina, R. Sarker, and X. Li NHE3 regulatory complexes J. Exp. Biol., June 1, 2009; 212(11): 1638 - 1646. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. M. Haggie and A. S. Verkman Defective organellar acidification as a cause of cystic fibrosis lung disease: reexamination of a recurring hypothesis Am J Physiol Lung Cell Mol Physiol, June 1, 2009; 296(6): L859 - L867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hernandez, X. Jiang, B. Cubero, P. M. Nieto, R. A. Bressan, P. M. Hasegawa, and J. M. Pardo Mutants of the Arabidopsis thaliana Cation/H+ Antiporter AtNHX1 Conferring Increased Salt Tolerance in Yeast: THE ENDOSOME/PREVACUOLAR COMPARTMENT IS A TARGET FOR SALT TOXICITY J. Biol. Chem., May 22, 2009; 284(21): 14276 - 14285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. K. Hoffmann, I. H. Lambert, and S. F. Pedersen Physiology of Cell Volume Regulation in Vertebrates Physiol Rev, January 1, 2009; 89(1): 193 - 277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. He, H. Zhang, and C. C. Yun IRBIT, Inositol 1,4,5-Triphosphate (IP3) Receptor-binding Protein Released with IP3, Binds Na+/H+ Exchanger NHE3 and Activates NHE3 Activity in Response to Calcium J. Biol. Chem., November 28, 2008; 283(48): 33544 - 33553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Donowitz and X. Li Regulatory Binding Partners and Complexes of NHE3 Physiol Rev, July 1, 2007; 87(3): 825 - 872. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. W. Musch, D. L. Arvans, M. M. Walsh-Reitz, K. Uchiyama, M. Fukuda, and E. B. Chang Synaptotagmin I binds intestinal epithelial NHE3 and mediates cAMP- and Ca2+-induced endocytosis by recruitment of AP2 and clathrin Am J Physiol Gastrointest Liver Physiol, June 1, 2007; 292(6): G1549 - G1558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Pullikuth, K. Aimanova, W. Kang'ethe, H. R. Sanders, and S. S. Gill Molecular characterization of sodium/proton exchanger 3 (NHE3) from the yellow fever vector, Aedes aegypti J. Exp. Biol., September 15, 2006; 209(18): 3529 - 3544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Murtazina, O. Kovbasnjuk, M. Donowitz, and X. Li Na+/H+ Exchanger NHE3 Activity and Trafficking Are Lipid Raft-dependent J. Biol. Chem., June 30, 2006; 281(26): 17845 - 17855. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. J. Pepe, M. G. Burch, and E. D. Albrecht Developmental Regulation of the Sodium/Hydrogen Ion Exchangers and Their Regulatory Factors in Baboon Placental Syncytiotrophoblast Endocrinology, June 1, 2006; 147(6): 2986 - 2996. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Cha, M. Tse, C. Yun, O. Kovbasnjuk, S. Mohan, A. Hubbard, M. Arpin, and M. Donowitz The NHE3 Juxtamembrane Cytoplasmic Domain Directly Binds Ezrin: Dual Role in NHE3 Trafficking and Mobility in the Brush Border Mol. Biol. Cell, June 1, 2006; 17(6): 2661 - 2673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Han, K. H. Kim, M. J. Jo, J. H. Lee, J. Yang, R. B. Doctor, O. W. Moe, J. Lee, E. Kim, and M. G. Lee Shank2 Associates with and Regulates Na+/H+ Exchanger 3 J. Biol. Chem., January 20, 2006; 281(3): 1461 - 1469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, H. Cai, L. Cebotaru, D. H. Hryciw, E. J. Weinman, M. Donowitz, S. E. Guggino, and W. B. Guggino ClC-5: role in endocytosis in the proximal tubule Am J Physiol Renal Physiol, October 1, 2005; 289(4): F850 - F862. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. T. Alexander, W. Furuya, K. Szaszi, J. Orlowski, and S. Grinstein Rho GTPases dictate the mobility of the Na/H exchanger NHE3 in epithelia: Role in apical retention and targeting PNAS, August 23, 2005; 102(34): 12253 - 12258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. S. Kocinsky, A. C. C. Girardi, D. Biemesderfer, T. Nguyen, S. Mentone, J. Orlowski, and P. S. Aronson Use of phospho-specific antibodies to determine the phosphorylation of endogenous Na+/H+ exchanger NHE3 at PKA consensus sites Am J Physiol Renal Physiol, August 1, 2005; 289(2): F249 - F258. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. C. Lin, W. P. Williams, Y. Luu, R. S. Molday, J. Orlowski, and M. Numata Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7 J. Cell Sci., May 1, 2005; 118(9): 1885 - 1897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Z. Szabo, M. Numata, V. Lukashova, P. Iannuzzi, and J. Orlowski {beta}-Arrestins bind and decrease cell-surface abundance of the Na+/H+ exchanger NHE5 isoform PNAS, February 22, 2005; 102(8): 2790 - 2795. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Brett, M. Donowitz, and R. Rao Evolutionary origins of eukaryotic sodium/proton exchangers Am J Physiol Cell Physiol, February 1, 2005; 288(2): C223 - C239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Nakamura, S. Tanaka, Y. Teko, K. Mitsui, and H. Kanazawa Four Na+/H+ Exchanger Isoforms Are Distributed to Golgi and Post-Golgi Compartments and Are Involved in Organelle pH Regulation J. Biol. Chem., January 14, 2005; 280(2): 1561 - 1572. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Yang, A. B. Maunsbach, P. K. K. Leong, and A. A. McDonough Differential traffic of proximal tubule Na+ transporters during hypertension or PTH: NHE3 to base of microvilli vs. NaPi2 to endosomes Am J Physiol Renal Physiol, November 1, 2004; 287(5): F896 - F906. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gekle, K. Volker, S. Mildenberger, R. Freudinger, G. E. Shull, and M. Wiemann NHE3 Na+/H+ exchanger supports proximal tubular protein reabsorption in vivo Am J Physiol Renal Physiol, September 1, 2004; 287(3): F469 - F473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Cha, A. Kenworthy, R. Murtazina, and M. Donowitz The lateral mobility of NHE3 on the apical membrane of renal epithelial OK cells is limited by the PDZ domain proteins NHERF1/2, but is dependent on an intact actin cytoskeleton as determined by FRAP J. Cell Sci., July 1, 2004; 117(15): 3353 - 3365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Li, H. Zhang, A. Cheong, S. Leu, Y. Chen, C. G. Elowsky, and M. Donowitz Carbachol regulation of rabbit ileal brush border Na+-H+ exchanger 3 (NHE3) occurs through changes in NHE3 trafficking and complex formation and is Src dependent J. Physiol., May 1, 2004; 556(3): 791 - 804. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hayashi, K. Szaszi, N. Coady-Osberg, W. Furuya, A. P. Bretscher, J. Orlowski, and S. Grinstein Inhibition and Redistribution of NHE3, the Apical Na+/H+ Exchanger, by Clostridium difficile Toxin B J. Gen. Physiol., April 26, 2004; 123(5): 491 - 504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Lee, C. A. Pollock, K. Drumm, J. A. Barden, and P. Poronnik Effects of pathophysiological concentrations of albumin on NHE3 activity and cell proliferation in primary cultures of human proximal tubule cells Am J Physiol Renal Physiol, October 1, 2003; 285(4): F748 - F757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. E. Machen, M. J. Leigh, C. Taylor, T. Kimura, S. Asano, and H.-P. H. Moore pH of TGN and recycling endosomes of H+/K+-ATPase-transfected HEK-293 cells: implications for pH regulation in the secretory pathway Am J Physiol Cell Physiol, July 1, 2003; 285(1): C205 - C214. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Lee-Kwon, K. Kawano, J. W. Choi, J. H. Kim, and M. Donowitz Lysophosphatidic Acid Stimulates Brush Border Na+/H+ Exchanger 3 (NHE3) Activity by Increasing Its Exocytosis by an NHE3 Kinase A Regulatory Protein-dependent Mechanism J. Biol. Chem., May 2, 2003; 278(19): 16494 - 16501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Szaszi, A. Paulsen, E. Z. Szabo, M. Numata, S. Grinstein, and J. Orlowski Clathrin-mediated Endocytosis and Recycling of the Neuron-specific Na+/H+ Exchanger NHE5 Isoform. REGULATION BY PHOSPHATIDYLINOSITOL 3'-KINASE AND THE ACTIN CYTOSKELETON J. Biol. Chem., November 1, 2002; 277(45): 42623 - 42632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Akhter, O. Kovbasnjuk, X. Li, M. Cavet, J. Noel, M. Arpin, A. L. Hubbard, and M. Donowitz Na+/H+ exchanger 3 is in large complexes in the center of the apical surface of proximal tubule-derived OK cells Am J Physiol Cell Physiol, September 1, 2002; 283(3): C927 - C940. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. N. Charney, R. W. Egnor, J. Alexander-Chacko, N. Cassai, and G. S. Sidhu Acid-base effects on intestinal Na+ absorption and vesicular trafficking Am J Physiol Cell Physiol, September 1, 2002; 283(3): C971 - C979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Klisic, M. C. Hu, V. Nief, L. Reyes, D. Fuster, O. W. Moe, and P. M. Ambuhl Insulin activates Na+/H+ exchanger 3: biphasic response and glucocorticoid dependence Am J Physiol Renal Physiol, September 1, 2002; 283(3): F532 - F539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gekle, O. K. Serrano, K. Drumm, S. Mildenberger, R. Freudinger, B. Gassner, H. W. Jansen, and E. I. Christensen NHE3 serves as a molecular tool for cAMP-mediated regulation of receptor-mediated endocytosis Am J Physiol Renal Physiol, September 1, 2002; 283(3): F549 - F558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Nehrke and J. E. Melvin The NHX Family of Na+-H+ Exchangers in Caenorhabditis elegans J. Biol. Chem., August 2, 2002; 277(32): 29036 - 29044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Kim, W. Lee-Kwon, J. B. Park, S. H. Ryu, C. H. C. Yun, and M. Donowitz Ca2+-dependent Inhibition of Na+/H+ Exchanger 3 (NHE3) Requires an NHE3-E3KARP-alpha -Actinin-4 Complex for Oligomerization and Endocytosis J. Biol. Chem., June 21, 2002; 277(26): 23714 - 23724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. R. Gawenis, X. Stien, G. E. Shull, P. J. Schultheis, A. L. Woo, N. M. Walker, and L. L. Clarke Intestinal NaCl transport in NHE2 and NHE3 knockout mice Am J Physiol Gastrointest Liver Physiol, May 1, 2002; 282(5): G776 - G784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hayashi, K. Szaszi, N. Coady-Osberg, J. Orlowski, J. L. Kinsella, and S. Grinstein A Slow pH-dependent Conformational Transition Underlies a Novel Mode of Activation of the Epithelial Na+/H+ Exchanger-3 Isoform J. Biol. Chem., March 22, 2002; 277(13): 11090 - 11096. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ledoussal, A. L. Woo, M. L. Miller, and G. E. Shull Loss of the NHE2 Na+/H+ exchanger has no apparent effect on diarrheal state of NHE3-deficient mice Am J Physiol Gastrointest Liver Physiol, December 1, 2001; 281(6): G1385 - G1396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, T. Galli, S. Leu, J. B Wade, E. J Weinman, G. Leung, A. Cheong, D. Louvard, and M. Donowitz Na+-H+ exchanger 3 (NHE3) is present in lipid rafts in the rabbit ileal brush border: a role for rafts in trafficking and rapid stimulation of NHE3 J. Physiol., December 1, 2001; 537(2): 537 - 552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Cavet, S. Akhter, R. Murtazina, F. Sanchez de Medina, C.-M. Tse, and M. Donowitz Half-lives of plasma membrane Na+/H+ exchangers NHE1-3: plasma membrane NHE2 has a rapid rate of degradation Am J Physiol Cell Physiol, December 1, 2001; 281(6): C2039 - C2048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Aharonovitz, A. Kapus, K. Szaszi, N. Coady-Osberg, T. Jancelewicz, J. Orlowski, and S. Grinstein Modulation of Na+/H+ exchange activity by Cl{-} Am J Physiol Cell Physiol, July 1, 2001; 281(1): C133 - C141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Schwab Function and spatial distribution of ion channels and transporters in cell migration Am J Physiol Renal Physiol, May 1, 2001; 280(5): F739 - F747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gekle, R. Freudinger, and S. Mildenberger Inhibition of Na+--H+ exchanger-3 interferes with apical receptor-mediated endocytosis via vesicle fusion J. Physiol., March 15, 2001; 531(3): 619 - 629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Shenolikar and Edward. J. Weinman NHERF: targeting and trafficking membrane proteins Am J Physiol Renal Physiol, March 1, 2001; 280(3): F389 - F395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chalumeau, D. Du Cheyron, N. Defontaine, O. Kellermann, M. Paillard, and J. Poggioli NHE3 activity and trafficking depend on the state of actin organization in proximal tubule Am J Physiol Renal Physiol, February 1, 2001; 280(2): F283 - F290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bowers, B. P. Levi, F. I. Patel, and T. H. Stevens The Sodium/Proton Exchanger Nhx1p Is Required for Endosomal Protein Trafficking in the Yeast Saccharomyces cerevisiae Mol. Biol. Cell, December 1, 2000; 11(12): 4277 - 4294. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. J. Janecki, M. Janecki, S. Akhter, and M. Donowitz Quantitation of Plasma Membrane Expression of a Fusion Protein of Na/H Exchanger NHE3 and Green Fluorescence Protein (GFP) in Living PS120 Fibroblasts J. Histochem. Cytochem., November 1, 2000; 48(11): 1479 - 1492. [Abstract] [Full Text]
|
|
|
|
|
|
D. W. Good, J. F. Di Mari, and B. A. Watts III Hyposmolality stimulates Na+/H+ exchange and HCO3- absorption in thick ascending limb via PI 3-kinase Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1443 - C1454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. J. Weinman, C. Minkoff, and S. Shenolikar Signal complex regulation of renal transport proteins: NHERF and regulation of NHE3 by PKA Am J Physiol Renal Physiol, September 1, 2000; 279(3): F393 - F399. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Janecki, M. Janecki, S. Akhter, and M. Donowitz Basic Fibroblast Growth Factor Stimulates Surface Expression and Activity of Na+/H+ Exchanger NHE3 via Mechanism Involving Phosphatidylinositol 3-Kinase J. Biol. Chem., March 10, 2000; 275(11): 8133 - 8142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Counillon and J. Pouyssegur The Expanding Family of Eucaryotic Na+/H+ Exchangers J. Biol. Chem., January 7, 2000; 275(1): 1 - 4. [Full Text] [PDF]
|
|
|
|
|
|
C.-W. Chow, S. Khurana, M. Woodside, S. Grinstein, and J. Orlowski The Epithelial Na+/H+ Exchanger, NHE3, Is Internalized through a Clathrin-mediated Pathway J. Biol. Chem., December 31, 1999; 274(53): 37551 - 37558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gekle, K. Drumm, S. Mildenberger, R. Freudinger, B. Gassner, and S. Silbernagl Inhibition of Na+-H+ exchange impairs receptor-mediated albumin endocytosis in renal proximal tubule-derived epithelial cells from opossum J. Physiol., November 1, 1999; 520(3): 709 - 721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. W. MOE Acute Regulation of Proximal Tubule Apical Membrane Na/H Exchanger NHE-3: Role of Phosphorylation, Protein Trafficking, and RegulatoryFactors J. Am. Soc. Nephrol., November 1, 1999; 10(11): 2412 - 2425. [Full Text]
|
|
|
|
|
|
K. Kurashima, S. D'Souza, K. Szaszi, R. Ramjeesingh, J. Orlowski, and S. Grinstein The Apical Na+/H+ Exchanger Isoform NHE3 Is Regulated by the Actin Cytoskeleton J. Biol. Chem., October 15, 1999; 274(42): 29843 - 29849. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Thangaraju, K. Sharma, D. Liu, S.-H. Shen, and C. B. Srikant Interdependent Regulation of Intracellular Acidification and SHP-1 in Apoptosis Cancer Res., April 1, 1999; 59(7): 1649 - 1654. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Francis, E. Jones, E. Levy, R. Martin, S Ponnambalam, and A. Monaco Identification of a di-leucine motif within the C terminus domain of the Menkes disease protein that mediates endocytosis from the plasma membrane J. Cell Sci., January 6, 1999; 112(11): 1721 - 1732. [Abstract] [PDF]
|
|
|
|
|
|
C.-H. C. Yun, G. Lamprecht, D. V. Forster, and A. Sidor NHE3 Kinase A Regulatory Protein E3KARP Binds the Epithelial Brush Border Na+/H+ Exchanger NHE3 and the Cytoskeletal Protein Ezrin J. Biol. Chem., October 2, 1998; 273(40): 25856 - 25863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kurashima, E. Z. Szabo, G. Lukacs, J. Orlowski, and S. Grinstein Endosomal Recycling of the Na+/H+ Exchanger NHE3 Isoform Is Regulated by the Phosphatidylinositol 3-Kinase Pathway J. Biol. Chem., August 14, 1998; 273(33): 20828 - 20836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Teter, G. Chandy, B. Quinones, K. Pereyra, T. Machen, and H.-P. H. Moore Cellubrevin-targeted Fluorescence Uncovers Heterogeneity in the Recycling Endosomes J. Biol. Chem., July 31, 1998; 273(31): 19625 - 19633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Collazo, L. Fan, M. C. Hu, H. Zhao, M. R. Wiederkehr, and O. W. Moe Acute Regulation of Na+/H+ Exchanger NHE3 by Parathyroid Hormone via NHE3 Phosphorylation and Dynamin-dependent Endocytosis J. Biol. Chem., October 6, 2000; 275(41): 31601 - 31608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pol, A. Lu, M. Pons, S. Peiro, and C. Enrich Epidermal Growth Factor-mediated Caveolin Recruitment to Early Endosomes and MAPK Activation. ROLE OF CHOLESTEROL AND ACTIN CYTOSKELETON J. Biol. Chem., September 22, 2000; 275(39): 30566 - 30572. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Szaszi, K. Kurashima, A. Kapus, A. Paulsen, K. Kaibuchi, S. Grinstein, and J. Orlowski RhoA and Rho Kinase Regulate the Epithelial Na+/H+ Exchanger NHE3. ROLE OF MYOSIN LIGHT CHAIN PHOSPHORYLATION J. Biol. Chem., September 8, 2000; 275(37): 28599 - 28606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Hu, L. Fan, L. A. Crowder, Z. Karim-Jimenez, H. Murer, and O. W. Moe Dopamine Acutely Stimulates Na+/H+ Exchanger (NHE3) Endocytosis via Clathrin-coated Vesicles. DEPENDENCE ON PROTEIN KINASE A-MEDIATED NHE3 PHOSPHORYLATION J. Biol. Chem., July 13, 2001; 276(29): 26906 - 26915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Numata and J. Orlowski Molecular Cloning and Characterization of a Novel (Na+,K+)/H+ Exchanger Localized to the trans-Golgi Network J. Biol. Chem., May 11, 2001; 276(20): 17387 - 17394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Szaszi, K. Kurashima, K. Kaibuchi, S. Grinstein, and J. Orlowski Role of the Cytoskeleton in Mediating cAMP-dependent Protein Kinase Inhibition of the Epithelial Na+/H+ Exchanger NHE3 J. Biol. Chem., October 26, 2001; 276(44): 40761 - 40768. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Brett, Y. Wei, M. Donowitz, and R. Rao Human Na+/H+ exchanger isoform 6 is found in recycling endosomes of cells, not in mitochondria Am J Physiol Cell Physiol, May 1, 2002; 282(5): C1031 - C1041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Yang, P. K. K. Leong, J. O. Chen, N. Patel, S. F. Hamm-Alvarez, and A. A. McDonough Acute hypertension provokes internalization of proximal tubule NHE3 without inhibition of transport activity Am J Physiol Renal Physiol, April 1, 2002; 282(4): F730 - F740. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |